ID: 955565497

View in Genome Browser
Species Human (GRCh38)
Location 3:60239944-60239966
Sequence CTAAGCCTCAGTTTCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 339}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955565491_955565497 9 Left 955565491 3:60239912-60239934 CCTTATGACCACAAGTTGGTCAG 0: 1
1: 0
2: 3
3: 8
4: 97
Right 955565497 3:60239944-60239966 CTAAGCCTCAGTTTCTCACAGGG 0: 1
1: 0
2: 3
3: 38
4: 339
955565489_955565497 20 Left 955565489 3:60239901-60239923 CCTATTATTGGCCTTATGACCAC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 955565497 3:60239944-60239966 CTAAGCCTCAGTTTCTCACAGGG 0: 1
1: 0
2: 3
3: 38
4: 339
955565492_955565497 1 Left 955565492 3:60239920-60239942 CCACAAGTTGGTCAGTTCGCCTC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 955565497 3:60239944-60239966 CTAAGCCTCAGTTTCTCACAGGG 0: 1
1: 0
2: 3
3: 38
4: 339
955565488_955565497 21 Left 955565488 3:60239900-60239922 CCCTATTATTGGCCTTATGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 955565497 3:60239944-60239966 CTAAGCCTCAGTTTCTCACAGGG 0: 1
1: 0
2: 3
3: 38
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955565497 Original CRISPR CTAAGCCTCAGTTTCTCACA GGG Intronic
900929158 1:5725506-5725528 CCAAGCCTCTGCTTCTCATATGG + Intergenic
901526471 1:9825772-9825794 CCAAGCCTCAGGTCCTTACAAGG + Intergenic
902719101 1:18292270-18292292 CTGGGCCTCAGTATCTCACTTGG - Intronic
903357785 1:22758684-22758706 CTAGGCCTCAGTTTCCCTCTCGG + Intronic
903436995 1:23357608-23357630 CAAAGAGTCAGTTTCTCCCAGGG + Intergenic
903543055 1:24107654-24107676 CCAGGCCCCAGTTTCCCACAAGG - Intronic
904773093 1:32891950-32891972 CTGAGCCTCAGTTTCTTATCTGG + Intronic
904944570 1:34189834-34189856 CTGAGCCTCAGTTTCAGGCAGGG - Intronic
904947195 1:34208135-34208157 CTGAGCCTCTGTTTCTCCCCAGG + Exonic
905733888 1:40313483-40313505 CTGAGCCTTAGTTTCTCATCTGG + Intronic
905809776 1:40903603-40903625 CTGGGCCTCAGTTTATCAAAAGG - Intergenic
906079121 1:43071965-43071987 CTGAGCCTCAGTTTCTCCACTGG - Intergenic
906646041 1:47475850-47475872 CTAAGCTTCAGTTTCTTCCCTGG + Intergenic
907386059 1:54125934-54125956 CTGAGCCTCAGTTCCTCCCAGGG - Intergenic
907432348 1:54420447-54420469 CCAAGCCTCAGCTTCTCCCCTGG - Intergenic
907579612 1:55559848-55559870 CTGAGCCTCAGTTTCTACCTCGG - Intergenic
907760363 1:57352237-57352259 CTAAGCCTCAGTTTATCATCTGG + Intronic
908116694 1:60947880-60947902 CTGAGCCTCAGTTTCTTTGAAGG - Intronic
911461958 1:98202586-98202608 CTAAACCTAATTTTCTCCCATGG - Intergenic
912238862 1:107883822-107883844 CTAAGTCTAAGTTTCTGCCAAGG - Intronic
912914168 1:113795293-113795315 CCCAGCCTCAGTTTCTTCCATGG + Intronic
913158735 1:116126529-116126551 CTGAGCCTCAGTCTCTTAGATGG - Intronic
913481368 1:119292651-119292673 CTGAGCATCAGTTTCTCCCCTGG - Intergenic
916569585 1:166013619-166013641 ATAAGCCTTAATTTCTCAAAAGG + Intergenic
918008814 1:180567056-180567078 CTAAGCCTCAGTTTCCTCAATGG + Intergenic
920227989 1:204451639-204451661 CTGTGCCTCAGTTTCTCATCAGG + Intronic
920445713 1:206014661-206014683 CTGAGGCTCAGTTTCTTCCACGG - Intronic
920539122 1:206764198-206764220 CTAAGGCTTAGTTTCTCATCTGG - Intergenic
921424184 1:214983608-214983630 CTGAGCCTCAGTTTCCCATCTGG - Intergenic
924026571 1:239839599-239839621 CTAAGCATCATATTCTGACATGG - Intronic
924304007 1:242668312-242668334 GGAAGCCTCAGTCTTTCACATGG - Intergenic
924474390 1:244370413-244370435 CTGAGCCTCAGTTTCTTATCAGG + Intronic
924640386 1:245827786-245827808 CTGGGTCTCAGTTTCTCACCTGG - Intronic
