ID: 955566742

View in Genome Browser
Species Human (GRCh38)
Location 3:60255545-60255567
Sequence GAATGAAGGCCCTGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955566733_955566742 25 Left 955566733 3:60255497-60255519 CCACCCGGGGCGACAAACCCAAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 187
955566734_955566742 22 Left 955566734 3:60255500-60255522 CCCGGGGCGACAAACCCAACTTC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 187
955566740_955566742 -4 Left 955566740 3:60255526-60255548 CCAACTGCTTTCAGGAATGGAAT 0: 1
1: 0
2: 1
3: 30
4: 205
Right 955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 187
955566735_955566742 21 Left 955566735 3:60255501-60255523 CCGGGGCGACAAACCCAACTTCT 0: 1
1: 0
2: 0
3: 19
4: 321
Right 955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 187
955566737_955566742 7 Left 955566737 3:60255515-60255537 CCAACTTCTCACCAACTGCTTTC 0: 1
1: 0
2: 1
3: 24
4: 362
Right 955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 187
955566736_955566742 8 Left 955566736 3:60255514-60255536 CCCAACTTCTCACCAACTGCTTT 0: 1
1: 0
2: 0
3: 31
4: 268
Right 955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955566742 Original CRISPR GAATGAAGGCCCTGAGTAGC TGG Intronic
900126922 1:1072817-1072839 GAATGCAGGCCGTGTGTAGGGGG + Intronic
903680759 1:25095208-25095230 GAAGGAAGGCCCAGAGTCACCGG + Intergenic
904767122 1:32858737-32858759 GAATGCAGGCCCTGATTTACTGG + Exonic
904999992 1:34660574-34660596 GAATGAAGGCCCAAAGATGCAGG - Intergenic
905272137 1:36794061-36794083 GAAGAAAGGCCCTGGGTTGCAGG - Intergenic
906301002 1:44681589-44681611 GAATGAGGGCCCTGAGAAGGCGG + Intronic
915309436 1:154999954-154999976 GAATGAAAGCCCCGAGTGGGAGG - Intergenic
915580953 1:156813215-156813237 GAATGGGACCCCTGAGTAGCTGG - Intronic
916240997 1:162639617-162639639 GAAAGAAATCCCTGATTAGCTGG + Intronic
916351873 1:163859594-163859616 GAATGAAGGCACTAAGAACCTGG - Intergenic
916609506 1:166377193-166377215 GAATCAGGCTCCTGAGTAGCTGG + Intergenic
918543825 1:185660109-185660131 AAATGCAGGCCCTGCTTAGCTGG + Intergenic
920965019 1:210694331-210694353 GAGTGAGGGCCGGGAGTAGCTGG - Intronic
924628300 1:245713978-245714000 GAATGAAGAAACTGTGTAGCGGG - Intergenic
924803232 1:247343135-247343157 GAATGAAGGCCCAGAGACACAGG + Intergenic
1062909210 10:1201636-1201658 GAATGAAGGTCCTCAGTGACAGG - Intronic
1062909232 10:1201774-1201796 GAATGAAGGTCCTCAGTGACAGG - Intronic
1071467946 10:85958016-85958038 CCATCATGGCCCTGAGTAGCTGG - Intronic
1073185117 10:101611233-101611255 AAGAGAAGTCCCTGAGTAGCTGG + Exonic
1073467155 10:103700869-103700891 CAATGAAGTCCCTGAGGAGAAGG + Intronic
1077433810 11:2528641-2528663 GAATGTGGGCCGTGAGCAGCAGG + Intronic
1077631774 11:3816152-3816174 GAGGGCAGGCCCTGAGGAGCAGG + Intronic
1078396571 11:10987043-10987065 GAAGGAAGGCCCTGGGTTCCAGG - Intergenic
1078908273 11:15707610-15707632 GAAAGAAGGCCCTAACAAGCAGG + Intergenic
1079899256 11:26160979-26161001 GAATGCAGGCCCTGATAACCTGG + Intergenic
1080926717 11:36764824-36764846 GAATGAAGCCCATGTGTAGGAGG + Intergenic
