ID: 955561261

View in Genome Browser
Species Human (GRCh38)
Location 3:60193586-60193608
Sequence CTTGTCAAGGCCATGGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955561261_955561265 12 Left 955561261 3:60193586-60193608 CCTATAACCATGGCCTTGACAAG 0: 1
1: 1
2: 2
3: 8
4: 114
Right 955561265 3:60193621-60193643 AAGGTAAGATCCAAGTCTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 160
955561261_955561264 -7 Left 955561261 3:60193586-60193608 CCTATAACCATGGCCTTGACAAG 0: 1
1: 1
2: 2
3: 8
4: 114
Right 955561264 3:60193602-60193624 TGACAAGTCATTTTATAGAAAGG 0: 1
1: 0
2: 1
3: 31
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955561261 Original CRISPR CTTGTCAAGGCCATGGTTAT AGG (reversed) Intronic
903210806 1:21817121-21817143 CTTGTCACTGGCTTGGTTATGGG - Intronic
904401373 1:30258851-30258873 ATTGTCAAAGTCATGGTGATTGG - Intergenic
914396869 1:147278052-147278074 CTTGCCCAGCTCATGGTTATCGG + Intronic
922591563 1:226781223-226781245 CTTGTCACAGTCATGCTTATGGG - Intergenic
923859373 1:237877554-237877576 CTTGTCATGGCCAAGGTACTTGG + Intergenic
924505815 1:244682907-244682929 CTTTTCAAGACCATTGTGATAGG + Intronic
1063432526 10:6003241-6003263 CTTATCAAGAACCTGGTTATGGG - Intergenic
1067329558 10:45302299-45302321 GTTTTCAAAGCCATGTTTATTGG + Intergenic
1068197230 10:53732412-53732434 CTTGGCAGGGGCAGGGTTATGGG + Intergenic
1071986720 10:91058979-91059001 CTTGACAAAGCCATGTTCATTGG + Intergenic
1072150794 10:92681183-92681205 CTTGTCCAGCCCATGGCCATGGG - Intergenic
1072391014 10:94986996-94987018 CTAGTCATGGCCATGTATATTGG + Intronic
1074472917 10:113743888-113743910 CTTGGCAGGGCCATGGGGATGGG - Intergenic
1075300035 10:121314194-121314216 CTGGTCCAGGCCATGGTGAATGG + Intergenic
1077583305 11:3431694-3431716 CTTGACAAGGCCTTAGCTATGGG + Intergenic
1084541044 11:69787457-69787479 TTTGTCAAGGGCATGGGTTTGGG + Intergenic
1084832211 11:71778340-71778362 CTTGGCAAGGCCTTAGCTATGGG - Intergenic
1090419053 11:126561537-126561559 CTTGTCAAGGCAGTGGTGTTGGG + Intronic
1090644137 11:128753881-128753903 CTTGCCAAGGGCATGGTCTTGGG + Intronic
1101414774 12:104499507-104499529 CTTGCTGAGGCCAAGGTTATAGG - Intronic
1104536544 12:129622815-129622837 ATTGTCATTGCCATGGTGATTGG + Intronic
1104936697 12:132368253-132368275 TTTGGCCAGGCCATGGTTTTTGG + Intergenic
1119099148 14:71863981-71864003 CTTGTAAAGGACATGCTTAGAGG - Intergenic
1122372465 14:101236172-101236194 CCTCTCAGGGCCATGGTGATGGG + Intergenic
1202848916 14_GL000225v1_random:3517-3539 CTTGTCTAGGCCCTGCTTACAGG - Intergenic
1202852286 14_GL000225v1_random:29531-29553 TTTGTCAAGGATATGGTTACAGG + Intergenic
1202858939 14_GL000225v1_random:69189-69211 TTTGTCAAGGATATGGTTATAGG + Intergenic
1202859041 14_GL000225v1_random:70076-70098 CTTGTCTAGGCTCTGTTTATGGG + Intergenic
1202863195 14_GL000225v1_random:97622-97644 CTTGTCTAGGCCCTGCCTATGGG + Intergenic
1202863406 14_GL000225v1_random:99675-99697 CTTGTCAAGGTTCTGCTTATAGG + Intergenic
1202863791 14_GL000225v1_random:102430-102452 CTTGTCAAGGCTCTGCTTACAGG + Intergenic
1202864685 14_GL000225v1_random:108150-108172 CTTGTCAAGGCTCTGGCTACAGG - Intergenic
1202864987 14_GL000225v1_random:110944-110966 CTTGTCAAGGCCCTGCCTACAGG - Intergenic
