ID: 955563701

View in Genome Browser
Species Human (GRCh38)
Location 3:60221935-60221957
Sequence GTGCATACCCACATTTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955563701_955563703 11 Left 955563701 3:60221935-60221957 CCTATATAAATGTGGGTATGCAC 0: 1
1: 0
2: 1
3: 9
4: 130
Right 955563703 3:60221969-60221991 TTCGCATTCCATTAGGAGCACGG 0: 1
1: 0
2: 0
3: 5
4: 64
955563701_955563702 4 Left 955563701 3:60221935-60221957 CCTATATAAATGTGGGTATGCAC 0: 1
1: 0
2: 1
3: 9
4: 130
Right 955563702 3:60221962-60221984 ACAGAAATTCGCATTCCATTAGG 0: 1
1: 0
2: 0
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955563701 Original CRISPR GTGCATACCCACATTTATAT AGG (reversed) Intronic
908922153 1:69208362-69208384 GAGCATACCCGAATGTATATAGG + Intergenic
914963655 1:152231409-152231431 CTGCATACCCACATTTATTGTGG - Intergenic
915688262 1:157659248-157659270 AAGTACACCCACATTTATATAGG + Intergenic
922591711 1:226782365-226782387 GTGCACACCAACATTGATGTTGG + Intergenic
1063819905 10:9822243-9822265 GTCCATACCCAACTTTAAATAGG - Intergenic
1065407453 10:25385416-25385438 TTGCATACCCATATTCATAGTGG - Intronic
1065615581 10:27518530-27518552 GTCTATATGCACATTTATATAGG + Intronic
1071061871 10:81579807-81579829 GTGCATAAACACATATATGTAGG - Intergenic
1077603122 11:3587902-3587924 TTGCATAACCAGATTTTTATAGG + Intergenic
1078263136 11:9730472-9730494 GTGCATACACACATATACCTTGG - Intronic
1080857529 11:36125145-36125167 GTGCAGACCCACAATCATAAAGG - Intronic
1080909873 11:36585087-36585109 GTGAATACACACATTTTTTTTGG + Intronic
1082755945 11:57076541-57076563 GTGTATACACACATATATGTGGG + Intergenic
1084259010 11:67962439-67962461 TTGCATAACCAGATTTTTATAGG + Intergenic
1084813745 11:71632735-71632757 TTGCATAACCAGATTTTTATAGG - Intergenic
1089083599 11:115798170-115798192 GTGCCCTCCCACATCTATATGGG - Intergenic
1092430328 12:8403447-8403469 TTGCATAACCAGATTTTTATAGG + Intergenic
1095324848 12:40877052-40877074 GTTCATACTCACAATTATTTTGG - Intronic
1097555237 12:61128102-61128124 GTGCATACCATTTTTTATATCGG - Intergenic
1098485440 12:71016175-71016197 GTGCCTACTTACATTTATTTTGG - Intergenic
1099047160 12:77736241-77736263 ATGTATACACACACTTATATGGG + Intergenic
1099313223 12:81053637-81053659 ATTCATACACACATGTATATAGG + Intronic
1104820844 12:131676599-131676621 GTGCGTACACACAGGTATATGGG + Intergenic
1107820224 13:44279109-44279131 GTTTATACCCAGATTTATGTTGG - Intergenic
1108818120 13:54315569-54315591 GTGCATACCCCCTGTGATATTGG - Intergenic
1109254893 13:60067900-60067922 GTGCATGCACACACCTATATAGG - Intronic
1109409290 13:61942813-61942835 ATGTATACCCACTGTTATATTGG + Intergenic
1111810877 13:93094130-93094152 GTGCATACCCCCAGCGATATTGG - Intergenic
1111811143 13:93095910-93095932 GTGTATACCCACTATTATATTGG - Intergenic
1112769966 13:102784114-102784136 CTGAATACCCACAATAATATGGG + Intergenic
1115039644 14:28908318-28908340 GTTCATAGCCACTTTTTTATGGG - Intergenic
1116518971 14:45828483-45828505 GTGTATACCCACTTCAATATTGG - Intergenic
1119513685 14:75231312-75231334 GTGCACACCTGCATGTATATGGG + Intergenic
1120483609 14:85083215-85083237 GTGCCTACCCAGATTAAGATTGG - Intergenic
1123954920 15:25325132-25325154 GTGCAGACCCACATTTTGCTGGG + Intergenic
1124155643 15:27223146-27223168 GGGCTGACCCACATTAATATTGG - Intronic
1130602000 15:85282101-85282123 ATGTATACACACATATATATAGG - Intergenic
1133365859 16:5209422-5209444 TTGCATAGCCAGATTTTTATAGG - Intergenic
1133472705 16:6091156-6091178 GTGCAAACCTACAGTTAGATAGG - Intronic
1134413802 16:14025976-14025998 GTGCATCTCCCCATTTATTTAGG - Intergenic
