ID: 955557326

View in Genome Browser
Species Human (GRCh38)
Location 3:60151883-60151905
Sequence CAGGGAAATTATATAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955557326_955557332 26 Left 955557326 3:60151883-60151905 CCTGCAACTATATAATTTCCCTG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 955557332 3:60151932-60151954 CACTGAAATATAATCCCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 152
955557326_955557331 25 Left 955557326 3:60151883-60151905 CCTGCAACTATATAATTTCCCTG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 955557331 3:60151931-60151953 CCACTGAAATATAATCCCTATGG 0: 1
1: 0
2: 1
3: 20
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955557326 Original CRISPR CAGGGAAATTATATAGTTGC AGG (reversed) Intronic
909029316 1:70521090-70521112 CAGAGAAATTATTTAGTTTAGGG + Intergenic
910887576 1:91981566-91981588 CAGAAGAATTAAATAGTTGCAGG - Intronic
913198438 1:116476712-116476734 CAGGGTAGTTATATAATTGATGG + Intergenic
917480484 1:175407287-175407309 CAGGCAAATAATATAGTTCCAGG + Intronic
919516649 1:198533408-198533430 CAGGCAAATTTAATAATTGCTGG + Intronic
919598405 1:199592475-199592497 CAGGGAAATTATATCTGTGAAGG - Intergenic
921457098 1:215384998-215385020 CAGATAAATTGTTTAGTTGCAGG + Intergenic
922428569 1:225523519-225523541 CAGGCAATTCATATAGCTGCAGG + Intronic
922584573 1:226723883-226723905 CAGGGAGGTTCTTTAGTTGCAGG - Intronic
1066667683 10:37802083-37802105 CAGGGAAACTATAAAGTAGCAGG - Intronic
1068613110 10:59082511-59082533 CAGGGAAATTAACTACTTGTGGG + Intergenic
1071732563 10:88263265-88263287 CAGAGAAATTATATGGTGTCTGG + Intergenic
1078066903 11:8084642-8084664 CAGGGAACTTATCTGGTTCCTGG + Intronic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080294990 11:30716216-30716238 CTTGGAAATTATATAGATGTGGG + Intergenic
1080547397 11:33334481-33334503 CAGGGAATATATATAGTTGGAGG + Intronic
1088609841 11:111566475-111566497 CACGGAAGTGATATAGGTGCCGG + Intergenic
1090735114 11:129606139-129606161 AAAAGAAACTATATAGTTGCAGG - Intergenic
1091632777 12:2174590-2174612 AGGTGAAATTATATAATTGCTGG - Intronic
1097362526 12:58673737-58673759 CAGCCAAAACATATAGTTGCAGG + Intronic
1099973948 12:89526458-89526480 CAGGATATTGATATAGTTGCTGG + Intergenic
1100093633 12:91004207-91004229 CAAAGAAATTATACACTTGCTGG + Intronic
1102646277 12:114405908-114405930 CACTGAGATTATATGGTTGCCGG - Intronic
1104329862 12:127834545-127834567 CATGGACATTACATGGTTGCGGG + Intergenic
1105444857 13:20444656-20444678 CAGTAAAACTATATAATTGCAGG - Intronic
1108749756 13:53436503-53436525 CAGGGACATTATAAGCTTGCAGG + Intergenic
1111581822 13:90232329-90232351 CAGGGAAGTTTTATATTTGAAGG + Intergenic
1112985796 13:105447773-105447795 CAGGGCATTTATATAGTCACAGG - Intergenic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1123159679 14:106266270-106266292 CGGGGAAATTTTACAATTGCAGG - Intergenic
1123570819 15:21606437-21606459 AAGGGAAATTATATTGTGACTGG + Intergenic
1123606932 15:22041790-22041812 AAGGGAAATTATATTGTGACTGG + Intergenic
1127441150 15:59009656-59009678 CAAGGAAATTATTCAGTGGCCGG + Intronic
1127701587 15:61506565-61506587 CAGGGAACTTATGCAGTTTCAGG - Intergenic
1128196076 15:65757538-65757560 CAGGGAGATAATAAAGTTGTAGG + Intronic
1129908115 15:79204006-79204028 CAGGGAAATCATTTCCTTGCTGG - Intergenic
1202979171 15_KI270727v1_random:333560-333582 AAGGGAAATTATATTGTGACTGG + Intergenic
1140605470 16:76531393-76531415 CAGAGAAATTATTCAGATGCAGG + Intronic
