ID: 955549430

View in Genome Browser
Species Human (GRCh38)
Location 3:60067804-60067826
Sequence AGGCAGCGACAAGAACGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955549430_955549436 14 Left 955549430 3:60067804-60067826 CCAGCACGTTCTTGTCGCTGCCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 955549436 3:60067841-60067863 GTTCAGACTAACAGTTTGAAGGG 0: 1
1: 0
2: 1
3: 12
4: 157
955549430_955549435 13 Left 955549430 3:60067804-60067826 CCAGCACGTTCTTGTCGCTGCCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 955549435 3:60067840-60067862 GGTTCAGACTAACAGTTTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 101
955549430_955549433 -8 Left 955549430 3:60067804-60067826 CCAGCACGTTCTTGTCGCTGCCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 955549433 3:60067819-60067841 CGCTGCCTAACAGTGATGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 63
955549430_955549437 29 Left 955549430 3:60067804-60067826 CCAGCACGTTCTTGTCGCTGCCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 955549437 3:60067856-60067878 TTGAAGGGCAATAACTAAAATGG 0: 1
1: 0
2: 0
3: 21
4: 333
955549430_955549432 -9 Left 955549430 3:60067804-60067826 CCAGCACGTTCTTGTCGCTGCCT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 955549432 3:60067818-60067840 TCGCTGCCTAACAGTGATGGTGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955549430 Original CRISPR AGGCAGCGACAAGAACGTGC TGG (reversed) Intronic
900080024 1:849678-849700 AGGCAGCGAGAAGCCCTTGCCGG - Intergenic
901805827 1:11737886-11737908 AGTCAGAGACAACAAAGTGCTGG + Intronic
904197126 1:28794291-28794313 AGGCAGCATCAAGAGTGTGCTGG + Intergenic
918464086 1:184804276-184804298 AGGCAGCGAGAAGAATGGTCAGG + Intronic
920178581 1:204118676-204118698 AGGCAGGGACAAGAGTGTGAAGG - Intronic
1064861649 10:19833103-19833125 AGGCAGAGACAAAAAAGGGCAGG + Intronic
1065260779 10:23921430-23921452 AGGAAGTGACAACAATGTGCTGG - Intronic
1071289617 10:84179401-84179423 AAGCCTGGACAAGAACGTGCAGG - Intronic
1072614425 10:97040025-97040047 ATGCAGCAACAAGCACCTGCGGG - Exonic
1077351228 11:2094109-2094131 AGGCAGAGACAGGAACATGCAGG + Intergenic
1083794543 11:65007546-65007568 AGGCACCAGCAAGCACGTGCTGG - Intergenic
1087810667 11:102606449-102606471 AGGCAGCAACAAGGACCTGTGGG + Intronic
1088551051 11:111012627-111012649 AGGCAGAGACAGGACCGTGCAGG + Intergenic
1095347463 12:41168453-41168475 TGGAACCCACAAGAACGTGCTGG + Intergenic
1100780349 12:98018986-98019008 AGGCAGAGACAGGAATGTGGTGG + Intergenic
1110737663 13:78956782-78956804 AGGCAGAGACCAAAAGGTGCAGG - Intergenic
1112234628 13:97624427-97624449 AGGCAGCTACAAGAGAGGGCAGG + Intergenic
1122501689 14:102204395-102204417 AGGGAGAGAAGAGAACGTGCTGG - Intronic
1123672377 15:22672112-22672134 AGGCAGGGATCAGACCGTGCAGG + Intergenic
1124324423 15:28745405-28745427 AGGCAGGGATCAGACCGTGCAGG + Intergenic
1124528301 15:30478447-30478469 AGGCAGGGATCAGACCGTGCAGG + Intergenic
1124770356 15:32529256-32529278 AGGCAGGGATCAGACCGTGCAGG - Intergenic
1128063090 15:64747550-64747572 AGGCAGCCACAGGAAGGGGCTGG - Intronic
1134559122 16:15192602-15192624 AGGCAGGGACCAGATCGTGCAGG - Intergenic
1134919658 16:18104215-18104237 AGGCAGGGACCAGATCGTGCAGG - Intergenic
1136399773 16:30011008-30011030 AGGGAGCGCCGAGAAAGTGCGGG + Exonic
1137707138 16:50543535-50543557 AGGCTGCTACAAGAACATACCGG - Intergenic
1143292106 17:5839129-5839151 AGGCAGCGAGAAAAGGGTGCTGG + Intronic
1146799818 17:35809601-35809623 CGGCAGCGACGAGAAGGTCCTGG + Intronic