1064704424 10:18057058-18057080 CTGAGCCTCAGTTTCCATCACGG + Intergenic
1065046815 10:21753022-21753044 CTATGCCTCAGTTCCTCATCTGG - Intergenic
1065386105 10:25134600-25134622 CTAACCCTTTGTTTCTAACATGG + Intergenic
1065685349 10:28279185-28279207 CTAAGGCTCAGTATCTCCTAAGG + Intronic
1066261481 10:33733467-33733489 CTAGACCTCAGTTGCTCAAAAGG + Intergenic
1067661851 10:48241898-48241920 GCAAGCCCCAGTTTGTCACATGG - Intronic
1068615192 10:59106638-59106660 CTAAGTGTCAGTTTCTTAAATGG - Intergenic
1068656886 10:59585012-59585034 CCCAGCCTCAGTTTTTCTCATGG - Intergenic
1069274222 10:66569027-66569049 CAAAGCCACAGTTTATCAGAGGG - Intronic
1069567510 10:69473621-69473643 CTGAGCCTCAGTTTCCCAGTTGG - Intronic
1069783002 10:70968624-70968646 CTATGCCTCAGTTTCCTCCATGG + Intergenic
1069831163 10:71283243-71283265 CTGAGCCTCAGTTTCTTCAAAGG + Intronic
1069963464 10:72093425-72093447 TTAAGCCTCAGTTTGTAAAATGG + Intergenic
1070784191 10:79153690-79153712 CTCTGCCTCAGTTTCTCCAATGG - Intronic
1071787104 10:88913477-88913499 ATGAGGCTCAGTGTCTCACATGG - Intronic
1072302585 10:94075828-94075850 CTTTGCCTCAGTTTTTCAGATGG + Intronic
1072685130 10:97532073-97532095 CTAACCCTCAGTGTCCCACCTGG - Intronic
1073171984 10:101518385-101518407 ATTAGCCTGAGTTTCTTACATGG + Intronic
1075296134 10:121276964-121276986 CAAAGCAGCAATTTCTCACAAGG + Intergenic
1078138451 11:8672229-8672251 CTCAGCCTCAGTTCCTCACCTGG + Intergenic
1078481130 11:11676667-11676689 CTCAGGCTCAATTTCTCAAATGG + Intergenic
1079140524 11:17806461-17806483 CTAAGCCTCAGCTTCTTCAAGGG - Intronic
1079239646 11:18713637-18713659 CTAAGTCTCAGCTTCTTACCTGG - Intronic
1079283945 11:19112449-19112471 CTGAGCCTCAGTTTCTCCATGGG + Intergenic
1080113548 11:28596770-28596792 TTGAGCCTCTGTTTTTCACAGGG + Intergenic
1080578688 11:33623558-33623580 CTTTGCCTCAGGTTCTCCCAGGG - Intronic
1080711770 11:34755223-34755245 CTGAGCCTCATTTTCTCACTTGG - Intergenic
1080839548 11:35971357-35971379 CTAACCCTCAGTACCTCAGAAGG + Intronic
1081584161 11:44372698-44372720 CTGAGCCTCAGTTTCCCATCTGG + Intergenic
1081966653 11:47174182-47174204 CAAAACCTCAGTTTCTAAAATGG - Intronic
1082011152 11:47450253-47450275 CTAACACTCAGTATCTCATAAGG + Intergenic
1082774577 11:57235608-57235630 CTCAGCCTCAGTTTCTCCATTGG - Exonic
1082927086 11:58560698-58560720 CTAAGCCCCAGTTTTTCATTTGG - Intronic
1083333377 11:61909396-61909418 CTGAGCCTCAGTTTCTCCCTTGG + Intronic
1084173449 11:67411331-67411353 CTAAGCCTGTGTCTCTAACAGGG - Intronic
1084448566 11:69218654-69218676 GTAAACCACACTTTCTCACAGGG + Intergenic
1085270019 11:75264766-75264788 CTGGGCCTCAGTTTCTCACTTGG - Exonic
1085281830 11:75335991-75336013 GTGAGCCTTGGTTTCTCACAGGG - Intronic
1085301806 11:75463021-75463043 CTGAACCTCAGTTTCTCCCAGGG - Intronic
1085513987 11:77101880-77101902 TTAATCCTCAGTTTCCCCCAGGG - Intronic
1085750552 11:79157244-79157266 CTGAGCCTCAGTTTCTGTCCTGG + Intronic
1087303555 11:96462855-96462877 CTAATCCTCAGTACCTCAGAAGG - Intronic
1088335659 11:108700732-108700754 CTAAGCCTCAGTTTCTTCTCTGG + Intronic
1088696348 11:112369508-112369530 CTAAGCCTCAGTTCCTCATCTGG - Intergenic
1089180858 11:116581927-116581949 CTGAGCCTCAGTTGCTCATTAGG - Intergenic
1089190847 11:116652108-116652130 CTGAGCCTCAGTTTCTCCTCTGG + Intergenic
1089640056 11:119842078-119842100 CCAAGCCTCTGTGTCTCACATGG + Intergenic
1089651910 11:119920164-119920186 CTGGGCCTCAGTTTCCCTCAGGG - Intergenic
1090561371 11:127936210-127936232 CCCAGCCTCAGATTCTTACAAGG - Intergenic
1092957818 12:13565805-13565827 GTAAGTCTCATTGTCTCACAGGG + Intronic