1083296763 11:61719181-61719203 GAGTGAGGGCCCTGAGTTCCTGG + Intronic
1085402187 11:76241753-76241775 GAAGGAAGGCCTGGAGTGGCAGG - Intergenic
1086209918 11:84307579-84307601 GCCTCAGGGCCCTGAGTAGCTGG - Intronic
1087922050 11:103877578-103877600 GAATTAAGGCCCAGAGTAAGAGG - Intergenic
1088650126 11:111950274-111950296 GAATGAAGAAGCTGAGTATCTGG + Intronic
1088823085 11:113473412-113473434 TAATGAATTCCCTGAGAAGCTGG - Intronic
1089195279 11:116690778-116690800 GAATGAGGGCCCAGAGAAGCGGG + Intergenic
1089500813 11:118930168-118930190 GGACTAAGGACCTGAGTAGCTGG + Intronic
1089512377 11:119007941-119007963 GAAACAAGGACCTGAGAAGCTGG - Intronic
1092829843 12:12433218-12433240 GAACAAGGCCCCTGAGTAGCTGG - Intronic
1094612881 12:32010588-32010610 GAAGGAAGGCCCTAAGGAGAAGG + Intergenic
1096139109 12:49227451-49227473 GCATGAGCCCCCTGAGTAGCTGG - Intronic
1096575350 12:52549263-52549285 GAAGGCAGGCCCTGAGTCCCGGG - Intronic
1096947557 12:55423942-55423964 GCATCAAGCTCCTGAGTAGCTGG - Intergenic
1098311265 12:69151454-69151476 GAATGTAGGCACTGGTTAGCTGG + Intergenic
1098561920 12:71883700-71883722 TAATAAAGGTCTTGAGTAGCAGG + Intronic
1099648606 12:85394767-85394789 GAATGAAAGCCATGAGTACATGG - Intergenic
1101226127 12:102689841-102689863 GCATGAGTGCCCAGAGTAGCAGG - Intergenic
1102001676 12:109561425-109561447 GGATGAAGGCCGTGAGTGGTGGG + Exonic
1103097739 12:118145578-118145600 GAATGAAGGAACTGAGTCCCCGG + Exonic
1103098710 12:118153602-118153624 GAATGATGACCCTGGGTTGCAGG + Intronic
1103508188 12:121455268-121455290 GACTGAGGGTCCTGAGCAGCTGG - Intronic
1105272782 13:18893779-18893801 GCATGAGGGCCGTGAGGAGCAGG + Intergenic
1105363293 13:19740987-19741009 GCCTCAACGCCCTGAGTAGCTGG + Intronic
1106217733 13:27718291-27718313 GAATGCAGGTCCTGAGAAGTCGG - Intergenic
1106525458 13:30536893-30536915 GAATCCAGGCCCTGTGGAGCAGG - Intronic
1113821054 13:113213271-113213293 GTGTGGGGGCCCTGAGTAGCTGG - Intronic
1116053560 14:39835446-39835468 GTTTGAAGGCACTGAGTTGCAGG - Intergenic
1117750466 14:58917352-58917374 AAATGAAGGCCATGAGTTGTAGG - Intergenic
1122126588 14:99581706-99581728 CAAGGAAGGCCATGAGCAGCAGG - Intronic
1123663970 15:22592052-22592074 GAAGGAAGGCACTGAGCAGAGGG + Intergenic
1124317800 15:28686493-28686515 GAAGGAAGGCACTGAGCAGAGGG + Intergenic
1124565636 15:30810995-30811017 GAAGGAAGGCACTGAGCAGAGGG - Intergenic
1125750917 15:42027725-42027747 GCATGAAGGACCAGTGTAGCTGG - Intronic
1125926019 15:43563878-43563900 GAATTAAGACCCTGAGTTGCAGG + Intronic
1125939163 15:43663429-43663451 GAATTAAGACCCTGAGTTGCAGG + Intronic
1126228950 15:46303214-46303236 GAATGACAGCCCTGAGAAGTAGG - Intergenic
1133284850 16:4685943-4685965 GAGTGAAGGCCCTGGGTGGGGGG - Intronic
1135093210 16:19538790-19538812 GAAATAAGGCTCTGAGTAGGTGG + Intronic
1135881775 16:26264522-26264544 AAATGTAGTCCCCGAGTAGCTGG + Intergenic
1136238612 16:28930773-28930795 GAATGAAGGGGGCGAGTAGCAGG - Intronic
1140852031 16:78943916-78943938 CAATGGAGGCCTTGGGTAGCAGG - Intronic
1141268367 16:82517297-82517319 GAATGAAGGCACTGATTAAGTGG + Intergenic