1148525082 17:48324387-48324409 CTTGGAAATAATATAGTTCCTGG - Intronic
1148729524 17:49824015-49824037 CAGGTGAATTAGAGAGTTGCTGG + Intronic
1149668315 17:58382056-58382078 GAGGGAAAGTATTTAGTTTCTGG - Intronic
1151506974 17:74534564-74534586 CAGGGAAAGAAAATAGTTGGGGG + Intergenic
1154151616 18:11910536-11910558 CAGGCAAATTATATTATTTCTGG + Intergenic
1156471259 18:37378408-37378430 CAGGGAAATTGTAAAGTCGGGGG - Intronic
1156942732 18:42790200-42790222 CAGGGAAATTATAAATGTGTGGG - Intronic
1157249665 18:46083509-46083531 CAGGGAAATGAAAAAATTGCTGG - Exonic
1164222772 19:23211330-23211352 CAAGGAATATATATATTTGCTGG + Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
930327604 2:49939900-49939922 CAGGGAAGTTATATATTTGGTGG - Intronic
932392428 2:71407205-71407227 CAAAGAAATTATCTAGTTGTTGG - Intronic
935525263 2:104158005-104158027 CAGGAAAAGTAGATAGTTTCTGG - Intergenic
938989065 2:136609570-136609592 CAGGGAGCTTATATTCTTGCTGG + Intergenic
940732104 2:157404311-157404333 CAGAGAAATTATAAACTTCCAGG + Intergenic
945421511 2:209642792-209642814 GAGGGAGAATATAGAGTTGCAGG + Intronic
948350999 2:237340785-237340807 CAGGGGAATGACACAGTTGCAGG - Exonic
1169097298 20:2913680-2913702 CATGGAAATTATGTAGTACCTGG - Intronic
1169393575 20:5210583-5210605 CAGGGAAGTTGTACAGTTTCGGG - Intergenic
1169577616 20:6982807-6982829 CATTGAAATTATAACGTTGCTGG - Intergenic
1170054364 20:12183300-12183322 CAGTGATATTTTATAGTTTCTGG + Intergenic
1170505990 20:17026396-17026418 CAGAGGCATGATATAGTTGCTGG + Intergenic
1171066372 20:22019688-22019710 CAGGGAAGATATATAGTTCCTGG + Intergenic
1173055158 20:39604773-39604795 CAAGGAGATGATATAGTTGCAGG - Intergenic
1174322830 20:49755537-49755559 TAGGTAAATTATACATTTGCGGG + Intergenic
1179771987 21:43627178-43627200 CTGAGAAATTATTTAGTTCCTGG + Intronic
951285329 3:20804975-20804997 CAAGGAAATTATATACTTCATGG + Intergenic
952145080 3:30523689-30523711 CAGGGAAAATATAAACTTACTGG - Intergenic
953181946 3:40603973-40603995 CAGGTAAATTATATTGTTCAGGG + Intergenic
955557326 3:60151883-60151905 CAGGGAAATTATATAGTTGCAGG - Intronic
955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG + Intronic
957231535 3:77523643-77523665 GAGGGAAATTACATAGTTCAAGG + Intronic
957859872 3:85933085-85933107 AAGGTAAATTACATAGTGGCAGG - Intronic
959608348 3:108266567-108266589 CAGGCAAATTATTTAGTGGTTGG - Intergenic
959922218 3:111880818-111880840 CAGGGAATTTATATGGTGTCTGG + Intronic
961099073 3:124183218-124183240 CTGGGCAATTTTATAATTGCTGG + Intronic
961585783 3:127922259-127922281 CAGAGAAATCATATAGTTTTAGG + Intronic
963704792 3:148672233-148672255 GGGGGAAATTATATAATTGCTGG - Intergenic
964374882 3:156040294-156040316 CATCAAAATTATGTAGTTGCTGG + Intronic
967520970 3:190432839-190432861 CAGAGAGATTGTATAGTTGAAGG + Intronic
968243857 3:197121113-197121135 CAGGGAAAATGTATATTTTCTGG - Intronic
971510678 4:27419215-27419237 CAGGTAAATTAGATAGTAGTTGG + Intergenic
972076252 4:35091381-35091403 CAGGGAACTTGTATTTTTGCTGG + Intergenic
977547829 4:98405789-98405811 AAGGAAAATGATATAGATGCAGG + Intronic
978750240 4:112237853-112237875 CAGGGAGATAATATGGTTTCAGG - Intronic
978789886 4:112651083-112651105 TAGGGAAATTATATACTTTTAGG + Intronic
979009450 4:115348834-115348856 CTGGGAAAATAAATTGTTGCAGG + Intergenic
981007843 4:139893926-139893948 CAGTGACTTTACATAGTTGCAGG + Intronic
982634927 4:157883021-157883043 CAGGGAAATTTTATGGTTCAGGG + Intergenic