1093328814 12:17810973-17810995 CTATCCATCAGTCTCTCACACGG - Intergenic
1095306590 12:40645706-40645728 CTGAGCCTCAGTTTTTCACGTGG + Intergenic
1095593288 12:43930449-43930471 CTAAGCCACAGTTTTCCATATGG + Intronic
1098754255 12:74338796-74338818 CTAAACCTCGGTTTCTCTCAAGG - Intergenic
1099501941 12:83424124-83424146 CTGTGCCACAGTTTCTCAAATGG - Intergenic
1102438417 12:112943368-112943390 CTGAGCCTCAGTTTCCCCAATGG - Intronic
1102450392 12:113037650-113037672 CTGAGCCTCAGTTTCCCCCTCGG - Intergenic
1102683736 12:114707994-114708016 CTAAGCCTCAATTTCCCCAATGG - Intergenic
1102722112 12:115025764-115025786 CTCAGCCACATTTTTTCACATGG + Intergenic
1103259919 12:119577870-119577892 GTAAGCCCCAGTTTCTCATTGGG + Intergenic
1103359975 12:120347741-120347763 CTGAGCCTCAATTTCTCCCCTGG + Intronic
1104074710 12:125378867-125378889 CTGAGCCTCATTTGCTCATATGG + Intronic
1105421660 13:20257851-20257873 TTTAGCCTGAGTTTCTTACATGG + Intergenic
1106160359 13:27195816-27195838 CTGTGCCTCAGTTTCCCTCATGG + Intergenic
1106565710 13:30882979-30883001 TAAAGCCTCAGTTTCCCACATGG - Intergenic
1106680738 13:32004352-32004374 CAAAGCCTCAGTTTCTTAATTGG + Intergenic
1106754300 13:32806951-32806973 CAAAGCCTGAGGTTCCCACATGG - Intergenic
1109696044 13:65959331-65959353 CTAAGCAGCTGTTTTTCACAAGG + Intergenic
1113136108 13:107091198-107091220 CTCAGCCTCAGTTCCCCACCTGG - Intergenic
1114322191 14:21556122-21556144 CAAAGTCTCACTCTCTCACATGG - Intergenic
1114483624 14:23049803-23049825 CTCTGCCTCAGTTGCTCACCTGG + Exonic
1114742442 14:25111621-25111643 CTATGCCTAAGTTTTTAACAAGG + Intergenic
1116986424 14:51224450-51224472 CTGAGCCTCAGTTTCCTAAATGG - Intergenic
1118452607 14:65917790-65917812 GCAAGCCTCGGTTTGTCACAGGG - Intergenic
1118720278 14:68589043-68589065 CTAAGCCTCAGTTTCCTCCTAGG + Intronic
1120748923 14:88179463-88179485 CCAAGCCTGAGTATCTCACTAGG - Intergenic
1121034683 14:90691300-90691322 CTAGGTCTCATTTTCTCTCAGGG + Intronic
1121929139 14:97956491-97956513 CTGAGCCTCAGTTTCTCCACTGG - Intronic
1122114430 14:99520631-99520653 CTGAACCTCAGTTTATCACCCGG + Intronic
1122316808 14:100830305-100830327 CTAAGTTTCAGTTTCTTTCATGG + Intergenic
1122756915 14:103988812-103988834 CTAAGTCCCAGCTACTCACAAGG - Intronic
1122801150 14:104230221-104230243 CTGAGCCTCAGTTTCCCATCAGG - Intergenic
1125059843 15:35406322-35406344 ATAAGCCTCATTTTCCCCCAAGG + Intronic
1125088914 15:35767942-35767964 CAATCCTTCAGTTTCTCACAAGG + Intergenic
1125467326 15:39966877-39966899 CTAATCCTCAGAACCTCACATGG - Intronic
1126665419 15:51072050-51072072 CTAAGCCTCTGCTGATCACAGGG + Intronic
1129520375 15:76182232-76182254 CTGAGCCTCAGCTTCTCATTGGG + Intronic
1130236590 15:82140886-82140908 CTAAAACTCATTTTCTCCCAGGG + Intronic
1130643976 15:85707245-85707267 CCAAGCCTCTGTGTCTCAGAAGG - Intronic
1133668626 16:7995682-7995704 CTAAGCCGCAGTCTTTCACCAGG - Intergenic
1135757540 16:25110584-25110606 CACATCCTCAGTTTCTCACGTGG - Intergenic
1135860477 16:26051511-26051533 CTAAGCCTCAGTTTCCCCCTGGG - Intronic
1137710425 16:50563099-50563121 CTAAGCCACAGGTTCCCAGAGGG - Intronic
1138097051 16:54220010-54220032 CTGACCCTCAGTTTCTCATCTGG + Intergenic
1138434357 16:56988984-56989006 CTGAGCCTCAGTGGCTCACCTGG + Intergenic
1138724179 16:59117834-59117856 CTGAGTCTCAGTTTCCCACCTGG + Intergenic
1140171962 16:72614894-72614916 CTATGCCTCAGTTTGTGAGATGG + Intergenic
1140255540 16:73332838-73332860 CTATGTCTCAGTTTCTCTCTTGG - Intergenic
1140876892 16:79161301-79161323 CTAAGCCTCAGCTTATCTCTAGG + Intronic
1141492224 16:84381847-84381869 CTAAGCCTCAGATTTCTACAGGG - Intronic