1202865163 14_GL000225v1_random:112512-112534 CTTGTCTAGGCTCTGCTTATAGG - Intergenic
1128026333 15:64440424-64440446 AGTGTCCAGGCCCTGGTTATGGG + Intronic
1133351680 16:5105240-5105262 CTTGGCAAGGCCTTAGCTATGGG + Intergenic
1133403527 16:5505755-5505777 CTTGTGAAGTCCATGGCTTTTGG + Intergenic
1134563044 16:15227265-15227287 CTTGGCAAGGTCGTAGTTATGGG - Intergenic
1134923578 16:18138898-18138920 CTTGGCAAGGTCGTAGTTATGGG - Intergenic
1138916300 16:61468951-61468973 CTTGTCTAGGACATGGTTGCTGG + Intergenic
1143391145 17:6560009-6560031 TTTGTCAAGGCCATGGTGATTGG - Intergenic
1143876714 17:9997098-9997120 CTTCTCAAGGCAATGGTGAAAGG + Intronic
1148523752 17:48309399-48309421 ATTGTCAAGGCCATGCTTACTGG - Intronic
1151858780 17:76742900-76742922 CTTGTCAAGGCCAAAATTTTAGG - Intronic
1155996899 18:32339978-32340000 TTAGCCAAGGCCATGATTATAGG - Intronic
1156992940 18:43431928-43431950 CTTGTGAAGGCCATGGTTGTTGG - Intergenic
1158259691 18:55592778-55592800 CATGTGAGAGCCATGGTTATAGG + Intronic
1160066899 18:75583962-75583984 GATGTCAAGGCCATCGTTGTTGG + Intergenic
1164817871 19:31220043-31220065 CTTGTCAAGGCCAAGGTGGATGG + Intergenic
1166121547 19:40690236-40690258 CTTGCCAAGGCCCTGGAAATAGG - Intronic
928051415 2:28000380-28000402 CATGTTTAGGCTATGGTTATGGG + Intronic
928195896 2:29216210-29216232 CTTCTCATGGCCATGGTCGTGGG + Intronic
930062553 2:47302447-47302469 CTTGGCAAGGGAAAGGTTATGGG + Intergenic
930444055 2:51448932-51448954 CTAGTCAAGTCCTTGGTTAAAGG - Intergenic
930934885 2:56936641-56936663 TTTGTCAAGGACATTGTTTTAGG + Intergenic
933411476 2:81930578-81930600 CTTATCAGTGCCATGGATATTGG - Intergenic
934126424 2:88897277-88897299 CAGGTCAGGGCCAAGGTTATGGG + Intergenic
935627309 2:105181726-105181748 CATGTCAGAGCCAGGGTTATTGG - Intergenic
940047770 2:149427948-149427970 CTTGGCAAGGCTAGAGTTATAGG - Intronic
946074425 2:217062087-217062109 CTGGGCAAGGCCATGGCTTTGGG + Intergenic
947108390 2:226691957-226691979 CTTGTCCAGCCCCTGGTGATGGG + Intergenic
948853791 2:240720844-240720866 CGAGTCACGGCCATGGTCATGGG + Intronic
1173320031 20:41979089-41979111 CTTTTCAAGGCCACGCATATTGG + Intergenic
1173320516 20:41983388-41983410 CTTTTCAAGGCCATGCATATTGG - Intergenic
1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG + Intergenic
1183258244 22:36776957-36776979 CTTGTCCAGGCCAGGGATTTAGG - Intergenic
949591492 3:5498989-5499011 CTTGTCAATGGCAAGGTTACTGG - Intergenic
949946823 3:9196169-9196191 CTTGTCAAATGCATGGTTGTTGG - Intronic
953959229 3:47254701-47254723 CTAGTTAAGGCCATGGTGACTGG - Intronic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955376872 3:58404663-58404685 CTTGTTCAGGCCATGGCTCTTGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
961298694 3:125907429-125907451 CTTGGCAAGGCCTTAGCTATGGG - Intergenic
961819786 3:129570137-129570159 CTTGTCAAGCCCTTGGTCCTGGG + Intronic
964177745 3:153845606-153845628 CTTTTCAAGGACATGCTGATTGG - Intergenic
964851747 3:161103354-161103376 CTTGTAAAGGGCATTATTATGGG + Intronic
965931591 3:174050340-174050362 CTTTTCATGGCTATTGTTATAGG - Intronic
966252551 3:177882736-177882758 CTTCCCAAGGCAATGGTTATGGG - Intergenic
967806234 3:193716762-193716784 CTTGGCAATGCCAAGGTTCTGGG + Intergenic
969755489 4:9147162-9147184 CTTGGCAAGGCCTTAGCTATGGG - Intergenic