983867109 4:172780846-172780868 CAGGGAGCTGATGTAGTTGCAGG - Intronic
984287194 4:177746025-177746047 CAGGGAAATAATATATTTCTTGG - Intronic
986423533 5:7608255-7608277 CAGGGAAATAACACAGTTGGAGG + Intronic
988841170 5:35085386-35085408 AAAGGAAAATATTTAGTTGCTGG - Intronic
992334839 5:75756071-75756093 CAGGGAACTTACATTGTTCCAGG + Intergenic
997784493 5:136696852-136696874 CATGTAAATTCTATATTTGCAGG + Intergenic
998308620 5:141103482-141103504 AAGGGAAATTATAAAATTGGTGG - Exonic
999579517 5:153020622-153020644 AAGGGAAATTATTTTCTTGCCGG - Intergenic
1000412606 5:160949277-160949299 CCGGGAAATGTTATAGGTGCTGG + Intergenic
1002937930 6:1689658-1689680 CTGGGAAGATAAATAGTTGCAGG - Intronic
1006658468 6:35618202-35618224 CAGGCAACTAATATAGTTGTTGG + Intronic
1008475953 6:51936012-51936034 CAGGCATATTATATATTTACAGG + Intronic
1009883446 6:69597528-69597550 CAGGGTAATTATTTTGTTGAAGG - Intergenic
1012393058 6:98764958-98764980 CAGTGAAATTGTACAGTTTCAGG + Intergenic
1013606074 6:111749965-111749987 CAGGGAAATTCTACAGATGTGGG - Intronic
1014816724 6:125943670-125943692 AAGGGAAATAATATTCTTGCAGG + Intergenic
1014941405 6:127444133-127444155 CAGAGAAATGGTATAGTTGTGGG + Exonic
1016683623 6:146857438-146857460 CATGGAAATCATATATTGGCTGG + Intergenic
1018391953 6:163347390-163347412 CAGGGAATATATAGAGTTGGGGG + Intergenic
1020605895 7:10336402-10336424 CAGGTAAATTATACATTTGCAGG + Intergenic
1021353361 7:19623299-19623321 CAGAGAAGTTATATGGTTGTAGG - Intergenic
1024730704 7:52250997-52251019 CAGGGGACTTATATTGATGCAGG + Intergenic
1026765737 7:73158418-73158440 AAGGGAAATTGTGTATTTGCTGG - Intergenic
1026812864 7:73483578-73483600 AAGGTAAATTATATTGTTGAAGG - Intronic
1027042211 7:74968115-74968137 AAGGGAAATTGTGTATTTGCTGG - Intronic
1027081431 7:75234243-75234265 AAGGGAAATTGTGTATTTGCTGG + Intergenic
1027893914 7:84015835-84015857 CAGGGAAATTATACAGATTCTGG + Intronic
1028112912 7:86964384-86964406 CAGAGAGATTATAGAATTGCTGG - Intronic
1029390018 7:100268832-100268854 AAGGGAAATTGTGTATTTGCTGG + Intronic
1029852028 7:103471886-103471908 CAGGGCCATTATAATGTTGCTGG + Exonic
1030853738 7:114524454-114524476 CAGGAAAATTATATAACTGAAGG - Intronic
1035289866 7:157831001-157831023 CAGGTAAATGACAGAGTTGCAGG + Intronic
1042209670 8:66367190-66367212 CAAGGAAATGAGATAGTGGCTGG - Intergenic
1042696557 8:71559529-71559551 CAGGAAAATTAGAGATTTGCAGG - Intronic
1043226675 8:77741348-77741370 TAGGGAAATTATAAAGTACCTGG + Intergenic
1044177488 8:89146351-89146373 CAGGTAAATTATGTATTTTCTGG - Intergenic
1044342435 8:91062201-91062223 CATTGAAATTATAGAGTAGCAGG - Intergenic
1047528200 8:125651900-125651922 CAAAGAAATTGTATAGTTGGTGG + Intergenic
1048665774 8:136658974-136658996 CAGGGAAATAATAAAGTTAGGGG + Intergenic
1052957720 9:34267070-34267092 CAGGAAAATCAGATAGTTGAGGG + Intronic
1054493979 9:65809765-65809787 CATGAAATTAATATAGTTGCAGG + Intergenic
1055496691 9:76861903-76861925 CAGGGAAGTTAAAGATTTGCGGG - Intronic
1056071137 9:82988070-82988092 GATGGAAGTGATATAGTTGCTGG - Intronic
1058635903 9:107038474-107038496 CAGGGGAATTACATAGTAGATGG - Intergenic
1061877593 9:133552547-133552569 CAGGGGAATGAAATAGTTTCTGG + Intronic
1188588505 X:31805209-31805231 GAGTTAAATTATATAGTTACAGG - Intronic
1189635639 X:43005457-43005479 CTGTGAAATTAAAAAGTTGCTGG - Intergenic
1194536975 X:95117793-95117815 CAGTGTATTTATGTAGTTGCTGG + Intergenic
1197264222 X:124348711-124348733 CATGGAGATTATATTTTTGCAGG - Intronic