1157213346 18:45762297-45762319 AGGCAGAGTCAAGAAGGGGCGGG + Intergenic
1159414360 18:68124988-68125010 AGGCAGGGACAGGATCCTGCTGG + Intergenic
1161966203 19:7550583-7550605 AGGCAGTGGCAAGAAGGAGCTGG + Exonic
1162423085 19:10577236-10577258 GGGCAGCGCCAAGTATGTGCCGG - Exonic
1167279480 19:48558510-48558532 AGGCAGAGATCAGAAGGTGCCGG - Intronic
926431988 2:12796778-12796800 AGACAGCGCCAAGAAGGTCCTGG + Intergenic
927492072 2:23527287-23527309 AGGGAGGGGCAAGCACGTGCTGG - Intronic
933774536 2:85764228-85764250 AGGCAGGGACAGGAACTTGGGGG + Intronic
935456041 2:103268714-103268736 AGAGAGCTACAAGAACGTGAGGG + Intergenic
939960520 2:148561443-148561465 TGGGAGCGCCAAGAATGTGCTGG + Intergenic
948526703 2:238575125-238575147 AGACAGAGACAAGCACGTGGAGG - Intergenic
948808505 2:240463200-240463222 AGGCAGCGACCACCACGAGCTGG + Intronic
1169869990 20:10239872-10239894 AGGCAGCAGCAAGAACCTACAGG + Intronic
1172754612 20:37274387-37274409 ATGCAGCAAAAAGAACTTGCAGG + Intergenic
1176639152 21:9281642-9281664 AGGAAGTGACAAGAAAGTACAGG + Intergenic
1178806530 21:35844420-35844442 TGGCAGCGACAAAAACATGTTGG + Intronic
1180217511 21:46334945-46334967 AGGCAACACTAAGAACGTGCAGG - Intronic
1180372459 22:12054473-12054495 AGGAAGTGACAAGAAAGTACAGG + Intergenic
1180423198 22:12889131-12889153 AGGAAGTGACAAGAAAGTACAGG + Intergenic
1181873856 22:25924619-25924641 AGGCAGGGACCAGAACATACGGG + Intronic
951727385 3:25774960-25774982 AAGCAGCGAGAAGAGCCTGCAGG - Intronic
952817167 3:37455777-37455799 AGGGAGGGAGAAGAATGTGCTGG + Intronic
955549430 3:60067804-60067826 AGGCAGCGACAAGAACGTGCTGG - Intronic
960439135 3:117665445-117665467 AGGCAGCAGGAAGAACATGCTGG + Intergenic
967336784 3:188352835-188352857 AGGCAGCGACGGGAAAGTGAAGG + Intronic
1202747743 3_GL000221v1_random:123385-123407 AGGAAGTGACAAGAAAGTACAGG - Intergenic
972285214 4:37641832-37641854 AGGCAGTGACTGGCACGTGCCGG - Intronic
1202754049 4_GL000008v2_random:40033-40055 AGGAAGTGACAAGAAAGTACAGG + Intergenic
986045206 5:4030205-4030227 AGCCAGTGGCAAGAAGGTGCAGG - Intergenic
986710773 5:10486598-10486620 AGGCAGTGACATCAAGGTGCTGG - Intergenic
995285939 5:110388285-110388307 AGGCACAGACAAGATGGTGCTGG - Intronic
995332022 5:110956718-110956740 AGGCACCGACAAGCACGAGAGGG + Intergenic
1001543905 5:172558373-172558395 AGGCACGGCCCAGAACGTGCAGG + Intergenic
1004205835 6:13591553-13591575 AGGCAGCGTCGGGAAGGTGCAGG - Intronic
1005554102 6:26956173-26956195 AGCCAGCAACAGCAACGTGCTGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1012924333 6:105252390-105252412 AGCCAGGGACAAAAAGGTGCTGG + Intergenic
1013297626 6:108772228-108772250 AGGCAGGGAGGAGAACGTCCTGG + Intergenic
1014005576 6:116414017-116414039 AGGCAGCGACAGGAAGATGATGG + Intronic
1031730944 7:125299658-125299680 AGGAAGTGCCAAGAACGAGCGGG + Intergenic
1034788197 7:153944440-153944462 AGGCAGCGAGAAGAGCGTGTTGG + Intronic
1036459138 8:8936441-8936463 AGGCAGGGGCAAGAACCTTCTGG - Intergenic
1037655285 8:20877842-20877864 AGGCAGCTCCCAGAATGTGCTGG + Intergenic
1039877458 8:41599135-41599157 AGGCAGCAACAGGAACATGGTGG - Exonic
1051665252 9:19462695-19462717 AGGCAGGGACCAGATCGTGGAGG - Intergenic
1059709164 9:116851716-116851738 AGGCAACAACAAAAACGTGAAGG + Intronic
1203716378 Un_KI270742v1:153476-153498 AGGAAGTGACAAGAAAGTACAGG - Intergenic
1203534837 Un_KI270743v1:24759-24781 AGGAAGTGACAAGAAAGTACAGG + Intergenic
1190797692 X:53759942-53759964 AGCCAGCAATAAGAACGTGCAGG - Intergenic