ID: 955568754

View in Genome Browser
Species Human (GRCh38)
Location 3:60279515-60279537
Sequence CTTTAGATAGGTAAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955568754 Original CRISPR CTTTAGATAGGTAAAGCAGA GGG Intronic
901756310 1:11443666-11443688 CTTTAAAAAGGTTAAGCAGAAGG + Intergenic
902030470 1:13418335-13418357 CTTTCTATGGGTCAAGCAGAGGG + Exonic
902424294 1:16307253-16307275 CTTTAGGAAGCCAAAGCAGAAGG + Intronic
904263697 1:29305653-29305675 CTTTAGAGAAGCAAAGCAAAGGG + Intronic
905927754 1:41764070-41764092 CTATAGATGGGAAAAGCAGTCGG + Intronic
910220392 1:84884133-84884155 TTTTAGATAGGTAAAGGCAAGGG - Intronic
910278145 1:85469904-85469926 CTTTAGGTATGTCAAACAGAGGG - Intronic
911056234 1:93710725-93710747 CGTTAGCTAGATAAAGCAGGGGG - Intronic
911810584 1:102272910-102272932 CTTTAGGAAGCTAAGGCAGAAGG - Intergenic
912123035 1:106497020-106497042 CTTTTGATATGCATAGCAGATGG + Intergenic
915872449 1:159575355-159575377 GTATAAATAGGTAAAGCAGAGGG + Intergenic
915879155 1:159647399-159647421 CTTTAGATAGATAAAGAAAAGGG - Intergenic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
917486941 1:175463918-175463940 CTTTATGTATATAAAGCAGAAGG + Intronic
918134264 1:181657477-181657499 GTTAGGAGAGGTAAAGCAGAGGG + Intronic
918286429 1:183059689-183059711 TATAAGATAGGTAAAACAGAGGG + Intronic
920693222 1:208162667-208162689 CTTCATACAGGTAAAGCACACGG - Intronic
921092852 1:211859679-211859701 CTATGGGTAGGAAAAGCAGAGGG + Intergenic
922568050 1:226614660-226614682 AGTTAGATAGGGAAAGCTGAAGG - Intergenic
1065774844 10:29110058-29110080 CTTGATTTAGGAAAAGCAGAAGG - Intergenic
1068975669 10:63006549-63006571 CTTTAGCTAGGTGAAGAAGGTGG - Intergenic
1074592522 10:114826632-114826654 CTTTAGAGAGGCAGAGAAGATGG + Intronic
1075167698 10:120084150-120084172 CTTTTCATATGTATAGCAGACGG + Intergenic
1076564398 10:131388277-131388299 CTTCAGATATGTGAAGCTGAAGG - Intergenic
1077595798 11:3530294-3530316 CTTTAAATTGGCAAAGCATACGG - Intergenic
1079063463 11:17269904-17269926 GTTTATATTTGTAAAGCAGAGGG - Intronic
1079802266 11:24884723-24884745 CTTTAGATGTGTAAAGGAGTTGG - Intronic
1079819968 11:25113960-25113982 CTACAGATAGGAAAAGCAGAAGG - Intergenic
1081128417 11:39347391-39347413 CTTTAGATAGCAAAGGCAAAGGG + Intergenic
1081430251 11:42968856-42968878 CTACAGAAAGGTAAAGCAGCAGG - Intergenic
1085709834 11:78819364-78819386 TTTTAGAAAGGAAAACCAGAAGG - Intronic
1086496688 11:87411242-87411264 TTTTAGGTAGGAAAGGCAGAGGG - Intergenic
1089886574 11:121830582-121830604 CCTTGGATAGATAAAGCAGATGG + Intergenic
1093977648 12:25440329-25440351 CTTTGGACAGGTCAAGCAGGAGG - Intronic
1094191138 12:27699698-27699720 TTTTAGATAGGAAAATCAGGAGG - Intergenic
1094738593 12:33262601-33262623 ATTTAGATAGGCAGAGAAGATGG + Intergenic
1095330846 12:40961383-40961405 CTTTATATATTTAAACCAGAAGG + Intronic
1096354502 12:50928859-50928881 CTTAACATATGTAAACCAGAGGG + Intronic