1143256342 17:5560709-5560731 TGGAGCCTCAGTTGCTCACAAGG + Intronic
1143951814 17:10638515-10638537 CTAAGACTCAGTTTGTCTAATGG - Intronic
1144110277 17:12023820-12023842 CGAAGCCTCAGTTTCTCACTTGG + Intronic
1144284438 17:13759406-13759428 CTAAGACTCTGTTTCTCAAAGGG - Intergenic
1144939794 17:18930668-18930690 CTAAGCCTATGTTTCTGAAAAGG - Exonic
1145388163 17:22433786-22433808 CTGAGCCTCAGTTTTTCATAGGG + Intergenic
1145808741 17:27752410-27752432 CTAAGCCTCATTACCTCACCAGG + Intergenic
1146150822 17:30469390-30469412 CTGAGCCTCAGTTTCTCTACTGG + Exonic
1146318846 17:31830787-31830809 CTGGGCCTCAGTTTCTTACCTGG - Intergenic
1146680858 17:34807085-34807107 CTGAGCCTCAGTTTCTTCCCTGG - Intergenic
1146807743 17:35878745-35878767 CTGAGCCTCAGTTTCTGTCAAGG - Intronic
1147055073 17:37827883-37827905 CTGAGCCTCAGTTTTCCAAAGGG - Intergenic
1147568424 17:41552030-41552052 CTGAGCCTCAGTTTCCCATCTGG + Intergenic
1147575104 17:41594470-41594492 CCAAGCCTCAGTTCCACATATGG + Intergenic
1148463895 17:47853074-47853096 CTAAGCCTCAGTTTCTTCCTTGG + Intronic
1148741216 17:49894035-49894057 CTCAGCCTGAGCTTCTCAAATGG + Intergenic
1149010775 17:51854214-51854236 CTTGGCCTCAGTTTCTCACCAGG - Intronic
1152259681 17:79260262-79260284 CTGAGGCTCAGCTTCTCCCAGGG + Intronic
1155715501 18:28937889-28937911 GTTACCCTCAGTTTATCACACGG + Intergenic
1156262753 18:35460037-35460059 CTGAGCCTCAGCTTCCCCCAGGG + Intronic
1156413026 18:36854015-36854037 TTAATCCTCAGTATCTCAGAAGG + Intronic
1156828243 18:41459217-41459239 CAAACCATCAGTCTCTCACAAGG + Intergenic
1157558188 18:48627314-48627336 CTCTGTCTCAGTTTCTCACAGGG + Intronic
1158878641 18:61755303-61755325 CTGTGCCTCAGTTTCTCCCATGG + Intergenic
1160519584 18:79496874-79496896 CTGAGCCTCAGTTTCCCCCCGGG - Intronic
1162004883 19:7771384-7771406 CTGAGCCCCAGTTGCCCACATGG + Intergenic
1163349087 19:16764055-16764077 CTAAGGCAGAGGTTCTCACAAGG + Intronic
1163761610 19:19140035-19140057 CCATGCCTCAGTTTCCCCCAGGG + Intergenic
1164853264 19:31501820-31501842 CTCAGCCTCAGTATCTAAAATGG + Intergenic
1165402592 19:35611451-35611473 CTAAGCATTAGATTCTCATAAGG - Intergenic
1166707953 19:44918993-44919015 CTGTGCCTCAGTTTCCCAGATGG - Intronic
1167497391 19:49827664-49827686 CTAAGCCCCAGTACCTCAGAAGG - Intronic
1167505970 19:49871243-49871265 CCAAGCCTCAGTTTCTCCACTGG + Intronic
1202649251 1_KI270706v1_random:165869-165891 TTAAGCCTGAGTTTCTGAGAGGG - Intergenic
925113942 2:1362058-1362080 CTCAGCCTCAGTGACTCTCATGG - Intronic
925825179 2:7841276-7841298 CTGTGCCTCAGTGTCTAACAGGG + Intergenic
925861894 2:8186664-8186686 CTAAGACTCAGTTTCTGACCTGG + Intergenic
927808577 2:26169480-26169502 CTAGGCCCCAGATTCTCCCACGG + Intergenic
929365066 2:41144337-41144359 TAATGCCTGAGTTTCTCACAGGG + Intergenic
930601102 2:53444187-53444209 CTCAGCCTCATTCTCTCCCAAGG + Intergenic
931585239 2:63819221-63819243 CTAAGCCTCAATTTTTATCAGGG + Intronic
931872878 2:66480420-66480442 CTAAGCCAGAGTTTCTTTCAAGG + Intronic
932576372 2:72964476-72964498 CTCAGCCTCAGTTTCCCACCTGG - Intronic
933151958 2:78926132-78926154 CTTAACTTCAGTTTCTCAAATGG - Intergenic
933164650 2:79062814-79062836 CTCAGCATCAGTTTCACACAAGG - Intergenic
933654830 2:84879023-84879045 TTCACCCTCATTTTCTCACAAGG + Intronic
935147892 2:100408719-100408741 CTAAGCCTCAGTTTCTTGAAGGG - Intronic
938979892 2:136516340-136516362 CTGAGCCTCAGTTTCTGCCTGGG + Intergenic
939722102 2:145666711-145666733 CTAAGCCTCAGTTTGAAAGATGG - Intergenic
940505718 2:154550458-154550480 GTAAGCCTCACTTTCCCATACGG + Intergenic