1141590805 16:85067347-85067369 GCATGAAGTCCCTGAGTGCCAGG - Exonic
1143043321 17:4056040-4056062 GAATGCAGGCTGTGAGCAGCAGG - Intronic
1143822143 17:9573307-9573329 AAATGAAGCCTCTGGGTAGCAGG - Intronic
1144299725 17:13912150-13912172 AAATGAAGGGCCTAAGAAGCAGG + Intergenic
1148201774 17:45754061-45754083 GAATGAGGGCCCTGCAGAGCTGG - Intergenic
1149380654 17:56090215-56090237 GAATGTGAGCACTGAGTAGCAGG + Intergenic
1150326954 17:64264971-64264993 GAATGAGGCACCAGAGTAGCAGG - Intergenic
1152458286 17:80428339-80428361 CCCTGAAGGGCCTGAGTAGCTGG - Intronic
1153656405 18:7286654-7286676 GTCTGAAGGCCCTGAGAATCAGG + Intergenic
1154464566 18:14631358-14631380 GCATGAGGGCCGTGAGGAGCAGG + Intergenic
1156375714 18:36513686-36513708 GGATGAAGGCTCTGATTGGCTGG - Intronic
1157981317 18:52384594-52384616 GGGTGAAGACCCTGTGTAGCAGG + Intronic
1158591353 18:58781466-58781488 GTTTGAAGGCCCTGAGCACCAGG + Intergenic
1159909064 18:74126669-74126691 GACTGAAATCCCTGAGGAGCTGG + Intronic
1159962808 18:74568566-74568588 GAACGAAGGCACTGAGGAGGTGG + Intronic
1160528108 18:79548948-79548970 GCACGAAGGCACTGAGGAGCCGG + Intergenic
1161044277 19:2126792-2126814 GATGGCAGGCCCTGAGCAGCAGG + Intronic
1164815886 19:31203225-31203247 GTATGAATGCCCTGAGAAGGAGG + Intergenic
1166029067 19:40112283-40112305 CAATCAGGCCCCTGAGTAGCTGG + Intergenic
1166090652 19:40506548-40506570 GAATCAGTGCCCTGAGTGGCAGG + Intronic
925658245 2:6173505-6173527 ATAGGAAGGCCCTGAGTAGAAGG - Intergenic
926281341 2:11449506-11449528 GAAAGAACGCACTGAGCAGCTGG + Intronic
928379840 2:30808275-30808297 GAATGAAGAATCTGAGAAGCTGG + Intronic
931321297 2:61177151-61177173 GAAGCAGGGCGCTGAGTAGCGGG - Intergenic
932335201 2:70927188-70927210 GAATGAATGACCAGAGTACCAGG + Intronic
933005569 2:76989200-76989222 GAATAAAGTGACTGAGTAGCAGG + Intronic
936903213 2:117507457-117507479 GAAGGAAGGCCCTCAAGAGCAGG + Intergenic
944267496 2:197744923-197744945 GAATGAGGTCCCTGAGGAGGAGG + Intronic
944482415 2:200171506-200171528 GAAGGAAGGCCTTGTGTACCTGG - Intergenic
946052314 2:216873742-216873764 GGAAGAAGGCCCTGAGTAGAAGG - Intergenic
946210852 2:218145916-218145938 GACTGGAGGCCCAGAGTAGGTGG + Intergenic
947459800 2:230293785-230293807 GAATGAAAGGCCTTAGTAGAGGG - Intronic
947651805 2:231792847-231792869 CAGCGAAGGCCCTGAGTATCAGG - Intronic
1170437634 20:16346716-16346738 GTGTGAAGGCCCTGAGAATCTGG + Intronic
1174553965 20:51380940-51380962 GGACGAAGGCCCTGAGATGCAGG + Intergenic
1174578268 20:51553102-51553124 GAATGTAGGCCTGGAGTGGCGGG - Intronic
1175149047 20:56918679-56918701 AAATGAAGACCCAGAGAAGCAGG + Intergenic
1176809974 21:13527026-13527048 GCATGAGGGCCGTGAGGAGCAGG - Intergenic
1181395447 22:22618133-22618155 GAATCAGGGACCTGAGCAGCAGG + Intergenic
1181415099 22:22753643-22753665 GCATCAAGGACCTGAGCAGCAGG + Intronic
1183167899 22:36161298-36161320 AAATGAACCTCCTGAGTAGCTGG + Intronic
1183718222 22:39546799-39546821 GAATGAAGGCCTGGGGTAGTGGG - Intergenic
1184913043 22:47548997-47549019 GATTGAAGGCCCTGAGCTCCTGG + Intergenic
