ID: 955559175

View in Genome Browser
Species Human (GRCh38)
Location 3:60170190-60170212
Sequence CAGGTTAATAAGATGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955559171_955559175 6 Left 955559171 3:60170161-60170183 CCACTGGAAGAGAGTGGCTTTCT 0: 1
1: 0
2: 1
3: 18
4: 216
Right 955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG 0: 1
1: 0
2: 1
3: 7
4: 174
955559168_955559175 25 Left 955559168 3:60170142-60170164 CCAAGGACTTTTGTTGAAACCAC 0: 1
1: 0
2: 1
3: 20
4: 190
Right 955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG 0: 1
1: 0
2: 1
3: 7
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955559175 Original CRISPR CAGGTTAATAAGATGGATGG AGG Intronic
901625774 1:10624189-10624211 CAGATAAATTAGATGGATTGCGG + Intronic
901783560 1:11610065-11610087 CAGGTTAAACACATGGATGTTGG - Intergenic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903371229 1:22837412-22837434 CAAGTTTATGAGAGGGATGGGGG + Intronic
905828890 1:41048436-41048458 CAGGTCAATCAGGTAGATGGGGG + Intronic
906048989 1:42855206-42855228 CAAGTTACTAAGAGGGAAGGAGG - Intergenic
907838417 1:58133205-58133227 CAGGGGTATAAGATGCATGGTGG - Intronic
908148441 1:61273252-61273274 CAGGTTAAAATGATGAATGATGG - Intronic
910329371 1:86052635-86052657 AAAGTTTTTAAGATGGATGGTGG + Intronic
910783906 1:90973006-90973028 AAAGTTATGAAGATGGATGGTGG + Intronic
914771383 1:150688835-150688857 CACGTAAATCAGATGGGTGGTGG - Intronic
915248551 1:154572543-154572565 CAGGTTAACAACTTGGATGTGGG - Intronic
915879880 1:159658184-159658206 CATGTGTTTAAGATGGATGGAGG + Intergenic
915902789 1:159858172-159858194 CAGGTTCATGAGGTTGATGGAGG + Exonic
916474235 1:165153345-165153367 CAGGTGAAGAAAAAGGATGGTGG + Intergenic
921358157 1:214305823-214305845 AAGGTTAATAAGGAGGATGTTGG + Intronic
1068598868 10:58934667-58934689 GAGGTTATTCAGATGGAAGGTGG + Intergenic
1070047354 10:72851767-72851789 CAGGTTAGGAAGATGGGAGGAGG - Intronic
1070498375 10:77046480-77046502 CTGGTTACTAAAATGGATGGGGG + Intronic
1071683945 10:87735346-87735368 CAGGTTTTTAGGCTGGATGGTGG + Intronic
1072825429 10:98601390-98601412 CTGATTAATCTGATGGATGGAGG - Intronic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1075667365 10:124240669-124240691 AAGGATAAGAACATGGATGGCGG - Intergenic
1076361671 10:129894053-129894075 CAGGTTAATAGGAAGGAGGGGGG - Intronic
1078142320 11:8701428-8701450 CAGTTTGATAAGAAGGCTGGAGG - Intronic
1078620039 11:12898925-12898947 CAGGTCAAGAAGGTGAATGGGGG - Intronic
1080570945 11:33556775-33556797 GAGGTTCTAAAGATGGATGGTGG + Intronic
1080675963 11:34427388-34427410 CAGGGTAATATGATGTAAGGAGG + Intergenic
1080723596 11:34872859-34872881 CTGGTTACCAAGATGGATGTCGG - Intronic
1080826920 11:35856303-35856325 TAGATCAATAGGATGGATGGAGG + Intergenic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1084785672 11:71440450-71440472 CAGGTGGATGAGATGGATGATGG + Intronic
1086183456 11:83985234-83985256 GAGATTAATAACAGGGATGGGGG - Intronic
1088464096 11:110115047-110115069 CAGTTTAACAATATAGATGGTGG - Intronic
1092582208 12:9854258-9854280 CATGTTAGAAAGATGGAGGGGGG - Intronic
1094173407 12:27518338-27518360 CATGTTGATAGGAAGGATGGCGG + Intergenic
1095041490 12:37446654-37446676 CAGGTGAATAAGAAGGGAGGGGG - Intergenic
1095973768 12:47925090-47925112 CAGCTTAAGAAAATGGATTGAGG + Intronic