942499067 2:176569156-176569178 CTCAGCATCAGTCTCTCAAAAGG + Intergenic
943332110 2:186572118-186572140 CTAACCCTCATTTTCTAAAATGG + Intergenic
944552012 2:200852651-200852673 CTAAGCCTCAGGATCCCAAATGG + Intergenic
944669882 2:201985760-201985782 CTCAGCCTCAGTTTCCTTCAGGG + Intergenic
944919930 2:204402339-204402361 ATAAGACTCTGTTTATCACATGG + Intergenic
945057918 2:205884308-205884330 CTAAGCATTAGATTCTCATAAGG - Intergenic
946157586 2:217817278-217817300 CTAAGCCTCAGTTTGTAAACTGG + Intronic
946669679 2:222089425-222089447 TTGAGCCTCAGCTGCTCACAGGG + Intergenic
948348594 2:237320000-237320022 CTGAGCCCCAGTTGCTCTCAAGG + Intergenic
1168760594 20:347423-347445 CTCTGCCTCAGTTTCTCTCTAGG + Intronic
1168767608 20:392377-392399 CTGAGCCTCAGTTTCTCCGTTGG + Intronic
1169284626 20:4297647-4297669 CTAAACCTTTGTTTCCCACAAGG - Intergenic
1169550302 20:6695431-6695453 TTAAGCCTCAGTTGCTCATAAGG - Intergenic
1169626161 20:7571945-7571967 TTAAGCTTCAATTTTTCACATGG - Intergenic
1170361630 20:15552826-15552848 CTGAGCCTCAGTTGCCTACATGG + Intronic
1170463617 20:16602174-16602196 CCTAGCCTCAGTTTCTCATCTGG + Intergenic
1171063605 20:21991343-21991365 CTATGCCTCAGTTTAAAACAAGG - Intergenic
1171174140 20:23038634-23038656 CTAAGCCTCAGTTTCCCACTTGG + Intergenic
1171326813 20:24301880-24301902 CTGGGCCTCAGTTTCTCAATTGG + Intergenic
1171569018 20:26228151-26228173 CTTAGCTACAATTTCTCACACGG + Intergenic
1172063037 20:32200014-32200036 CAAAGCCTCAGTTCCTCATCTGG - Intronic
1172167674 20:32908858-32908880 CTGTGACTCAGTTTCCCACAGGG - Intronic
1173042304 20:39475773-39475795 CTAACCCCTAGTATCTCACAAGG - Intergenic
1173354950 20:42278604-42278626 CTGGGCATCAGTTTCTCAAAGGG + Intronic
1173580079 20:44140896-44140918 CTGAGCCTCAGTTTCTCCAACGG - Intronic
1174200820 20:48805300-48805322 CTGAGCCTCAGTTTCTTATCTGG - Intronic
1174955816 20:55097123-55097145 CTAAGCCTCAGGTTCCCCCTTGG - Intergenic
1175427232 20:58876007-58876029 CTAAGCCCCAGTTTTTCCTAAGG - Intronic
1175460814 20:59150774-59150796 CTGAGCCTCTGTTTCTCTCCTGG - Intergenic
1175670803 20:60901214-60901236 CTGAGCCCCAGTTGTTCACAAGG + Intergenic
1178354064 21:31895899-31895921 CTAACCCCCAGTATCTCAGAAGG + Intronic
1178380834 21:32106566-32106588 CCAAGCCCCTGTATCTCACATGG - Intergenic
1178464400 21:32833550-32833572 CTAAGCCTCCGTTTTTCCCCAGG + Intergenic
1179802994 21:43820265-43820287 CAAAGCCTGTGTTTCCCACACGG + Intergenic
1180352680 22:11817224-11817246 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1180385572 22:12175133-12175155 TTAAGCCTGAGTTTCTGAGAGGG - Intergenic
1181492524 22:23269395-23269417 CTAACCCTGCGGTTCTCACACGG - Intronic
1181899253 22:26139310-26139332 CCAAGCCTCAGTTTGTCATTTGG + Intergenic
1181950824 22:26552394-26552416 CTAAGCCTCAGTTTCCCCTTCGG - Intronic
1182055855 22:27354082-27354104 CTAACCCTCAGTACCTCAGAAGG - Intergenic
1182057325 22:27369817-27369839 CTTAACGTCAGCTTCTCACACGG + Intergenic
1182073506 22:27479250-27479272 CTCAGCCTCAGCTCCTCACCTGG - Intergenic
1182078892 22:27515059-27515081 CTGAGCCTCAGTTTCCCCAAGGG + Intergenic
1182177016 22:28300925-28300947 CATAGCCTCAGTCTCTCACTTGG + Intronic
1182761833 22:32728701-32728723 CTGAGTCTCAGTTTCCCTCAAGG - Intronic
1182765316 22:32753921-32753943 CAGAGCCTCAATTTCTCATATGG - Intronic
1183292587 22:37012045-37012067 CTGAGCCTCAGTTTCTCCATAGG + Intronic
1183293219 22:37015483-37015505 CTAAGCATCAGTATCACACCTGG + Intronic
1184329647 22:43819230-43819252 CTAGGCCTCAGTTTTTACCAAGG - Intergenic
949254295 3:2026897-2026919 CTAAGCTTCAGTTTGTAAAATGG - Intergenic