1185205250 22:49534133-49534155 GAGCGAAGGCCCTGAGCCGCAGG + Intronic
950858826 3:16129540-16129562 GAATCAAGGCCCTGAATACTGGG - Intergenic
953746134 3:45575418-45575440 GCAAGCAGGGCCTGAGTAGCTGG - Intronic
954377173 3:50201363-50201385 GATAGGAGGCCCTGAGGAGCTGG + Intergenic
954415538 3:50391514-50391536 AAACGATGGCCCTGATTAGCAGG - Intronic
955495293 3:59525026-59525048 GAATGTATTCCCTGAGGAGCGGG + Intergenic
955566742 3:60255545-60255567 GAATGAAGGCCCTGAGTAGCTGG + Intronic
956000803 3:64728136-64728158 GAATGGAGGCTCTGAGAGGCTGG + Intergenic
959591169 3:108083674-108083696 GATTGAAGGCCCGGAGGAGCAGG - Intronic
960444045 3:117725600-117725622 GCATGAAGGTCCTGGGTATCTGG - Intergenic
962790120 3:138803751-138803773 GAATGGAGGCCCAGAGAAGGAGG - Intronic
963008886 3:140751119-140751141 GAAGGGAGGCCCAGAGGAGCTGG + Intergenic
963480237 3:145863617-145863639 CAAAGAAGGCCCTGAATAACTGG - Intergenic
964707825 3:159639153-159639175 GAATGAAGGCCAAGTTTAGCAGG + Intronic
965001375 3:162958383-162958405 GCCTCAAGGTCCTGAGTAGCTGG - Intergenic
965961381 3:174432097-174432119 GAATGGAGGACATGAGTATCAGG + Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
967674231 3:192277023-192277045 GAATGAAGGCCCAAAGAAGCAGG - Intronic
967905032 3:194492186-194492208 GAAAGAAGGCCTAGTGTAGCTGG - Intronic
968673501 4:1864619-1864641 GGCTGTAGGCCCTGAGTAGGCGG + Intergenic
969530839 4:7729380-7729402 GGCTGAGGGCCCTGGGTAGCTGG + Intronic
970881269 4:20935003-20935025 GAATGAAGGCCATGTGAAGATGG - Intronic
972520701 4:39853051-39853073 GACTGCAGGGACTGAGTAGCTGG + Intronic
977330113 4:95627282-95627304 GAGTGAAGTGGCTGAGTAGCTGG + Intergenic
977712939 4:100148428-100148450 GAATTGAAGCCCTCAGTAGCAGG - Intergenic
986467239 5:8037891-8037913 GAATGAAGGCAAGGAATAGCTGG - Intergenic
989805778 5:45602037-45602059 GAATGAATGCCCAGTGAAGCGGG - Intronic
992570703 5:78054111-78054133 GCATGAAGGGCCTGAGGAGCAGG + Intronic
995299332 5:110558962-110558984 GAATGCAGACCTTGAGCAGCTGG - Intronic
996321621 5:122222979-122223001 GAAGGAATGCCCTGGGGAGCAGG - Intergenic
998748754 5:145293065-145293087 GAATAAAGGCTCTGTGTTGCTGG - Intergenic
999437400 5:151573799-151573821 GAATCAAGATCCTGAGAAGCTGG - Intergenic
999936642 5:156493905-156493927 GGATGAAGGCCGTGAGAGGCAGG - Intronic
1001933861 5:175691125-175691147 AAGTGCAGGCCCTGAGAAGCTGG - Intergenic
1002069218 5:176669130-176669152 GAAAGGTGGCCCTGAGTAGACGG - Intergenic
1002283971 5:178150024-178150046 GAATGTAGGCCCTGTGTGGCTGG - Exonic
1002430866 5:179203153-179203175 GAATGCAGGCTCTGAGGAGGAGG - Intronic
1002519497 5:179783384-179783406 GAACGAACGCCCAGAGAAGCGGG + Intronic
1002575844 5:180173225-180173247 GAATGCAGGCCCTGTGTAGCTGG - Intronic
1003922533 6:10846602-10846624 CCATGAAGGCCCAGAGTGGCTGG + Intronic
1005089568 6:22042725-22042747 GAATGATGGCTGTGAGTACCTGG + Intergenic
1006456956 6:34137307-34137329 GAATGAGAGCCCTGAGGGGCAGG + Intronic
1008584081 6:52933136-52933158 AAATTGAGGCCCTGAGAAGCTGG - Intergenic
1008875812 6:56325104-56325126 GAATAAAGACCCTGAGAAACAGG - Intronic
1009482955 6:64183115-64183137 GAATGAATGCCCAGAGAAGAGGG - Intronic
