ID: 955554924

View in Genome Browser
Species Human (GRCh38)
Location 3:60126677-60126699
Sequence GCATTTATGAGCGTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955554924_955554927 21 Left 955554924 3:60126677-60126699 CCACAGCACACGCTCATAAATGC 0: 1
1: 0
2: 1
3: 11
4: 104
Right 955554927 3:60126721-60126743 TCAACAATGTCCCTGCCAAATGG 0: 1
1: 0
2: 0
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955554924 Original CRISPR GCATTTATGAGCGTGTGCTG TGG (reversed) Intronic
900293911 1:1939210-1939232 GCATATGTGTGTGTGTGCTGGGG + Intronic
905177039 1:36143235-36143257 GCATTTACGTGTGTGTGTTGGGG + Intronic
906854892 1:49293217-49293239 GCATGTCTGAGTGTGTGCAGTGG + Intronic
908683390 1:66687595-66687617 GCATTTAAGAGCGTGAGCTTTGG + Intronic
910680834 1:89862726-89862748 GCAATTATGAACATGTGCTCTGG - Intronic
911672896 1:100627396-100627418 GGAGTTATGAGCGTGGGCAGTGG + Intergenic
914756210 1:150562836-150562858 TCCTTTCTGAGGGTGTGCTGGGG + Intergenic
917468532 1:175306415-175306437 GCATTTAAGAGAGTTGGCTGTGG - Intergenic
919886514 1:201938872-201938894 GCTTTTCTGAGCTTGTGCTGGGG + Intronic
920169715 1:204064083-204064105 ACATTTCTGAGCATGTGCTATGG - Intergenic
920353112 1:205350857-205350879 GCATGTGTGTGTGTGTGCTGAGG + Intronic
922650755 1:227336126-227336148 GAATTCATGAGTGTCTGCTGGGG + Intergenic
924698768 1:246428707-246428729 GCAGTTAAGAGCATGGGCTGTGG - Intronic
924698773 1:246428754-246428776 GCAGTTAAGAGCATGGGCTGTGG - Intronic
1062820875 10:533735-533757 GCATTTATCTCCGTGTGCAGGGG - Intronic
1063242987 10:4190726-4190748 GCATTTATGACCGTGTCTGGTGG + Intergenic
1067352523 10:45489170-45489192 GCAATTTTGAGTGTGTGTTGGGG - Intronic
1077221893 11:1421638-1421660 GATGTTCTGAGCGTGTGCTGAGG + Intronic
1078604304 11:12761630-12761652 GCATTCATGAGGGTGGGCAGAGG + Intronic
1079449288 11:20585424-20585446 CCATGTATGTGCGTGTGTTGTGG - Intergenic
1087622479 11:100558181-100558203 GAATTTATGAGCCTGATCTGTGG + Intergenic
1090473650 11:127001273-127001295 GCATTTCTGAGAGTTTCCTGTGG + Intronic
1092099561 12:5871937-5871959 GCTTTCCTGAGCATGTGCTGTGG - Intronic
1092887684 12:12939417-12939439 TCCTTTATGAGCATCTGCTGGGG + Intergenic
1097611550 12:61828425-61828447 GGATTTATGACCATGTGTTGAGG - Intronic
1097745761 12:63301424-63301446 GAATTTTTGAGGGTGTGCTCAGG + Intergenic
1098558349 12:71844573-71844595 GCATTTATTAGGGCTTGCTGTGG + Intronic
1101718580 12:107332057-107332079 GCAGCTGGGAGCGTGTGCTGGGG + Intronic
1102237871 12:111305916-111305938 GCATGTGTTAGTGTGTGCTGTGG + Intronic
1110621151 13:77597205-77597227 GCATATGTGTGCCTGTGCTGAGG + Intronic
1113665604 13:112139769-112139791 GCGTTAATGAGCGTGTGCATGGG + Intergenic
1118457847 14:65960942-65960964 GCAGTTATGAGCATGGGCTTTGG - Intronic
1120452590 14:84687773-84687795 ACATTTAAGAGCGTGTGCTGGGG - Intergenic