1097181267 12:57173348-57173370 CAGGTGAAGAGGATGGTTGGAGG + Exonic
1098522325 12:71447352-71447374 CAGGTTAATAAGCTGAATCAAGG - Intronic
1100871465 12:98914598-98914620 CAGGTCAATAAGGGGGATAGTGG - Intronic
1101828360 12:108238456-108238478 CTGGCTTTTAAGATGGATGGAGG - Intronic
1103048468 12:117758908-117758930 CAGGTTGCTAAGGTGGAGGGTGG - Intronic
1104198531 12:126565181-126565203 GAGGTTAATAAAAGGGGTGGCGG + Intergenic
1108739523 13:53321088-53321110 CAAGACAGTAAGATGGATGGGGG - Intergenic
1110101543 13:71612404-71612426 AAGGTCAACAAGATGGATGCTGG + Intronic
1111514466 13:89310290-89310312 CAGTTAAATAAGATGGAGTGGGG - Intergenic
1111723785 13:91978935-91978957 CAGGTTGATAAGATGAAAGCAGG + Intronic
1112183187 13:97104902-97104924 TATGTTAATGAGATGGCTGGTGG - Intergenic
1116046602 14:39751447-39751469 CATGTTATTAACATGGATGTTGG - Intergenic
1116046605 14:39751455-39751477 CATGTTAATAACATGGATGTTGG + Intergenic
1120021921 14:79540692-79540714 CATGTAAATAAGATTGAGGGAGG + Intronic
1121242179 14:92438956-92438978 CAGGTTAATGAGGTGACTGGTGG - Intronic
1121459553 14:94064390-94064412 CATGTTAATAAGATGACTAGTGG + Intronic
1121757427 14:96414712-96414734 CAGGCCAAGAAGACGGATGGAGG + Intronic
1122260253 14:100514450-100514472 CAAGTGAAAAAAATGGATGGGGG - Intronic
1122653727 14:103242755-103242777 CAGGTTAAGATGAAGGATTGTGG - Intergenic
1126898318 15:53284252-53284274 AAATTTAAAAAGATGGATGGGGG - Intergenic
1127309738 15:57742054-57742076 CAGGTCAAAAAGAGGGGTGGAGG - Intronic
1128000586 15:64187494-64187516 TAGGTTAAAATGATGGATTGAGG - Intronic
1133897271 16:9941830-9941852 CAACTTAATAAGGTGGTTGGGGG - Intronic
1137567931 16:49545182-49545204 CATGTGAGTAAGCTGGATGGAGG + Intronic
1139262936 16:65612586-65612608 TAGGTTGATAAGAAGGCTGGGGG + Intergenic
1139812405 16:69632937-69632959 CAGTATAATAAGATAGAAGGAGG - Intronic
1146679054 17:34793965-34793987 CAGGTGCATAAGAAGGCTGGAGG + Intergenic
1146741348 17:35286546-35286568 CAGGTTAATAATATGGACCCAGG + Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1153341115 18:3975978-3976000 CAGGTTCTGGAGATGGATGGTGG + Intronic
1153726913 18:7966285-7966307 AATGGTAATAACATGGATGGAGG - Intronic
1155507814 18:26549116-26549138 CAGGTTAATGAGCAGGGTGGAGG + Exonic
1156229619 18:35140690-35140712 CAGGATAAAAAGAGGGGTGGTGG - Exonic
1159846046 18:73461292-73461314 CAGGTTAATGTGATGAATTGAGG + Intergenic
1160315930 18:77847745-77847767 TTGGTGAATAAGATGGAAGGAGG + Intergenic
925626991 2:5851273-5851295 GAGGTGAGTGAGATGGATGGAGG - Intergenic
927073829 2:19556690-19556712 CAGGTAGAAAAGATGTATGGTGG - Intergenic
929766360 2:44847208-44847230 GAGGTTCTGAAGATGGATGGTGG - Intergenic
929892517 2:45930122-45930144 CAGGTGACTGAGCTGGATGGAGG - Intronic
930484713 2:51997897-51997919 CATATTAATTACATGGATGGTGG - Intergenic
930560678 2:52956576-52956598 TAAGTGAATAAGATGGAAGGAGG + Intergenic
930720896 2:54636765-54636787 CAGGGTATTAAGATGGATAAAGG - Intronic
931085039 2:58820578-58820600 GAGGTTAAGAAGATGGGAGGAGG - Intergenic
935503243 2:103868149-103868171 CTGGTTTGGAAGATGGATGGAGG + Intergenic
937251337 2:120525806-120525828 CAGGTTAACAAGTGGGGTGGGGG + Intergenic
939567521 2:143802122-143802144 AAGGTTAAAAAAATGAATGGGGG + Intergenic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941604954 2:167585091-167585113 CCTGTTAATAAGATGACTGGTGG - Intergenic