1135964423 16:27024088-27024110 ATACATACACACATATATATAGG - Intergenic
1138767368 16:59620412-59620434 CTGCATAAACACCTTTATATGGG + Intergenic
1140587781 16:76314451-76314473 GTGTATACACACATATGTATAGG + Intronic
1145048781 17:19642697-19642719 GTGGACACAAACATTTATATTGG + Intergenic
1149335839 17:55635007-55635029 GTGCCTAACCATATTTAGATTGG + Intergenic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1150957532 17:69876863-69876885 GTGAATCCTCAAATTTATATGGG + Intergenic
1202644828 1_KI270706v1_random:130449-130471 GTGTATACCCACTGTGATATTGG - Intergenic
927584605 2:24290197-24290219 CTGCAAACCCTCATCTATATTGG + Intronic
928692585 2:33816297-33816319 GTGTATACGTATATTTATATAGG - Intergenic
933231659 2:79814590-79814612 GTGTATACACACATATATAATGG - Intronic
940168353 2:150800040-150800062 GTGCCCACCCACATTTAAAGTGG - Intergenic
941678341 2:168368186-168368208 ATGCATACATATATTTATATGGG + Intergenic
941880945 2:170479987-170480009 ATACATACACACATATATATAGG - Intronic
1170951688 20:20942260-20942282 ATGCATACATACATATATATAGG + Intergenic
1171308389 20:24125667-24125689 GTGCTTACCTAAATATATATGGG + Intergenic
1171894785 20:30749368-30749390 GTGTATACCCACTGTGATATTGG - Intergenic
1174088686 20:48029045-48029067 TTGCATGCCCACATTTATAGAGG - Intergenic
1174726906 20:52872108-52872130 GTGCGCACACACATATATATAGG - Intergenic
1174954514 20:55082479-55082501 GTGTATACCCATGTATATATAGG + Intergenic
1177465579 21:21474770-21474792 GTGTATACACACACATATATGGG - Intronic
1180357128 22:11851994-11852016 GTGTATACCCACTGTGATATTGG + Intergenic
1180381134 22:12140337-12140359 GTGTATACCCACTGTGATATTGG - Intergenic
1181933776 22:26425341-26425363 GTGTATACCCACATGTGTACAGG + Intergenic
1184448158 22:44565760-44565782 TTGCCCACCCACATTTATAAGGG - Intergenic
950554189 3:13685385-13685407 GTGGAAACCCAAATTTGTATGGG - Intergenic
951035614 3:17928702-17928724 GTGGAAACCCAGATTTATAAGGG - Intronic
953636098 3:44666385-44666407 GTGCACACGCACACGTATATGGG - Intergenic
954257337 3:49415920-49415942 GTGCAGACCCACATTCCCATAGG - Exonic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
955837582 3:63073684-63073706 GTGCATAGGGACATTTGTATTGG + Intergenic
956940365 3:74153626-74153648 GTACCTACCCAAATTTATGTTGG + Intergenic
957073958 3:75586969-75586991 TTGCATAACCAGATTTTTATAGG + Intergenic
957189569 3:76989859-76989881 ATGCATGCCCACATGTGTATGGG - Intronic
960080377 3:113534150-113534172 ATACATAAACACATTTATATGGG - Intronic
960201064 3:114837252-114837274 GTGCATACTCACATACATACAGG - Intronic
960554449 3:119011967-119011989 GTGTATACACACATATATATAGG + Intronic
961280128 3:125759760-125759782 TTGCATAACCAGATTTTTATAGG - Intergenic
961347513 3:126273855-126273877 GTGCATCCTCCCATTCATATGGG - Intergenic
965362989 3:167764272-167764294 ATTCATACCCAAATTTATACAGG + Intronic
968408968 4:369197-369219 ATGTATACCCACATTTATCATGG + Intronic
968469161 4:770375-770397 TTGCAAACCCTCATTTAAATTGG + Exonic
969017540 4:4114275-4114297 TTGCATAACCAGATTTTTATAGG + Intergenic
969736403 4:8994036-8994058 TTGCATAACCAGATTTTTATAGG - Intergenic
969795598 4:9525599-9525621 TTGCATAACCAGATTTTTATAGG - Intergenic
970269690 4:14332165-14332187 GGGCATATCCACATTTAATTTGG - Intergenic
970830163 4:20328857-20328879 GTACATACACACATTTATTTTGG - Intronic
972055734 4:34800236-34800258 ATACAGACACACATTTATATAGG + Intergenic
973371071 4:49249008-49249030 GTGTATACCCACTGTGATATTGG - Intergenic
973389957 4:49546447-49546469 GTGTATACCCACTGTGATATTGG + Intergenic
974417793 4:61632944-61632966 GTGAATAACCCCATTAATATTGG - Intronic