1009956628 6:70462975-70462997 AAAGGAAGGCCCTGAAAAGCTGG - Intronic
1014398078 6:120951590-120951612 GAATGAAAGCACTGAGAAGGAGG - Intergenic
1017280555 6:152619706-152619728 GAAAGAAGGCACTGAGAGGCGGG + Intronic
1017757188 6:157539519-157539541 GAAGGAAGTCCCTGAGTGGGAGG + Intronic
1018595743 6:165478765-165478787 AAATGAAGCCCCCAAGTAGCAGG - Intronic
1019273099 7:161525-161547 GACGGAAGCCCCTGAGGAGCTGG - Intergenic
1025065885 7:55855668-55855690 GACTCAACGTCCTGAGTAGCTGG + Intronic
1026501330 7:70945633-70945655 AGATGAAGACTCTGAGTAGCAGG - Intergenic
1028810766 7:95083174-95083196 GAATGAAGACCCAGAGAAACAGG + Intronic
1028825340 7:95266154-95266176 GAATGCTGGCCCTGAGGATCTGG - Intronic
1031209560 7:118805247-118805269 GAAGGAAGCCCCAGAATAGCAGG - Intergenic
1034474736 7:151275838-151275860 AAATGAAGTCCCTGAGCAGACGG + Intronic
1034491788 7:151396705-151396727 AGATGAGGGCCCTGAGAAGCTGG + Intronic
1037519157 8:19662876-19662898 GGTTGAAGGCTCAGAGTAGCTGG - Intronic
1039406555 8:37318320-37318342 AAATGAACCCCCTGAGGAGCAGG + Intergenic
1039491033 8:37947552-37947574 GAATGCAGGCTCTGAGCAGCAGG - Intergenic
1041999987 8:64111204-64111226 AAAAGAAGGCCCTGAGCATCCGG + Intergenic
1044274094 8:90280125-90280147 GGATAAAGCCTCTGAGTAGCAGG + Intergenic
1044884492 8:96762235-96762257 GAATGAAGGCACTGTGTATGAGG + Intronic
1047546667 8:125824690-125824712 GAGTGAAGGCCCTGGGTTCCAGG + Intergenic
1048656586 8:136544498-136544520 GAATGAAGACCCTGATTAAGTGG - Intergenic
1049655664 8:143795872-143795894 GAAGGAGGGGCGTGAGTAGCAGG + Intronic
1050109048 9:2195899-2195921 GAAGGAAGAGCCAGAGTAGCAGG - Intergenic
1053469084 9:38332808-38332830 TAATGAAGGCCTTGAATACCAGG + Intergenic
1053533207 9:38901740-38901762 TAATGAAGGCCCTGAACAGAGGG - Intergenic
1054205433 9:62126169-62126191 TAATGAAGGCCCTGAACAGAGGG - Intergenic
1054632928 9:67462201-67462223 TAATGAAGGCCCTGAACAGAGGG + Intergenic
1054711037 9:68511005-68511027 GGATGAAGCCTCTAAGTAGCAGG + Intronic
1056585579 9:87925283-87925305 AAAGGAAGGGCCAGAGTAGCCGG - Intergenic
1057151011 9:92796144-92796166 TAATGAAGGCCCTGAACAGAGGG + Intergenic
1057318685 9:93991579-93991601 GAATCCAGGACCTGAGCAGCTGG - Intergenic
1057318703 9:93991787-93991809 GAATGAAGGCCCAAAGATGCAGG + Intergenic
1057976545 9:99611177-99611199 GAATGAGGGCCCCGGGAAGCAGG + Intergenic
1059554595 9:115266751-115266773 GAAAGAAGGACCTCAGTTGCCGG - Intronic
1060146976 9:121261374-121261396 GAATGAAGGCACTGGGCAGGAGG - Intronic
1061606550 9:131715378-131715400 GTATGAAAGACCTGTGTAGCTGG + Intronic
1188612854 X:32120678-32120700 TAATCAAGGCCCTAAGCAGCTGG + Intronic
1189143700 X:38634657-38634679 GAATAAAGTCCCTAAGTAGATGG - Intronic
1189695786 X:43660387-43660409 CATTGAAGGCCCTGAGCAGAGGG - Intronic
1190263139 X:48811455-48811477 GAATGAAGGCCCATTGTAGGGGG + Intronic
1196365053 X:114914638-114914660 GAAGCAAGGGCCTGAGAAGCAGG + Intergenic
1197952826 X:131916585-131916607 GAATGAACGCCTTGGGTACCTGG - Intergenic
1199691371 X:150311375-150311397 GAGTGAAGGTCCAGAGTAGCTGG + Intergenic