1120452605 14:84687972-84687994 ACATTTAAGAGAGTGTGCTGGGG - Intergenic
1129599948 15:76993007-76993029 GAAGTTAAGAGCGTGTGCTTTGG + Intergenic
1133939478 16:10296441-10296463 ACGTTTATTAGCATGTGCTGGGG + Intergenic
1135085013 16:19468348-19468370 GCATTTTTGTGTGTGTGCTCAGG + Intronic
1139178911 16:64722746-64722768 GCATTTATGAGTCCCTGCTGTGG + Intergenic
1141983439 16:87564145-87564167 GCATTTGTGTGCGTGTGTTGGGG + Intergenic
1146719737 17:35115561-35115583 GCCTTTCTTACCGTGTGCTGTGG - Intronic
1152086824 17:78225180-78225202 GCTTCTGTGAGCCTGTGCTGTGG + Exonic
1152472465 17:80498094-80498116 GTATATGTGAGTGTGTGCTGGGG + Intergenic
1160046826 18:75393840-75393862 GGATTTATGAGCATGAGCTGTGG + Intergenic
1161596492 19:5153626-5153648 TCATTTCTGAGCCTGTGCTAGGG + Intergenic
1167609752 19:50501454-50501476 GCTTTCATGAGTGTGTCCTGCGG + Intergenic
930132114 2:47862681-47862703 GCATTTATGTACTTGTACTGTGG - Intronic
930188942 2:48438421-48438443 CCATTTTTGTGTGTGTGCTGTGG + Intergenic
931052610 2:58430423-58430445 CCATTTATGAGAATGTGCTTGGG - Intergenic
933506044 2:83178288-83178310 GCATTTATGAGCATTCACTGAGG - Intergenic
935675579 2:105592625-105592647 GAATTCATGTGGGTGTGCTGGGG - Intergenic
937420958 2:121755099-121755121 GCTTTTTTAAGCGTGTGCGGTGG - Intronic
940014557 2:149089997-149090019 GCATCTAAGAGTGTGTGATGGGG + Intronic
946117903 2:217479601-217479623 GGATTTATGAGGGTCTGCTGGGG - Intronic
1172190415 20:33058981-33059003 GCATTTGTGTGAGTGTGCAGGGG + Intronic
1173325067 20:42025679-42025701 ACATTTGTGAGCGTTTGGTGAGG + Intergenic
1174127448 20:48317488-48317510 GCATGGATGAGGGTGGGCTGAGG - Intergenic
1175409429 20:58756371-58756393 GGATTTATGAGCGTCTCCTGCGG - Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG + Intergenic
1181051534 22:20240422-20240444 GCTTCTCTGTGCGTGTGCTGCGG - Intergenic
1182875676 22:33689326-33689348 GCATTCATCAGGGTGTGCTCTGG - Intronic
1183801696 22:40171446-40171468 GCATTTATGGCCGGGTGCGGTGG - Intronic
1185142863 22:49113002-49113024 GCACTGATGAGAGTGTGGTGTGG + Intergenic
949258225 3:2076047-2076069 GAAATTATGCGTGTGTGCTGGGG + Intergenic
950435101 3:12974729-12974751 GCATTTTTGATCGTCAGCTGGGG - Intronic
952169700 3:30793177-30793199 GCATTTGTGAAAGTATGCTGTGG - Intronic
953346043 3:42176547-42176569 GTGTGTATGAGCATGTGCTGAGG - Intronic
954706346 3:52482782-52482804 GCATGCATGAGCGAATGCTGGGG + Intronic
955554924 3:60126677-60126699 GCATTTATGAGCGTGTGCTGTGG - Intronic
961602284 3:128071391-128071413 GCATTCCTAAGCGTGGGCTGGGG - Exonic
962043351 3:131730717-131730739 GCATTTCTTGGCTTGTGCTGAGG - Intronic
967789378 3:193530910-193530932 GTGTATATGAGCGTGTGGTGGGG - Intronic
968691184 4:1991166-1991188 GCATTTCTGAGCATGTACTCTGG + Intronic
979291166 4:118980513-118980535 GCATGTGTGGGTGTGTGCTGGGG - Intronic
