ID: 955567808

View in Genome Browser
Species Human (GRCh38)
Location 3:60268237-60268259
Sequence CTCCTATAGCATTTAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955567808 Original CRISPR CTCCTATAGCATTTAGGCTG AGG Intronic
900479367 1:2890590-2890612 CTCCTGGAGCCTTGAGGCTGAGG + Intergenic
903055344 1:20632607-20632629 TTCCTATAGCATATAGGCCCTGG + Intergenic
903920774 1:26799025-26799047 CTACATTAGCATTTAGACTGGGG - Intergenic
904727660 1:32562063-32562085 CTCCTATAGTTTGGAGGCTGAGG - Intronic
907127656 1:52065669-52065691 CTGCTAAAGCCTTTTGGCTGAGG - Intronic
911003394 1:93191498-93191520 CTTCTATACCATTTAGATTGTGG + Intronic
911161163 1:94684290-94684312 CTTCTTTAGCATCTAGGCTGCGG - Intergenic
913133967 1:115869316-115869338 ATCCTATAGCACTTAGACTATGG - Intergenic
914247469 1:145896789-145896811 CTCATATTGGATGTAGGCTGAGG + Exonic
915481013 1:156185088-156185110 CTTCTTTAGCATTCAGTCTGGGG + Intergenic
918114795 1:181486293-181486315 GTTCTACAGCATGTAGGCTGTGG + Intronic
922232072 1:223696245-223696267 CTTCTAGAGCATTTAGGATGGGG - Intergenic
922683738 1:227622789-227622811 CTCCTAGAGAATTCAGGATGGGG - Intronic
924699153 1:246433165-246433187 CCCCTATAACATTCAAGCTGAGG + Intronic
1063867317 10:10379885-10379907 CTCCTTTAGATTTTAGACTGGGG - Intergenic
1073433244 10:103500476-103500498 CCCCTGTAGCATTTAGCCTTGGG + Intronic
1073794479 10:106972985-106973007 CTCTTCTACCATTGAGGCTGAGG + Intronic
1079187075 11:18247370-18247392 CTCCTATGCGATTTATGCTGAGG + Intronic
1079189729 11:18267507-18267529 CTCCTATGCGATTTATGCTGAGG - Intronic
1088512577 11:110593556-110593578 ATCTTACAGCTTTTAGGCTGAGG + Intronic
1089434960 11:118457164-118457186 CTGCTATAGCCTTCAGGATGAGG + Intronic
1093135315 12:15442691-15442713 CACCAATAGCATTCAAGCTGAGG + Intronic
1093498175 12:19780569-19780591 CTGCTATAGCCTTCAGGCTCTGG - Intergenic
1094306316 12:29023761-29023783 TTCCTATAACATTAAGGTTGAGG - Intergenic
1097630312 12:62052729-62052751 CTACTTTTGCATTTATGCTGCGG - Intronic
1099771732 12:87068265-87068287 ATCCTATATGATTTAGGCTTTGG - Intergenic
1102418799 12:112787682-112787704 CTCCTAAAGCAACTAGCCTGAGG - Intronic
1112478945 13:99756258-99756280 ATCCTATTACATTTAGGCAGGGG - Intronic
1116807413 14:49507536-49507558 CTCCTATGGCCTTCAGGCAGTGG + Intergenic
1117282492 14:54254567-54254589 CTCATTTAGCATGTGGGCTGAGG - Intergenic
1118532727 14:66725050-66725072 GTCCTATTGCATTAAGACTGTGG - Intronic
1120936966 14:89906398-89906420 TTCCTATAGCATTTGGGTTTGGG + Intronic
1124552281 15:30692924-30692946 CACCTGGAGCCTTTAGGCTGAGG + Intronic
1124678958 15:31712742-31712764 CACCTGGAGCCTTTAGGCTGAGG - Intronic
1127812840 15:62579549-62579571 TTCCTGTTGCATTTATGCTGTGG + Intronic
1129541400 15:76350679-76350701 TTCCTATAGCATTCCTGCTGGGG - Intronic
1135468388 16:22707118-22707140 CTTCTATAGCCATTAGCCTGGGG + Intergenic
1139832942 16:69815032-69815054 CTCCTCTGTCATTCAGGCTGGGG + Intronic
1146263813 17:31438170-31438192 CCCCTATAGCATATGGACTGGGG - Intronic
1147314598 17:39613621-39613643 CTCCTAAAGCAGAAAGGCTGAGG + Intergenic
1150365860 17:64583727-64583749 CTTCTAAAGTATTTATGCTGAGG + Intronic
1152923409 17:83077060-83077082 CTCCTAGAGGATGCAGGCTGAGG - Intergenic
1153899876 18:9608618-9608640 CACCTATGGAATTTTGGCTGAGG - Intronic
1155080912 18:22408812-22408834 CTCCTACAGCATTCAGTATGAGG + Intergenic
1157583745 18:48788133-48788155 CCTCTCTAGCCTTTAGGCTGGGG + Intronic
1163631177 19:18418611-18418633 CTCCTATAGTACCCAGGCTGTGG - Intergenic
1165330355 19:35138530-35138552 CTCCAAGAGCTTTTGGGCTGAGG - Intronic
931124560 2:59260226-59260248 CTCCTTTAACATTTTGACTGAGG + Intergenic
935001026 2:99015458-99015480 CTCCTATACCAATTTTGCTGAGG - Intronic
937298382 2:120823556-120823578 CTCTTATAGCATTTTTGCTGTGG + Intronic