980613745 4:135192420-135192442 GAGCACACCCACAGTTATACAGG + Intergenic
980729618 4:136810312-136810334 ATTCATACCAACATTTATAATGG + Intergenic
982341741 4:154307382-154307404 GTGCATACACACATAGGTATGGG - Intronic
983624075 4:169787001-169787023 GTGTATACCCCCTTTGATATGGG + Intergenic
983693661 4:170502683-170502705 GTGCATACCTATATCCATATGGG + Intergenic
985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG + Intergenic
988464271 5:31473419-31473441 ATGCATGCCTACATATATATTGG - Intronic
990428075 5:55708583-55708605 GTCCATAGTCACATTTATTTGGG - Intronic
993812935 5:92505106-92505128 GGGCATGCCCACAGTTATCTTGG - Intergenic
994391938 5:99200413-99200435 GTGTACACCCACTTTGATATTGG + Intergenic
997175633 5:131773605-131773627 GTGCATAAACACATTTTTCTAGG - Intronic
997599426 5:135129242-135129264 GTGTATATGCACATTTAAATTGG + Intronic
998302971 5:141043631-141043653 GTGCATACGTATATCTATATGGG - Intergenic
999991890 5:157057578-157057600 ATGCATAGACACATGTATATAGG - Intronic
1004848717 6:19674261-19674283 ATGCATACACACATATATTTTGG + Intergenic
1012645696 6:101677869-101677891 GTGAAAATCAACATTTATATTGG - Intronic
1012695663 6:102379368-102379390 CTGCACTCCCACATTCATATTGG - Intergenic
1014845576 6:126271965-126271987 TTTCATACCCACATTGATATGGG + Intergenic
1021020262 7:15589031-15589053 GTACAGACCCACATTTAAGTGGG + Intergenic
1021442754 7:20697193-20697215 TGGCTAACCCACATTTATATTGG - Intronic
1022067690 7:26876712-26876734 ATGCATATGCACATTTTTATAGG + Intronic
1024532257 7:50403126-50403148 GTGCAAAGAGACATTTATATTGG - Intronic
1025703528 7:63842174-63842196 GTGTATACACACATATATTTTGG - Intergenic
1026130609 7:67617498-67617520 GTGCACACACACATTTAAAATGG - Intergenic
1029076029 7:97935099-97935121 TTGCATAACCAGATTTGTATAGG + Intergenic
1035741633 8:1932236-1932258 GTGCATACACACATGTGCATGGG - Intronic
1036241485 8:7085257-7085279 TTGCATAACCAGATTTTTATAGG - Intergenic
1036819686 8:11930714-11930736 GTGTACACCCACTTTGATATTGG - Intergenic
1036831249 8:12021834-12021856 TTGCATAACCAGATTTTTATAGG + Intergenic
1037453457 8:19040035-19040057 GTGCATTCCCTCATTCATTTAGG - Intronic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1040901774 8:52424888-52424910 GTGCATACACACTTTTTTATGGG - Intronic
1045180497 8:99776080-99776102 GTCCATACCCATATTTCCATAGG - Intronic
1046587358 8:116163905-116163927 GTGCACACACACATATACATAGG + Intergenic
1053583699 9:39434537-39434559 GTGCATGTGCACATGTATATTGG + Intergenic
1054105279 9:60993280-60993302 GTGCATGTGCACATGTATATTGG + Intergenic
1203695477 Un_GL000214v1:93807-93829 GTGTATACCCACTGTGATATTGG - Intergenic
1203742190 Un_GL000218v1:12508-12530 GTGTATACCCACTGTGATATTGG + Intergenic
1203554363 Un_KI270743v1:193153-193175 GTGTATACCCACTGTGATATTGG + Intergenic
1203640796 Un_KI270751v1:10256-10278 GTGTATACCCACTGTGATATTGG + Intergenic
1186038867 X:5454359-5454381 GTGCATACCTATATATATATAGG - Intergenic
1186119527 X:6344544-6344566 GTACATACCCTGATTTTTATTGG + Intergenic
1186138227 X:6542831-6542853 GTACACACACACATATATATGGG - Intergenic
1188366360 X:29320236-29320258 GTGCATATGTACATTTTTATGGG + Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191796142 X:65023799-65023821 GTGCATACATACATTTATTGTGG + Intronic
1193801222 X:85938630-85938652 GTGCATAGCTACATTTTTCTAGG - Intronic
1199052590 X:143254171-143254193 GTGCCTACCCACATTAAGAGTGG - Intergenic
1201155723 Y:11129984-11130006 GTGTATACCCACTGTGATATTGG + Intergenic
1201469727 Y:14319851-14319873 GTCCATAACCACACTGATATGGG + Intergenic