983990451 4:174112798-174112820 GAATTTTTGAGCCTTTGCTGTGG + Intergenic
988048031 5:25984803-25984825 GCATTTATGTGTGTATGGTGAGG + Intergenic
988143792 5:27277643-27277665 GTATTTATGAATGTGTGATGTGG + Intergenic
990537180 5:56734174-56734196 GCATTTTTGGCCGTGTCCTGGGG - Intergenic
993425148 5:87754143-87754165 GCATTAATTAACATGTGCTGGGG + Intergenic
995770220 5:115661424-115661446 ACATTTATGAGTGTTGGCTGAGG - Intergenic
998354927 5:141527091-141527113 GCATGTGTGAGCGTGTGTAGTGG + Intronic
999148601 5:149412195-149412217 GCATTTTTGAGCCTGAGCAGGGG - Intergenic
1001754841 5:174160161-174160183 GCATTTCAGAGCGTGAGCTTTGG + Intronic
1004144482 6:13052223-13052245 GGAATTCTGAGTGTGTGCTGTGG - Intronic
1006699292 6:35958713-35958735 GCATTTGTGTGTGTGTGTTGCGG + Intronic
1009212113 6:60874437-60874459 GCATTCATCAGCTTGTCCTGGGG - Intergenic
1012399540 6:98832791-98832813 GTGTTTATGAGCGTGTGTGGGGG - Intergenic
1013941281 6:115666325-115666347 GCAATTATGAGTGTGTCCTCAGG + Intergenic
1014625901 6:123724395-123724417 GCATTTATGAATGTGTGTAGGGG - Intergenic
1017517407 6:155169279-155169301 GCATTTGTGGCCGGGTGCTGTGG - Intronic
1022420278 7:30214303-30214325 GCATTTATGTGTGTGTGGTGAGG + Intergenic
1022533946 7:31084319-31084341 GCATTCATGAGCACCTGCTGGGG + Intronic
1024819521 7:53311024-53311046 GCATTTATGAGTGTGTATGGAGG - Intergenic
1029117148 7:98243274-98243296 GCATTGATGTGCCTGAGCTGAGG + Intronic
1029605749 7:101598602-101598624 GCTTTGATGACCCTGTGCTGAGG + Intergenic
1032641172 7:133770350-133770372 GCATTTAAGAGCATGGGCTCTGG - Intronic
1035567433 8:650722-650744 CCTTTTATCAGCGTGTGCTGCGG - Intronic
1039494236 8:37968808-37968830 TCATTTTTGAGCGTGTGTGGTGG + Intergenic
1046057755 8:109098652-109098674 GCCTGTATGAGGGTGTGTTGGGG - Intronic
1046618802 8:116505962-116505984 GCATTTGTGAGCCTGAGCTTTGG - Intergenic
1051184974 9:14450654-14450676 GTATTTATGAGTTTGTGGTGCGG - Intergenic
1053458406 9:38249728-38249750 TCATTTATGAGCAGGTTCTGTGG - Intergenic
1060028115 9:120190282-120190304 GCATTCATTAGCATGTGCTGGGG + Intergenic
1060357081 9:122919267-122919289 GAATTTATCAGGGAGTGCTGGGG + Exonic
1192222620 X:69207574-69207596 GCATTCATGAGCGCATTCTGAGG + Intergenic
1194166204 X:90520389-90520411 GCATGTATGAGCATGTCCTAGGG + Intergenic
1195216551 X:102709935-102709957 TCATTCATGAGAGTATGCTGTGG + Intergenic
1197378307 X:125709421-125709443 GCATTTCTGAGCCTGTGGAGTGG - Intergenic
1199517130 X:148690658-148690680 GCAGTTAAGAGCATGTGCTCAGG + Intronic
1200052238 X:153440403-153440425 GCATTGATGAGTGTCAGCTGCGG - Intergenic
1200512472 Y:4098158-4098180 GCATGTATGAGCATGTCCTAGGG + Intergenic
1202245923 Y:22820159-22820181 GCATTTCTGAGAGTGTGATTGGG + Intergenic
1202398911 Y:24453907-24453929 GCATTTCTGAGAGTGTGATTGGG + Intergenic
1202471869 Y:25216179-25216201 GCATTTCTGAGAGTGTGATTGGG - Intergenic