950211239 3:11125117-11125139 TTGAGCCTCAGTTTCCCAAAAGG - Intergenic
951958763 3:28290892-28290914 TTCTGCTTCAGTTTCTCACAAGG + Intronic
953294838 3:41704543-41704565 CTAAGACACAGTTTCCCAAATGG + Intronic
953541557 3:43823405-43823427 CTTAGCTTCAATTTCTAACATGG + Intergenic
955565497 3:60239944-60239966 CTAAGCCTCAGTTTCTCACAGGG + Intronic
956650794 3:71502725-71502747 CTAAGCCTCAGTTTCCCCAGTGG + Intronic
957109830 3:75940179-75940201 CTTAGCTACAATTTCTCACACGG - Intronic
958127445 3:89375449-89375471 TTAAGCTCCAGTTTCCCACAGGG - Intronic
958150004 3:89679521-89679543 CTAAACCACAGTTTCTTACATGG - Intergenic
959713930 3:109412579-109412601 CTAACCCCCAGTACCTCACAAGG - Intergenic
959945720 3:112123611-112123633 CTCAGTCTCAGTTCCTCCCAAGG + Exonic
961375892 3:126465576-126465598 CTAAGCCTGTGTCTCTCACTGGG - Intronic
964312435 3:155409068-155409090 ATAAACCTGAATTTCTCACAGGG - Intronic
964877891 3:161390033-161390055 CTAAGTCTTAGTTTCTCATGTGG + Intergenic
967407015 3:189127832-189127854 CTCAGACTCAGTTTCTCACTAGG + Intronic
967816501 3:193803571-193803593 CTAAGCCAGAGTTTGGCACAGGG + Intergenic
969721137 4:8893572-8893594 CTGAGCCTCGGTTTCCCAGACGG + Intergenic
970238544 4:13983633-13983655 CTAAGCCTCTGGCTCTCAGAGGG + Intergenic
970534057 4:17011161-17011183 CTCTGCCTCAGTTTCTCATCTGG - Intergenic
971065471 4:23027126-23027148 CTGAGCCTCAGTTTCTCCATTGG + Intergenic
973375216 4:49281538-49281560 TTAAGCCTGAGTTTCTGAGATGG + Intergenic
973377040 4:49293723-49293745 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
973378904 4:49306158-49306180 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
973379314 4:49309496-49309518 TTAAGCCTGAGTTTCTGAGAGGG - Intergenic
973380189 4:49315492-49315514 TTAAGCCTGAGTTTCTGAGATGG - Intergenic
973382195 4:49328703-49328725 TTAAGCCTGAGTTTCTGAGATGG - Intergenic
976144440 4:82027947-82027969 CTTGGCCTCAGTTTCTAACTGGG - Intronic
976273862 4:83256487-83256509 CTAAGCCTGAGTTTTTTAAATGG - Intergenic
976809306 4:89083771-89083793 CTAAGTCTCAGTCTCTCATTTGG - Intronic
980129798 4:128807952-128807974 CTGAGCCTCAGTTTCTTCCCTGG - Intergenic
981216310 4:142173070-142173092 CTAAGCCTTAGTTTTTCCAAAGG - Intronic
982508526 4:156251001-156251023 CTAACCCTCAGTACCTCAGAAGG - Intergenic
982653995 4:158123302-158123324 CTAAGCCTCAGTTTCTCCATCGG + Intergenic
983998633 4:174214738-174214760 CTAAGCCTGAGCTGCCCACATGG - Intergenic
984053899 4:174902202-174902224 CTAAGCCTCAGTTTCTTCACAGG + Intronic
984064084 4:175026575-175026597 CTGAGCTTCAGTTAATCACAGGG - Intergenic
985089380 4:186348002-186348024 CAAAGTCGCAGTTTCTCACAAGG - Intergenic
985651407 5:1109404-1109426 TTAACCCTCAGTTTCTCAGTGGG - Intronic
986565845 5:9113105-9113127 CACAGCTTCAGGTTCTCACAAGG - Intronic
987037682 5:14034711-14034733 CTAAGCCTTAGTTGCTGATATGG - Intergenic
988027074 5:25709076-25709098 CTAAGCCCCAGTCTCCCATAGGG + Intergenic
988334405 5:29887380-29887402 CTAAGCCACATTTTTTCCCAGGG + Intergenic
989095237 5:37775796-37775818 CTATGCCCCAGTTTGTAACATGG + Intergenic
989138938 5:38182950-38182972 CTGAGCCTCAGTTTCTTTCTTGG - Intergenic
990051561 5:51507877-51507899 CTCAGCTTCACTTTCTCACCAGG + Intergenic
991168206 5:63588375-63588397 CTAAATGTCAGTTACTCACATGG - Intergenic
991444668 5:66686189-66686211 CTAAGCCTCAGTTTCTTTATCGG + Intronic
992547131 5:77824135-77824157 CTAAGATTCAGTTTCAAACATGG - Intronic
994166758 5:96616912-96616934 CGAAGCCTCTGGTTCTCTCATGG + Intronic
995791073 5:115887692-115887714 CTAAGCCTCAGTTTCTTATCTGG - Intronic