942645057 2:178101641-178101663 TATGTTAATAAGATGAATTGCGG - Intronic
943387861 2:187224818-187224840 CTGGTTAATGAGATGGAGAGTGG + Intergenic
944114705 2:196173613-196173635 TAGGTAAATGAGGTGGATGGAGG - Intronic
946094798 2:217264558-217264580 GGGGTTATAAAGATGGATGGTGG - Intergenic
1169642116 20:7764443-7764465 TAAGTTAATAAGATGCATGTGGG - Intergenic
1169815463 20:9651529-9651551 AAGGTTAATGACATGGATGGTGG + Intronic
1170330166 20:15200788-15200810 CATGTTAAAAAGATGTATAGAGG - Intronic
1170645180 20:18191397-18191419 CAGGTTAAGAGGCTGGAAGGTGG + Intergenic
1171141292 20:22745900-22745922 CTGGTAAATAAGATGGACAGGGG - Intergenic
1173002946 20:39118573-39118595 CAGGTTAATAAAATGCTTGGAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953009108 3:39007433-39007455 CATGTTAATAAAATGACTGGTGG + Intergenic
953988223 3:47462203-47462225 AAGATAAAAAAGATGGATGGTGG - Intronic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
956458017 3:69443039-69443061 TATGTTAATGAGATGGCTGGGGG + Intronic
960136646 3:114112339-114112361 CTGGTTAATAAGATAAAAGGGGG + Intergenic
962340755 3:134581037-134581059 GTGGTTATGAAGATGGATGGGGG + Intergenic
963158973 3:142130679-142130701 CAAGTTCTGAAGATGGATGGTGG + Intronic
965053975 3:163690281-163690303 TAGGTTAATATAATTGATGGTGG + Intergenic
967511044 3:190312833-190312855 CAGGTTAGTAAGGTGAAAGGGGG + Intronic
968571537 4:1344786-1344808 CAGGTTTAGAAAACGGATGGGGG + Intergenic
969082629 4:4631292-4631314 CAGTTTTGCAAGATGGATGGTGG - Intergenic
969220600 4:5756152-5756174 CAGGTTAGAAAGAAGGATGTTGG - Intronic
970144380 4:13019247-13019269 CAAGTCAATAAAATGGGTGGGGG + Intergenic
970226153 4:13859238-13859260 CAGGATGATAAGATGTCTGGAGG - Intergenic
971031129 4:22637881-22637903 AAGGTTAATAAGTTGGCTGTGGG + Intergenic
974866063 4:67582121-67582143 CAGGTAAAAATGATGGTTGGCGG - Intronic
977470077 4:97432035-97432057 TAAGTTATAAAGATGGATGGAGG + Intronic
979384474 4:120048181-120048203 AAGGTTATGGAGATGGATGGTGG + Intergenic
979801748 4:124918247-124918269 CAGCTTATAAAGATGGATAGTGG - Intergenic
979813945 4:125075211-125075233 CAGATAAATAAGGTGGAAGGAGG - Intergenic
981398962 4:144289243-144289265 AAGTTTAAAAAGATGTATGGTGG + Intergenic
981560305 4:146041089-146041111 AAGGTTAATAACATGGATCTAGG - Intergenic
983107385 4:163705259-163705281 CATGTTAATAATATGGATTAGGG - Intronic
986026344 5:3854732-3854754 CAGGTTAATAAGGTGGGGAGGGG + Intergenic
987016104 5:13820961-13820983 AAGGTTCTGAAGATGGATGGTGG + Intronic
991085576 5:62645720-62645742 CAGGTGAATAAGAGGAAGGGAGG - Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
996289640 5:121836749-121836771 CAAGTTAATAATATGGTTGATGG + Intergenic
996400978 5:123062117-123062139 GAGGTGAAGCAGATGGATGGTGG + Intergenic
998897825 5:146818753-146818775 CAGGTTAATAGAAAGGATGCTGG + Intronic
998979253 5:147682855-147682877 CTTGTTACTATGATGGATGGAGG - Intronic
999536422 5:152522579-152522601 CAGCTTAAAAAAATGGTTGGAGG - Intergenic
1000413494 5:160958971-160958993 AATGTTAATAAGAGGGATGCTGG + Intergenic
1001344368 5:170877626-170877648 GAGGTTAGGGAGATGGATGGGGG - Intronic
1001469826 5:172004042-172004064 CAAGATAATACGATTGATGGAGG - Intronic
1003341471 6:5225293-5225315 CAGGTAAAAAAGATGTAAGGTGG + Intronic
1003962980 6:11226208-11226230 AAAGTAAATAAGATGGAGGGGGG + Intronic