941090037 2:161164357-161164379 TTCCTGTAGGATTTATGCTGTGG + Intronic
942547133 2:177076785-177076807 CTCCTTTAGCCTCTAGGCTGTGG + Intergenic
945804687 2:214476207-214476229 CTCCTTTTGCATATTGGCTGTGG - Intronic
946085600 2:217168273-217168295 CTCCTATTACATTGAGACTGAGG + Intergenic
946726710 2:222668699-222668721 CTAGTATAGCAGTTAGGCTCTGG + Intergenic
1170131364 20:13023436-13023458 CTCCTATTACATATAGGCTCTGG - Intronic
1173873654 20:46356822-46356844 CTGCTCTAGCATTAGGGCTGGGG + Intronic
1179635430 21:42705648-42705670 CTCCTATAGGACTTGGGCCGTGG - Intronic
1183693765 22:39407119-39407141 CTTCTATAGTAGTTTGGCTGGGG + Intronic
1184882880 22:47322575-47322597 CTCCTATAGCTGGCAGGCTGTGG + Intergenic
950010628 3:9721025-9721047 CACCTATAGTATTTATGATGTGG - Intronic
951154655 3:19335308-19335330 CTCATGTAGCATTTATGCTAAGG - Intronic
952573969 3:34751981-34752003 CTCCAATAACTTCTAGGCTGAGG + Intergenic
954857101 3:53653589-53653611 CTTCTATAGTGTTTAAGCTGAGG - Intronic
955216860 3:56991175-56991197 CTCCTCCAGCATGAAGGCTGAGG + Intronic
955354707 3:58221854-58221876 CTCCTATAGCATTTCTTCTCTGG + Intergenic
955567808 3:60268237-60268259 CTCCTATAGCATTTAGGCTGAGG + Intronic
958838241 3:99171693-99171715 CTGCTATAGCCTTCAGGCTCTGG + Intergenic
958838279 3:99171938-99171960 CTGCTATAGCCTTCAGGCTGTGG + Intergenic
959729601 3:109585742-109585764 TTCCTATAACATTTAGGAAGAGG + Intergenic
960990339 3:123306023-123306045 CTCCTATACCATCAAGCCTGTGG + Intronic
966556313 3:181264513-181264535 CTCATAAAGTATTTAGGCTGGGG + Intergenic
969490177 4:7495183-7495205 CTCCCCCAGCATTTAGTCTGGGG - Intronic
975950821 4:79768775-79768797 CTCCTAAAACATTCAGGCAGAGG + Intergenic
976216638 4:82721227-82721249 TCCCTGTAGCATATAGGCTGAGG + Intronic
978665120 4:111173094-111173116 CTCCAAAAGCAATTTGGCTGTGG + Intergenic
990483514 5:56235114-56235136 CTCCTGTAGCCATGAGGCTGAGG + Intergenic
991644049 5:68782853-68782875 TTCCTATAGCATAAAGTCTGAGG - Intergenic
997569135 5:134912453-134912475 CCCATATAGGATTTGGGCTGTGG + Intronic
998293703 5:140943734-140943756 CTCCTACTGCTTTTAGACTGTGG - Intronic
1006876554 6:37302382-37302404 CTCCAAGAGCTTTTAGGCTTAGG + Intronic
1010152978 6:72758030-72758052 CTCCTGCAGCACTTAGACTGAGG - Intronic
1011806257 6:91075823-91075845 CTCAGATAACATTAAGGCTGTGG - Intergenic
1012423126 6:99085958-99085980 CTCCTTTAAAATTTAGGCTATGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014141815 6:117952386-117952408 ATCCTTTAGCATTCAGGCTATGG - Intronic
1017979843 6:159391313-159391335 TTCCTATAGTATTTAACCTGTGG + Intergenic
1020537418 7:9418117-9418139 CTCCAATCCCATTTAGGATGCGG - Intergenic
1022243176 7:28532200-28532222 CTCCTATAGCTGTTTGGCAGGGG - Intronic
1027235264 7:76294296-76294318 GTCCTGCAGCATTTAGGCTGTGG + Intergenic
1027711997 7:81615843-81615865 CTCCTATGGCATTTATTCTATGG + Intergenic
1031221161 7:118967629-118967651 GTTCTAAAGCATTTAGTCTGTGG - Intergenic
1037923169 8:22822238-22822260 TTCCTATAGCATCTAGTTTGTGG - Intronic
1042963958 8:74330997-74331019 TTCCAATAGCATTCATGCTGAGG + Intronic
1045079085 8:98604625-98604647 CTCCTCTAAAATCTAGGCTGGGG + Intronic
1051914596 9:22193148-22193170 CTCCTATAGTATTTTGAATGTGG + Intergenic
1057753276 9:97809506-97809528 CTCCCATGGCATTTTGGCTGTGG - Intergenic
1058679856 9:107431307-107431329 CTCCTAAAGAATCTAGACTGTGG - Intergenic
1185962148 X:4556305-4556327 GTCCCATAGCATTTACTCTGAGG - Intergenic
1186592979 X:10950863-10950885 CTCCTTTAACATTTATGTTGAGG - Intergenic
1194191716 X:90844949-90844971 CTCCTATACCAATTTTGCTGAGG + Intergenic
1194195259 X:90883964-90883986 CTGCTATAGCGTTCAGGCTCTGG - Intergenic
1194521374 X:94922305-94922327 CTTCAATAGCATTTAGGTTAAGG + Intergenic
1197288702 X:124627892-124627914 CTTATATAGAATATAGGCTGGGG - Intronic
1200538361 Y:4427383-4427405 CTCCTATACCAATTTTGCTGAGG + Intergenic