1097299565 12:58003880-58003902 CTTTGGAAAGGTGAAGCAGGGGG - Intergenic
1097729640 12:63113426-63113448 ATTTAAATAGGTAAAGCATGGGG - Intergenic
1099292439 12:80788626-80788648 ATTTGGATAGGTAAAGGAAAAGG + Intergenic
1099831846 12:87853866-87853888 CTTAACATATGTAAAGCAAATGG + Intergenic
1100953001 12:99873597-99873619 CTGTAAATAGTTAAAGGAGATGG - Intronic
1102894817 12:116590318-116590340 CTTTAAAAAGTTAAAACAGAGGG - Intergenic
1104473249 12:129048551-129048573 AGTTAGAAAGCTAAAGCAGAGGG + Intergenic
1106888098 13:34212209-34212231 CTATAGATAACTAAAGCAGTAGG + Intergenic
1107966174 13:45600136-45600158 TTTTAGATAAATAAAGCTGAAGG - Intronic
1108673376 13:52714096-52714118 CTTTAATCAGGAAAAGCAGAAGG - Intronic
1109081943 13:57914734-57914756 CTTGAAATAGATAAAGAAGATGG + Intergenic
1110048075 13:70856792-70856814 CATTCAATAGGTAAATCAGATGG + Intergenic
1110445046 13:75570663-75570685 CTTTGGAAAGTTAAAGCAGAAGG + Intronic
1112438592 13:99408881-99408903 CTTTTGACAGGTAAGGCAAAGGG + Intergenic
1114207007 14:20581500-20581522 CTTTATTTTGGGAAAGCAGAGGG + Intergenic
1114943009 14:27639762-27639784 CTTAAGAAAGGTAAAGTATATGG - Intergenic
1115120265 14:29928678-29928700 CTTTAGATTGATAGAGGAGAAGG - Intronic
1115573930 14:34693005-34693027 CTTTAGATGAGAAAAGAAGAGGG + Intergenic
1116202024 14:41809026-41809048 CTTTAGTTATGTGAAGCAGGAGG + Intronic
1117088755 14:52228138-52228160 ATTTAGATAGATAAGGCAGATGG - Intergenic
1119158825 14:72436062-72436084 CTTTAGAAAGGAAAGGCAGAAGG - Intronic
1120027971 14:79607584-79607606 ATTTAGATAATTAAAGCAGAGGG + Intronic
1120053185 14:79892226-79892248 CTTTGGAGAGGTTAATCAGAAGG - Intergenic
1120255239 14:82110465-82110487 CTGTAGGTATTTAAAGCAGACGG + Intergenic
1128765054 15:70246301-70246323 CTTTAGAATGCCAAAGCAGAGGG + Intergenic
1128910055 15:71505687-71505709 CTTCAAATAGGTAAGGCAAATGG + Intronic
1129980481 15:79864784-79864806 CTTTAGAAAGGAAAAGAAAAAGG + Intronic
1130237533 15:82150544-82150566 CTTTACATAGGTAAAGAAAGGGG - Intronic
1130966811 15:88703805-88703827 CATCAGATTAGTAAAGCAGATGG - Intergenic
1131220673 15:90581347-90581369 ATTTAGTTAGATAAAGCACATGG - Intronic
1131894885 15:97016111-97016133 CTTTAGAAGGCTGAAGCAGATGG - Intergenic
1131931391 15:97446356-97446378 CTTCAGATAAGGAAAGCAGCAGG + Intergenic
1133846620 16:9460107-9460129 CTTTAATTAGGCAAAGCACAGGG + Intergenic
1134105869 16:11485682-11485704 CATAAGAAAGGAAAAGCAGATGG - Intronic
1135105511 16:19645887-19645909 CAGTAGATAAGTAAAACAGATGG - Intronic
1135693237 16:24562518-24562540 GTTTAGATAGGTAGAGAAGAGGG + Intronic
1137341160 16:47607179-47607201 CTTTAAATAGGTAAAATATATGG - Intronic
1139020056 16:62737680-62737702 CTGTAGAAAATTAAAGCAGATGG - Intergenic
1139079655 16:63500592-63500614 ATTCAGATAGCTATAGCAGATGG + Intergenic
1140657461 16:77155432-77155454 CTATAGAGAGGGAAAGTAGAGGG - Intergenic