996695534 5:126390865-126390887 TTAAGCCTCAGTTTCCTACATGG - Intronic
997351227 5:133232898-133232920 CCAAGCCTCAGTTTCTGTCCTGG + Intronic
997465828 5:134087455-134087477 ACAAGCCTCACTTTCTCAAATGG + Intergenic
997472577 5:134125005-134125027 CTAGGTCTCAGTTTCTTAAATGG + Intronic
999119601 5:149198865-149198887 GTAAGCCTCAGTTTCTCCACAGG + Intronic
999907190 5:156154672-156154694 GTCAGCCACTGTTTCTCACATGG - Intronic
1001296388 5:170502133-170502155 GTAAGCCTCAATTTCTCTCTGGG + Intronic
1001447299 5:171795453-171795475 CCAAACCTCTGTTTCTCACCTGG - Intergenic
1001978861 5:176023688-176023710 CAAAGCCTCACTTTATCACCAGG - Intronic
1002238554 5:177820074-177820096 CAAAGCCTCACTTTGTCACCAGG + Intergenic
1003594685 6:7463827-7463849 CCATCCCTCAGTTTCCCACAGGG + Intergenic
1004882921 6:20026473-20026495 CTGAGCCTCAGTTTCCCATCTGG + Intergenic
1005077032 6:21918673-21918695 CTGAGCCTCAGTTTCTCTGATGG + Intergenic
1005331843 6:24758302-24758324 CTAACCCTCACTTTCTGTCATGG + Intergenic
1005351358 6:24938577-24938599 ATACGCCTAAGTCTCTCACAGGG + Intronic
1006453980 6:34121706-34121728 CCAGGCCTCAGTTTCTCCCTGGG - Intronic
1008694936 6:54024718-54024740 TGACACCTCAGTTTCTCACATGG + Intronic
1013278297 6:108608260-108608282 CCAAGCATCAGTTTTTCAAAGGG - Intronic
1013634024 6:112011397-112011419 CTTAGCTGCATTTTCTCACAAGG + Intergenic
1016550949 6:145279389-145279411 CTTGGACTCAGATTCTCACATGG + Intergenic
1018961887 6:168455120-168455142 CAAAGCCCCAGTTCCTCCCAAGG - Intronic
1019330581 7:458699-458721 CTGTGCCTCGGTTTCTCACCTGG + Intergenic
1019353064 7:564210-564232 CCAAGTCTCAGGTTCCCACAGGG - Intronic
1019703879 7:2488260-2488282 CTGAGCCTCAGTTTCTCCTCTGG - Intergenic
1019766962 7:2858550-2858572 CTGAGGCTCTGTTTCTGACATGG - Intergenic
1025974862 7:66361706-66361728 GTAAGCCTCACTTACTCAGAGGG + Intronic
1028240599 7:88415346-88415368 CAAAGCCACAGCTTGTCACATGG + Intergenic
1028314183 7:89379287-89379309 TTAAGCCCCAGTTTTTCCCATGG - Intergenic
1029410486 7:100406616-100406638 TTAAACCTCATTTTCTCCCAGGG - Intronic
1030273939 7:107699504-107699526 CTAAGCCTCAGTTTCTTTTCTGG + Intronic
1031425455 7:121600042-121600064 CCAAGCCTCACATACTCACATGG - Intergenic
1032025807 7:128441389-128441411 CTCAGCCTCATTTACACACATGG - Intergenic
1032362496 7:131269129-131269151 CTAAACCAAACTTTCTCACATGG + Intronic
1032387125 7:131532756-131532778 CTAAACCTAAGTCTCTCCCAAGG - Intronic
1034738985 7:153455984-153456006 CTCAACCTCACCTTCTCACAGGG - Intergenic
1034760772 7:153669676-153669698 CTCAGCAGCAGTTTCTCAGAGGG + Intergenic
1036657972 8:10690198-10690220 TTGAGCCTCAGTTTCTCTCCCGG + Intronic
1037504011 8:19512639-19512661 CTGAGCCTTATTTTCTCAAACGG - Intronic
1037530379 8:19766940-19766962 TTAAGCCTCAGTTTCTCTATAGG - Intergenic
1037648254 8:20813381-20813403 CTTTGCCTCAGTTTCTCATCTGG + Intergenic
1038778326 8:30550496-30550518 CTAAGCCTAAGCTACCCACAAGG + Intronic
1039781875 8:40794192-40794214 ACAAGCCTCACTTTCTTACAGGG + Intronic
1040427984 8:47308480-47308502 CTAAGCCTGAGTTTTTCTCCAGG + Intronic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1043711483 8:83424044-83424066 CTAAGCCTCAGTTTTCCATTTGG - Intergenic
1046776574 8:118170164-118170186 CTAAGCCTCAGTTTCTCATTTGG + Intergenic
1046863832 8:119124087-119124109 CTAGGCCACAGTTCCTCTCAGGG - Intergenic
1047888320 8:129278011-129278033 CTAAGCCTCAGTTTTCAATATGG + Intergenic
1047951092 8:129935403-129935425 CCAAGCGTTAGATTCTCACATGG + Intronic
1047982461 8:130197305-130197327 CTAAACCTCAGCTGCTCAGAAGG + Intronic