1004306060 6:14502829-14502851 CATATTAAGTAGATGGATGGAGG - Intergenic
1005817822 6:29570686-29570708 CAGGTCCAGAAGAAGGATGGTGG + Intronic
1005995386 6:30927869-30927891 CAGGAAAATAAGATTGAAGGAGG - Intergenic
1010073654 6:71773946-71773968 CATTTTAAAAAGATGGATCGAGG - Intergenic
1010180957 6:73086174-73086196 CAGGTTAATAAGAGGTCTGCTGG - Intronic
1011909162 6:92413321-92413343 CAAGTTATGCAGATGGATGGTGG + Intergenic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015497708 6:133897996-133898018 CATGCTAATGAGATGGCTGGTGG - Intergenic
1016563851 6:145429891-145429913 CAGGTTAAAAAGATGTTTGAAGG + Intergenic
1016840127 6:148517386-148517408 CAGCTGAATAAGATAGATGATGG + Intronic
1017367035 6:153655139-153655161 CAGTGTAAAAAGGTGGATGGGGG - Intergenic
1022143625 7:27514982-27515004 CAGGTAATTCAGATGGATAGCGG - Intergenic
1022597039 7:31722655-31722677 CAGGTGAAGAAGCAGGATGGTGG + Intergenic
1022802082 7:33786357-33786379 CAGGCTGCTGAGATGGATGGAGG + Intergenic
1024973722 7:55094232-55094254 CAGGATAAGAAGCTGGATGCTGG - Intronic
1029624182 7:101709436-101709458 CAGTTTCAAAAGATGGATGGGGG + Intergenic
1029676573 7:102073845-102073867 CAGTTTAAATTGATGGATGGTGG + Intronic
1030118088 7:106078953-106078975 CAGGTTAATATAAAGGATTGTGG - Intergenic
1031127231 7:117788558-117788580 CAGGTTAGTAAGCAGGGTGGAGG + Intronic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1037998709 8:23371976-23371998 CAGGTTAATAAGGGGGTTTGGGG + Intronic
1041729321 8:61048863-61048885 CAGGTGCATAGGATTGATGGAGG - Intergenic
1042974875 8:74457265-74457287 CAGGTAATTAAAATGGATTGTGG - Intronic
1045556785 8:103222120-103222142 CAGGTTAAGAAAAAGGATTGTGG + Intronic
1047368446 8:124234536-124234558 CAGGGTAATAAGGTGGGTGAGGG - Intergenic
1048790868 8:138102089-138102111 GAGGTAAATCAGAAGGATGGAGG + Intergenic
1048874550 8:138826899-138826921 CAGGCCAAGAAGGTGGATGGTGG - Intronic
1049927892 9:427258-427280 CAAGTTTATAATATGGATGTTGG + Intronic
1049990568 9:987137-987159 AAGGTTCTGAAGATGGATGGTGG - Intronic
1050161658 9:2726039-2726061 CAGTATATTAAGATGGATTGCGG + Intronic
1050924989 9:11253447-11253469 CATGTTAACAGGATGAATGGGGG + Intergenic
1056947912 9:91015960-91015982 CAGGTTAATTAGCTTGATGTAGG - Intergenic
1058111511 9:101035394-101035416 AACATTAATAGGATGGATGGGGG - Intronic
1058358589 9:104113367-104113389 GAAGTTAAGAAGATGGATAGTGG + Exonic
1058995541 9:110295217-110295239 CAGGTAAATAAGATGGCAGTTGG - Intergenic
1059046077 9:110868469-110868491 AAGGAAAATAAAATGGATGGTGG - Intergenic
1059621367 9:116009316-116009338 CAAGTTCTGAAGATGGATGGTGG - Intergenic
1186574259 X:10748844-10748866 CATGTTAGTATCATGGATGGGGG + Intronic
1187135987 X:16548000-16548022 CATGTTAATCAGCTGGATGTAGG - Intergenic
1187695963 X:21920672-21920694 CAGGATAATAAGATGGCAGCTGG - Intergenic
1190477460 X:50842096-50842118 CAGGTAAATGGGGTGGATGGAGG + Intergenic
1192300892 X:69901422-69901444 CAGGTTAAGAAGATAGATGGAGG + Intronic
1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG + Intergenic
1194968400 X:100315932-100315954 CAGTTGAATATGATGGATGATGG + Intronic
1197779159 X:130142486-130142508 CATGTTAATAGGCTGGACGGGGG - Intronic
1200425847 Y:3019633-3019655 CAGCTAAATTAGATGGCTGGAGG + Intergenic
1201532470 Y:15007041-15007063 CACATTATTAAGATGGAAGGTGG + Intergenic