1141539243 16:84706124-84706146 CTTTAGGAAGCTGAAGCAGAAGG - Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143211734 17:5193105-5193127 ATTAAGAGAGGTAAAGCAAAAGG - Intergenic
1143978935 17:10851222-10851244 CTTTAGATAACTAAAACAAAGGG - Intergenic
1146503700 17:33386312-33386334 CTTTAGATAGATGAAGTAGAAGG - Intronic
1149587797 17:57804452-57804474 CTTTGGGAAGGTAAGGCAGAAGG - Intergenic
1157635986 18:49155403-49155425 CTTTAGATTGGTGAAGTATATGG - Intronic
1157821865 18:50777242-50777264 AGTTAGATAGGAAAAGCTGAAGG + Intergenic
1158385990 18:56992113-56992135 CTTAAGATAGGTAAGGAAAAAGG - Intronic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1168323871 19:55528089-55528111 CTTTGGTTTGGTAAAGGAGAGGG + Intergenic
1168379743 19:55909931-55909953 TTTTAGGTAGGAAAGGCAGAAGG - Intronic
928268695 2:29834910-29834932 CTTTTGAAAGGTAAAGCAAATGG - Intronic
928842788 2:35630747-35630769 ATTTAGATAGGTGACACAGATGG - Intergenic
929372262 2:41240616-41240638 CTTTGGGAAGGCAAAGCAGATGG - Intergenic
929402017 2:41594913-41594935 TTTTAGATAGGTAAAGTTTATGG - Intergenic
929768327 2:44869613-44869635 ATTTAGATAGGCAGAGCAGAGGG - Intergenic
929912909 2:46107130-46107152 AGTTGGATAGGTAAAGCACAGGG - Intronic
931151309 2:59576641-59576663 CTTCAAATAGGTAAAGCATATGG - Intergenic
931266289 2:60663230-60663252 CTTTAAATAGGTGAAGTATATGG - Intergenic
935737977 2:106121387-106121409 TTTTATATAGGTAAAGCTGGTGG - Intronic
936889229 2:117349788-117349810 ATTTAGATATGTAAACAAGAAGG - Intergenic
936956260 2:118025330-118025352 CTTTAGCCAGATAAAACAGATGG - Intergenic
937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG + Intergenic
938163531 2:129007338-129007360 CTTTTGATAGCTAAAGCTGGTGG + Intergenic
938894889 2:135740192-135740214 CTCTAGGTAGGTGAAGGAGAAGG - Intergenic
939158404 2:138554526-138554548 CTGTAGACAGGTAAGGCAGTTGG + Intronic
940266350 2:151843047-151843069 GTTTAGTTAGGGAAAGCAGGGGG + Intronic
940663414 2:156575716-156575738 TTTTAGATAGAGCAAGCAGATGG + Intronic
941029609 2:160495220-160495242 TTTTACATAGGTAAATGAGAGGG - Intergenic
941599749 2:167527739-167527761 TTTTAGAGAGGAAAAGCACAAGG - Intergenic
942052203 2:172150359-172150381 CTTTAGATAGCTAAATAATAGGG - Intergenic
942137268 2:172938818-172938840 GATTAAATAGGTAAAGCACAGGG - Intronic
945263319 2:207865306-207865328 CTTTAAATAGGTGAATCACATGG - Intronic
945269225 2:207922261-207922283 TTTTAGATAGGTAGGGCAGATGG - Intronic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946629002 2:221646033-221646055 ATTTAGATAGTGAAAACAGAAGG - Intergenic
947018579 2:225648681-225648703 CTATACATAGGAAAAGTAGAAGG + Intronic
947826743 2:233111035-233111057 CATTAATTGGGTAAAGCAGAGGG - Intronic
948334737 2:237199133-237199155 TTTTGGAGAGGGAAAGCAGATGG + Intergenic
948738134 2:240024466-240024488 GGTTTAATAGGTAAAGCAGAGGG + Intronic
1168796798 20:615651-615673 CATTAGATAACTAAAACAGATGG + Intergenic
1168937187 20:1675380-1675402 CTTTAGAAAGGTTCTGCAGATGG - Intergenic