1048162179 8:132031691-132031713 CTGAGCCTCAGCTGCTCACCAGG + Intronic
1048212440 8:132466557-132466579 CTAAGCCTCAGTTGCCCTCATGG + Intronic
1048286621 8:133146759-133146781 CCCAGCCTCAGCTTCTCACTGGG - Intergenic
1048552389 8:135445776-135445798 CTAAGCCTCAGTTTCCTCAATGG - Intergenic
1050627561 9:7521393-7521415 CTAAGCCTTAGTTTCTTATTTGG - Intergenic
1051359804 9:16271913-16271935 CTATGCCTCAGTTTCTCATTTGG - Intronic
1051697328 9:19782823-19782845 CTAAGCCTCAGTTTCCTAATTGG - Intronic
1051712136 9:19942136-19942158 CTGAGTTTCAGTTTCTCAGAGGG - Intergenic
1053078280 9:35153427-35153449 CAGAGTCTCAGTGTCTCACAGGG - Intergenic
1053283924 9:36838569-36838591 CTGGGCCTCAGTTTCCCACAAGG + Exonic
1054724058 9:68632738-68632760 CTAAGCCTCAATTTATTCCAAGG - Intergenic
1055060762 9:72066350-72066372 CTAAGCCTGAATTCCTCAAATGG - Intronic
1055212804 9:73817746-73817768 CTATACCTCAGTTTCTGAGAAGG + Intergenic
1057721764 9:97537127-97537149 CTATGCCTCAGTTTCCCCAATGG + Intronic
1057880441 9:98788860-98788882 CTGGGCCTCAGTTTCCCACCTGG + Intronic
1059161681 9:112040699-112040721 CCAAATCTCAGTTTCTAACAGGG + Intergenic
1060201590 9:121654655-121654677 CTCAGCCTGAGTTTCTCCCTGGG - Intronic
1060943601 9:127557348-127557370 CCAAGCCTCAGTTTCCCCCATGG - Intronic
1061195015 9:129102790-129102812 CTGGGCTTCAGTTTGTCACAGGG + Intronic
1061283690 9:129610766-129610788 CTGAGCCTCAGTTTACCCCAAGG - Intronic
1062552409 9:137095652-137095674 CTAAGCCTCAGTCCGTGACACGG + Intronic
1203698934 Un_GL000214v1:119787-119809 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1203699892 Un_GL000214v1:126085-126107 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1203700793 Un_GL000214v1:132077-132099 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1203479626 Un_GL000224v1:675-697 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1203481559 Un_GL000224v1:13299-13321 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1203549114 Un_KI270743v1:153472-153494 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1203549336 Un_KI270743v1:155077-155099 TTAAGCCTGAGTTTCTGAGAGGG - Intergenic
1203569232 Un_KI270744v1:116033-116055 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1203570181 Un_KI270744v1:122322-122344 TTAAGCCTGAGTTTCTGAGAGGG + Intergenic
1186873866 X:13798208-13798230 CCAATCCTTAGTTTCTCAAAGGG - Intronic
1186972037 X:14857405-14857427 CAAAGCCTCAGTATTTTACAGGG + Intronic
1188295956 X:28448618-28448640 CTGAGCCTCAATTTCTCATCCGG - Intergenic
1189960578 X:46321071-46321093 CTGAGCCTCAGTTACCCACTTGG + Intergenic
1191044066 X:56117165-56117187 CAAAGTCTCTGGTTCTCACAAGG - Intergenic
1192547037 X:72022771-72022793 TTAAGCCTCAGACTCTAACAGGG - Intergenic
1193559511 X:83000567-83000589 AGAAGACTCAATTTCTCACATGG - Intergenic
1194001655 X:88437140-88437162 ACAAGCCTCAGTTTTTCACAGGG + Intergenic
1195167908 X:102238676-102238698 CTTGGCCTCAGGATCTCACAGGG + Intergenic
1195190949 X:102448411-102448433 CTTGGCCTCAGGATCTCACAGGG - Intronic
1196111698 X:111953533-111953555 CTGAGCCTCATTTTCTCCCTTGG - Intronic
1197147744 X:123187838-123187860 CTAAACCTGAGATTTTCACATGG - Intronic
1198564627 X:137891552-137891574 CTGAGCCTCAGCTTCTGATATGG - Intergenic
1198868401 X:141150202-141150224 CTTTGCCTGAGTTTCTCAAAGGG - Intergenic
1201330564 Y:12815562-12815584 CTAAGCCTGTGTTTAACACATGG + Intronic
1201492481 Y:14557387-14557409 ATAAGCTTCAGGATCTCACAGGG - Intronic
1202073649 Y:21017160-21017182 CTATGCCACATTTTCCCACATGG + Intergenic
1202078349 Y:21059014-21059036 CTATGCCACATTTTCCCACATGG + Intergenic