ID: 955547054

View in Genome Browser
Species Human (GRCh38)
Location 3:60042299-60042321
Sequence TATCGATGGTAGGACTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955547054_955547060 9 Left 955547054 3:60042299-60042321 CCTCCATAGTCCTACCATCGATA 0: 1
1: 0
2: 0
3: 2
4: 32
Right 955547060 3:60042331-60042353 TAGGACTCTATTAGTTTGCTAGG 0: 1
1: 0
2: 4
3: 43
4: 314
955547054_955547057 -10 Left 955547054 3:60042299-60042321 CCTCCATAGTCCTACCATCGATA 0: 1
1: 0
2: 0
3: 2
4: 32
Right 955547057 3:60042312-60042334 ACCATCGATATATCCTTTGTAGG 0: 1
1: 0
2: 1
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955547054 Original CRISPR TATCGATGGTAGGACTATGG AGG (reversed) Intronic
924130797 1:240906024-240906046 TATGGGTGGTAGGACTATGCCGG - Intronic
924280064 1:242427937-242427959 TAGAGATGGTAGGACCAGGGAGG + Intronic
924395089 1:243609924-243609946 GATAGATGGTGGGACTTTGGTGG - Intronic
1063967554 10:11358747-11358769 TATAGATGGTAGGTCCCTGGAGG - Intergenic
1089709590 11:120305558-120305580 GATCGATGCTAGGACCATGCAGG + Intronic
1093490256 12:19697249-19697271 TATGGTTGGTAGTAGTATGGGGG + Intronic
1113019634 13:105870283-105870305 TATCAATAGTTGGACTATGGGGG - Intergenic
1117394891 14:55299191-55299213 TTTTGATGGTAGGGCTATAGAGG - Intronic
1137499703 16:49000962-49000984 AATGGATGGGAGGACTGTGGCGG + Intergenic
1150230027 17:63544671-63544693 TGTGGATGGCAGGGCTATGGTGG + Intronic
1156816596 18:41318985-41319007 AGTCAATGGAAGGACTATGGAGG - Intergenic
932649098 2:73536274-73536296 TATCGATAGCAGGACACTGGAGG - Intronic
936277850 2:111116418-111116440 TATAGAGGGTAGGGATATGGTGG - Intronic
942550320 2:177108856-177108878 TATCAATGGTAGGTTTGTGGAGG - Intergenic
1169395232 20:5223287-5223309 TATTGATGGTTGGATTATGATGG - Intergenic
1172301261 20:33852177-33852199 TTTTGATGGTAGGGCTATAGAGG - Exonic
1174756423 20:53163024-53163046 TCTGTATAGTAGGACTATGGAGG - Intronic
951190849 3:19769365-19769387 TATATATTGTAGGACTTTGGAGG - Intergenic
955547054 3:60042299-60042321 TATCGATGGTAGGACTATGGAGG - Intronic
961336139 3:126180678-126180700 CACCGGTGGTGGGACTATGGCGG + Intronic
963944621 3:151131831-151131853 TATGGCTGGTTGGACTTTGGAGG + Intronic
969155363 4:5205293-5205315 TGACAATGGTGGGACTATGGAGG + Intronic
972844973 4:42976604-42976626 TATCTATGGAAGGAATATGAGGG - Intronic
996375713 5:122804734-122804756 TTTTAATGGTAGGCCTATGGAGG - Intronic
999705196 5:154266364-154266386 ATTGGATGGTAGGATTATGGAGG + Intronic
1010271806 6:73924066-73924088 TATAGATGGCAGGAGTGTGGGGG + Intergenic
1032888625 7:136169295-136169317 TATCAAAGGGAGGACTTTGGGGG - Intergenic
1033805643 7:144951833-144951855 TAACGAATGTAGGACTCTGGTGG - Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1048966456 8:139618457-139618479 TACCGCTCGCAGGACTATGGCGG - Exonic
1051948323 9:22599331-22599353 TATAGATAGTAGTACTCTGGAGG + Intergenic
1187707413 X:22022285-22022307 TCTCGATGGTATTATTATGGTGG - Intergenic
1192700867 X:73470464-73470486 TTTTGATGGTAGGATTATGCTGG + Intergenic
1193935573 X:87615801-87615823 TATTGGTTGTAGGAATATGGAGG + Intronic
1195464929 X:105169858-105169880 TATGGATGGTAGGGATTTGGTGG + Intronic