1169725607 20:8726185-8726207 TTTTAGATAAGTATAGCACAGGG - Intronic
1172526840 20:35604939-35604961 CTTTGGGAAGCTAAAGCAGAAGG - Intergenic
1173421322 20:42903881-42903903 CATTAGAGAGGAAGAGCAGAAGG - Intronic
1174026041 20:47576397-47576419 ATTTAGGCAGGTAAAGGAGATGG - Intronic
1174799187 20:53548852-53548874 CTTTAGAAAGCCAAGGCAGAAGG + Intergenic
1175005308 20:55675551-55675573 CTTTTGATAAGTCATGCAGACGG + Intergenic
1177257306 21:18682282-18682304 ATTTTTATAGGTAAAGCAAAGGG + Intergenic
1178018443 21:28379293-28379315 GAATAGATAAGTAAAGCAGAAGG + Intergenic
949232456 3:1767280-1767302 CTTTACATACGTAAGGGAGAGGG - Intergenic
949915390 3:8959220-8959242 CTTTAGACAGCTAAAGATGATGG + Intronic
955568754 3:60279515-60279537 CTTTAGATAGGTAAAGCAGAGGG + Intronic
956308347 3:67851547-67851569 CTTAAGATAGGTAGAGCACTTGG - Intergenic
957270446 3:78024014-78024036 CTTTATGAAGGTAAAACAGAGGG + Intergenic
957901524 3:86500088-86500110 CTTTAAATAGATAAACTAGAGGG + Intergenic
958794606 3:98693448-98693470 CTTCAGATAGCTATAGCAGAGGG - Intergenic
960617467 3:119609170-119609192 CTTTAGACAGCGAATGCAGATGG + Intronic
963935311 3:151046319-151046341 ATATAGATAGAGAAAGCAGATGG - Intergenic
963953309 3:151226237-151226259 CTTTAGCTAGGCAAAGAAGAAGG + Intronic
964439247 3:156688820-156688842 CTTGAGACAGGCACAGCAGATGG - Intronic
964591960 3:158374964-158374986 CTTAAGAGAGTTAAAACAGAAGG - Intronic
966974727 3:185073860-185073882 TTTGAGATAGGCAAAGCACAGGG - Intergenic
970661156 4:18287373-18287395 CTTTAGGTAGGGGAAGCAGTGGG + Intergenic
972439504 4:39072918-39072940 CTTTAAATAGCTAAAAGAGAGGG + Intronic
973959719 4:56097580-56097602 GTTTAGACAGGTAAGCCAGATGG + Intergenic
974189895 4:58491156-58491178 AGTTAGATAGGGAAAGCTGAAGG - Intergenic
974555336 4:63439488-63439510 CTTTAAATAGGTAAATTATATGG + Intergenic
975549041 4:75591350-75591372 CTTTGGGAAGCTAAAGCAGAAGG + Intronic
975614459 4:76233000-76233022 AGTTAGATAGGAAAAGCTGAAGG - Intronic
975980510 4:80153340-80153362 CTTTATATAGGAAAAGTAGATGG - Intergenic
976016420 4:80560412-80560434 CTTTGGCTTGGGAAAGCAGAGGG + Intronic
976235521 4:82892003-82892025 CTTTGGGTAGCTAAAGCAGAAGG + Intronic
976235623 4:82893310-82893332 CTTTGGGTGGCTAAAGCAGAAGG - Intronic
976578607 4:86706773-86706795 CTCTACATACGTAAAGCAGTAGG + Intronic
976621225 4:87129410-87129432 CTTTAGATAAGTATATCATAAGG - Intronic
977659194 4:99563451-99563473 CTTTAAAGAGGTAAAGCCCACGG + Exonic
981913799 4:150012006-150012028 CTTTCTCTAGGTAAAGAAGAAGG - Intergenic
982145861 4:152391001-152391023 CTTTAAATAGGTAAAATAGGAGG + Intronic
982749191 4:159138933-159138955 ATTGAAATAGGTAAAGCAGAAGG + Intronic
983126068 4:163951608-163951630 TATCAGAAAGGTAAAGCAGACGG + Intronic
983838362 4:172422348-172422370 CTGTGGATAGGTCAAGCAAAGGG - Intronic
984103672 4:175517695-175517717 TTATAGATAGGTGAAGCAGAGGG - Intergenic
987131316 5:14862560-14862582 ATTTAGAGAGGTAAGGCAGGAGG + Intronic