971757016 4:30719277-30719299 CTTGGTTAGGACATGGTTATCGG - Intergenic
974348717 4:60716549-60716571 TTTGTCAAGGCAATGGTTTAGGG + Intergenic
975817709 4:78236198-78236220 GTTGTCAAGGCCAGGGAGATAGG + Intronic
980140856 4:128914753-128914775 GTTTTCAAGATCATGGTTATTGG + Intronic
983989579 4:174101367-174101389 TTTGTCAAGGCCACAGGTATTGG - Intergenic
986139733 5:5018251-5018273 CTTGTCCTGGCCATGGCTTTTGG + Intergenic
988058016 5:26125620-26125642 CTTAGCAACGCCATGGTTAATGG - Intergenic
995435595 5:112131512-112131534 CCTGTCAAGCCCATGGTGAAAGG + Intergenic
997603733 5:135157648-135157670 CTACTCAAGGCCATGGTGCTGGG + Intronic
1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG + Intronic
1002049655 5:176563045-176563067 CCAGTCAAGGCTGTGGTTATGGG + Intronic
1002587172 5:180256522-180256544 CCTGGCAAGGCCATGGATGTGGG + Intronic
1004942711 6:20577681-20577703 CTTGTCTAGCCCATAGTTACAGG + Intronic
1004967335 6:20868679-20868701 CTTGTTAGTGCCATTGTTATTGG + Intronic
1006921654 6:37631651-37631673 CTTGCCAAGGTCATGGGGATAGG - Exonic
1008496383 6:52138282-52138304 CTTTCCAAGGGCATGGTTGTAGG - Intergenic
1009489104 6:64264935-64264957 ATTGTCAACGGCATGGATATAGG + Intronic
1012353149 6:98278348-98278370 CTTCTCCTGCCCATGGTTATTGG + Intergenic
1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG + Intergenic
1033557124 7:142498636-142498658 CTTGTCAAGGTAATGGTATTGGG + Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035764070 8:2091692-2091714 CTTGTCAAGCCTGTGGTTCTGGG - Intronic
1036850831 8:12200123-12200145 CTTGGCAAGGCCTTAGCTATGGG + Intergenic
1036872195 8:12442401-12442423 CTTGGCAAGGCCTTAGCTATGGG + Intergenic
1042325636 8:67524832-67524854 CTTGTCAATTCCATGGTAAGGGG - Intronic
1043566992 8:81559469-81559491 CTTTTCTAGGCCAGGGTGATCGG + Intergenic
1045611321 8:103846383-103846405 CTAGTCAAGGGCATGGTTTCAGG + Intronic
1047220380 8:122913910-122913932 CTCATGAAGGCCATTGTTATAGG - Intronic
1048912560 8:139150038-139150060 CTTGACAAAGCGATGGGTATGGG + Intergenic
1051908971 9:22131007-22131029 CTTGCAAAGGCTATGGTTAAGGG + Intergenic
1052291726 9:26849245-26849267 CTTGACTAGGCAATAGTTATAGG - Intronic
1056605042 9:88078517-88078539 CTTGTCAAGGGCTTGGGTAGGGG + Intergenic
1059823153 9:117996512-117996534 CTTGGCAAGGAGATGGTTCTTGG - Intergenic
1203739340 Un_GL000216v2:165081-165103 CTTGTCAAGGCCCTGTCTACAGG + Intergenic
1203739661 Un_GL000216v2:168072-168094 CTTGTCAAGGCTCTGGCTACAGG + Intergenic
1203740533 Un_GL000216v2:173583-173605 CTTGTCAAGGCTATGCTTACAGG - Intergenic
1203740930 Un_GL000216v2:176338-176360 CTTGTCAAGGTTCTGCTTATAGG - Intergenic
1189520985 X:41767730-41767752 CTTGCCTAGGTCAGGGTTATGGG + Intronic
1192302506 X:69920104-69920126 CTTGTCAATGCAATGGTGAAGGG - Intronic
1192717407 X:73659005-73659027 CTTGTCAGGGCCATGGCTGCTGG - Intronic
1192718270 X:73665846-73665868 CTTGTCAGGGCCGTGGCTGTTGG - Intronic
1194398033 X:93410910-93410932 CTTTTTAAAGCCATAGTTATGGG - Intergenic
1196189819 X:112782548-112782570 CATGTCAAGGCAACGCTTATTGG + Exonic
1196286325 X:113884953-113884975 GTTGGCAATGCAATGGTTATAGG - Intergenic
1201125775 Y:10912814-10912836 CTTGTCTAGGCTCTGTTTATGGG - Intergenic
1201175331 Y:11305519-11305541 CTTGTCAAGGCCCTGCCTACAGG - Intergenic