987213443 5:15708285-15708307 CTTTAGATAGGGAAAGGAATTGG + Intronic
987493094 5:18606260-18606282 TTCTAGAAAGCTAAAGCAGATGG + Intergenic
990119914 5:52438475-52438497 AGTTATATAGGTAAAGAAGAAGG + Intergenic
990793432 5:59510778-59510800 CTTTAGTTAAGTGAAGCAAAAGG + Intronic
993085215 5:83355381-83355403 GGATAGAGAGGTAAAGCAGATGG - Intergenic
993584411 5:89706193-89706215 TTTTAGATACCTAAAGCAGTGGG - Intergenic
994121901 5:96123891-96123913 CATAAGATAGGCAAAGCAGGGGG - Intergenic
994146394 5:96400677-96400699 CTTTTGATAGATAAAGAAAAAGG - Intronic
994867305 5:105292496-105292518 CTTTAGTTAGGTAAGTCAGATGG + Intergenic
996794456 5:127329996-127330018 GTTTAGATAGGTCAAGTTGAAGG - Intronic
998310718 5:141127203-141127225 CTTTTGATAGTAAAAGAAGAGGG - Intronic
999938368 5:156513514-156513536 TTTTCAATAGGAAAAGCAGAAGG - Intronic
1000518282 5:162267591-162267613 CTTTACAGAAGTAAAGTAGAGGG + Intergenic
1000535375 5:162471981-162472003 ATTTATCTAGGTACAGCAGAAGG - Intergenic
1000951807 5:167493167-167493189 CTTTAGAAGGCCAAAGCAGAAGG + Intronic
1004416735 6:15431438-15431460 CTTCAGAAGGGTAAAGCTGAAGG - Intronic
1005661380 6:28002369-28002391 CCTTGGATAGGGAAAGCAGTTGG + Intergenic
1006325331 6:33349405-33349427 CTTTAGGAAGGTAAAGGTGAGGG - Intergenic
1008191220 6:48460941-48460963 CTTTATAAAAGCAAAGCAGAGGG + Intergenic
1009615601 6:66000584-66000606 TTTCAGATACGTAAACCAGAGGG + Intergenic
1010309132 6:74362408-74362430 CTTTTGATAGTTAATGAAGAAGG + Intergenic
1010688981 6:78886848-78886870 CATTAAAAAGGTAAAGCAGAAGG - Intronic
1012058542 6:94446903-94446925 ATTTAGATATGTGAAGCATAGGG + Intergenic
1012067555 6:94567639-94567661 CTTTAGACATGTAAAGAATAGGG + Intergenic
1012670754 6:102044340-102044362 CTTAAGATAGGTAAAAGAAAGGG - Intronic
1014217443 6:118766433-118766455 CTTTACAGAGGAAAGGCAGAAGG - Intergenic
1014614999 6:123587743-123587765 ATTTGGGTAGGTAAAGCAAAAGG + Intronic
1016099708 6:140083917-140083939 CTTTAATTAGGTAAAAAAGAAGG - Intergenic
1016167167 6:140960656-140960678 CTTTATATATGTTAAGGAGAAGG + Intergenic
1016428857 6:143962297-143962319 ATTTAGATTTCTAAAGCAGAGGG + Intronic
1016957206 6:149638215-149638237 CTTTGGAAAGCCAAAGCAGAAGG - Intronic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1017045213 6:150340858-150340880 CTTTAGATAGTTAAAAAAAATGG - Intergenic
1020676960 7:11194359-11194381 AGTTAGATAGGAAAAGCTGAAGG + Intergenic
1020795298 7:12671583-12671605 CTTTACATAGCTGAAGCAGGAGG - Intergenic
1022275877 7:28854705-28854727 CTGTGGATAGGTAAAGAATAGGG - Intergenic
1028516738 7:91685904-91685926 GTTTAGAAAGGTAAAGTAGCTGG + Intergenic
1033855457 7:145555945-145555967 TTATAGATAAGTATAGCAGAAGG - Intergenic
1034066093 7:148138128-148138150 CTTTAGATAAGTCTATCAGAAGG - Intronic
1036220949 8:6921295-6921317 ATTTAAATTGGTAAAGCAGATGG - Intergenic
1036248893 8:7144924-7144946 CTTTAAATTGGCAAAGCATACGG + Intergenic
1036848237 8:12184453-12184475 CTTTAGGAAGCTAAAGCAGGAGG - Intronic
1036869599 8:12426734-12426756 CTTTAGGAAGCTAAAGCAGGAGG - Intronic
1036971816 8:13363877-13363899 CTTTAGCCAAGTAAAGCAAATGG - Intronic
1037578775 8:20232235-20232257 GTTTTGATAAGTAAATCAGATGG - Intergenic
1041543738 8:59016827-59016849 CTTAGGACAGGTAAAGCAAATGG - Intronic
1042652536 8:71059224-71059246 TTTTCCACAGGTAAAGCAGAGGG - Intergenic
1042921653 8:73925883-73925905 CTTTGGAAAGCCAAAGCAGACGG - Intergenic
1043136418 8:76531948-76531970 CTTTAAATAATTAAAGCAGCTGG + Intergenic
1043244907 8:77986144-77986166 CTTTAGATAGGTAAAGATATAGG - Intergenic
1045051732 8:98333688-98333710 ATTTGAATTGGTAAAGCAGATGG + Intergenic
1045833466 8:106492310-106492332 CTTTAGATAGTTAGCTCAGAAGG + Intronic
1046054602 8:109064192-109064214 CTTATCATAGCTAAAGCAGATGG - Intergenic
1046307897 8:112394499-112394521 GTTTAGAGAGGCAGAGCAGAGGG - Intronic
1046706911 8:117464364-117464386 CATTAGCTAGGTAAAGAACATGG + Intergenic
1047264304 8:123291639-123291661 GGTTAGATAGGTACAGGAGAAGG + Intergenic
1047380396 8:124356669-124356691 CTTTAGATAGGTCAAGTAAGAGG - Intronic
1048092830 8:131259798-131259820 TTTTAGAAATGTAAGGCAGAGGG - Intergenic
1048150521 8:131889134-131889156 CAGTAGATAAGTAAAGCAGATGG + Intergenic
1050648146 9:7744562-7744584 CTTTAGGAAGCTAAGGCAGATGG + Intergenic
1051711797 9:19938545-19938567 CATTAGAAATGTGAAGCAGAAGG - Intergenic
1053151430 9:35745936-35745958 CATTAGATAGCTAGAGCAGGTGG - Intronic
1058289990 9:103228220-103228242 CTAAAGACAGCTAAAGCAGATGG - Intergenic
1058525727 9:105856191-105856213 AGTTAGATAGGAAAAGCATATGG - Intergenic
1058840594 9:108904075-108904097 CTTAAAATAGTTAAAGCAGCTGG + Intronic
1059042885 9:110833179-110833201 CATTAGCTAGTTTAAGCAGAAGG + Intergenic
1059711443 9:116871349-116871371 CTTTAAATAGGTAAATCATATGG - Intronic
1060578873 9:124725364-124725386 CTTTAGTGTGATAAAGCAGATGG - Intronic
1185874183 X:3688617-3688639 CTTTAGAAGGCTGAAGCAGAAGG + Intronic
1186176580 X:6931417-6931439 CTTTAGAAGGGCAAGGCAGAAGG - Intergenic
1186836405 X:13442785-13442807 CTTTAGAGGGTTAAAGCAGAGGG + Intergenic
1186948013 X:14590994-14591016 CTTTAAAAAGGTACAGCTGAGGG + Intronic
1189153129 X:38727732-38727754 AGTTAGATAGGGAAAGCTGAAGG + Intergenic
1190843244 X:54166388-54166410 TTTTAGATATGTAAAGCACTTGG + Intronic
1193111319 X:77733623-77733645 CTTTGGAAGGCTAAAGCAGACGG + Intronic
1193205682 X:78745176-78745198 CTTTGGTTGGGTAAAACAGAAGG + Intergenic
1195520945 X:105827895-105827917 CTTGAGATAAGAAAACCAGAAGG - Intronic
1197126731 X:122955541-122955563 CTTTGTGTAGGTGAAGCAGAAGG - Intergenic
1197784365 X:130185960-130185982 GTTTAGATTGGTAAAGGAGAGGG + Intergenic
1197836876 X:130704334-130704356 TATTAGATAGGTAAAGTAGAGGG + Intronic
1197900375 X:131365300-131365322 CTTTATCTAGGTGAAGGAGAAGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1201581830 Y:15517914-15517936 ATTTGGGTAGGTAAAGGAGAAGG - Intergenic