ID: 955570616

View in Genome Browser
Species Human (GRCh38)
Location 3:60301020-60301042
Sequence GAGTCCATTCTAGATTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955570612_955570616 -6 Left 955570612 3:60301003-60301025 CCCAAAGCATCTCTCCCGAGTCC 0: 1
1: 0
2: 2
3: 75
4: 1851
Right 955570616 3:60301020-60301042 GAGTCCATTCTAGATTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 116
955570613_955570616 -7 Left 955570613 3:60301004-60301026 CCAAAGCATCTCTCCCGAGTCCA 0: 1
1: 0
2: 0
3: 16
4: 208
Right 955570616 3:60301020-60301042 GAGTCCATTCTAGATTCCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955570616 Original CRISPR GAGTCCATTCTAGATTCCCC CGG Intronic
900866002 1:5269123-5269145 GAGAGCATCCTGGATTCCCCAGG + Intergenic
904534332 1:31189189-31189211 GAGGCCATGCTAGATCACCCCGG + Intronic
905126192 1:35717897-35717919 GAATCCACTCTTGACTCCCCAGG + Intronic
907273780 1:53305795-53305817 GAGGCCATTCTAGAGGCCCCTGG - Intronic
907772959 1:57484314-57484336 TAGATCATTCTTGATTCCCCTGG - Intronic
909336925 1:74485982-74486004 GAGTCCAGTATAGATTAGCCGGG - Intronic
910988967 1:93035339-93035361 GAGTGCAGCCTCGATTCCCCAGG - Intergenic
912557866 1:110529265-110529287 GAGGCCATTCTCTATTCTCCTGG + Intergenic
915277001 1:154795932-154795954 GAATACAGTCTAGACTCCCCAGG - Intronic
916464239 1:165057917-165057939 CAGTGCATTCTTGATTCCCTTGG + Intergenic
920634813 1:207690917-207690939 GAGACCATTCTGGATTGCCAGGG - Intronic
924439387 1:244073830-244073852 GAGATCATCCTAGATTACCCAGG - Intergenic
924759569 1:246971446-246971468 GAGTCTTGTCTAAATTCCCCAGG + Intronic
1064149767 10:12852964-12852986 AGGTCCATTATAGACTCCCCTGG - Intergenic
1066214010 10:33267910-33267932 TAGGCCATTCCAGAGTCCCCGGG - Intronic
1071765537 10:88660455-88660477 GACTACGTACTAGATTCCCCTGG - Intergenic
1074955217 10:118382209-118382231 CAGTCCATTGTAGAGTCCCCCGG + Intergenic
1076003001 10:126927339-126927361 ATGTGCATTCCAGATTCCCCTGG + Intronic
1080744745 11:35098819-35098841 GAGTCCATTCTAGGTAGCTCAGG + Intergenic
1085056182 11:73405363-73405385 GAGACCATTCCAGACTCACCAGG + Intronic
1085837038 11:79967975-79967997 GACTAGATTCTAGATTCCTCTGG - Intergenic
1089091751 11:115883867-115883889 CAGTCCATTCTTCATGCCCCAGG + Intergenic
1092985009 12:13836905-13836927 GAATGCATTCTCCATTCCCCGGG - Intronic
1093588305 12:20869115-20869137 GAGTCTTTTCTAAACTCCCCCGG + Intronic
1094390181 12:29940462-29940484 GAGGTCATTCTGGATTACCCAGG + Intergenic
1094614046 12:32020527-32020549 TAGTTCATTCTAAATTCACCTGG + Intergenic
1095825335 12:46524968-46524990 GAATACATTCTAAATTCCTCTGG + Intergenic
1099867398 12:88300612-88300634 GAGTCCATTCTAAATCCCAGTGG + Intergenic
1099887667 12:88551854-88551876 GAGACTATCCTAGATTCCCTGGG + Intronic
1101783287 12:107857884-107857906 CACTCCATTCTGGATTCCCCTGG - Intergenic
1103596415 12:122026873-122026895 GAATCCATCCCAGATTCTCCAGG - Intronic
1104538450 12:129640576-129640598 AGGTCCCTCCTAGATTCCCCAGG - Intronic
1106661675 13:31806631-31806653 CATTCCATTCTCAATTCCCCTGG + Intergenic
1109414185 13:62014334-62014356 AAGTACATCCTAGAATCCCCAGG - Intergenic
1109584873 13:64386644-64386666 TAGTTCATTCTAGATTCACCTGG + Intergenic
1116382327 14:44285497-44285519 GAGAGCATTCTAAATTACCCAGG - Intergenic
1118972941 14:70652823-70652845 GAGTCCATTCAAGTTTCCAATGG - Intronic
1129942129 15:79507363-79507385 GAGACCATTCTAGTTTGTCCTGG - Intergenic
1132967961 16:2670067-2670089 GAGTCTTTTCTAAACTCCCCCGG + Intergenic
1136352722 16:29721618-29721640 GAGTCTTTTCTAAACTCCCCCGG + Intergenic
1136657304 16:31717525-31717547 GAGTTCATCCTAAATTCACCTGG - Intronic
1136673605 16:31879261-31879283 GAGTTCATCCTAAATTCACCTGG - Intronic
1137595059 16:49717982-49718004 GAGTACATTCAAGAATCCCCTGG + Intronic
1145226164 17:21129925-21129947 TAGTTCATTCTAAATTCACCTGG + Intronic
1163797285 19:19344950-19344972 GAGAACATTCTGGATTCTCCCGG - Intronic
1163926612 19:20351137-20351159 TAGTTCATTCTAAATTCACCTGG + Intergenic
925526382 2:4807238-4807260 GAGAACATTCTGGATTTCCCAGG - Intergenic
928616217 2:33042331-33042353 AAGTCCATTTTAGTTTTCCCTGG - Intronic
929060102 2:37914820-37914842 GAGTCCATTCTTGTTTTTCCTGG - Intergenic
929090743 2:38214694-38214716 GAGTCCATTTTTCATTCCCTGGG - Intergenic
933897368 2:86824060-86824082 GAGTGCATTCTAGATGCAGCAGG + Intronic
934621550 2:95812609-95812631 GAGTCAATTCCTGATACCCCCGG + Intergenic
934965434 2:98717450-98717472 GAGTCCAATCTAGGATCCCATGG - Intronic
936064258 2:109318661-109318683 GAGACCATTCTGGCTTCCCTAGG - Intronic
947111691 2:226725481-226725503 GTGTCCATTTTTGATTCCCGGGG - Intergenic
948275978 2:236709145-236709167 GAATCCATTCTAAAGTCTCCAGG + Intergenic
1171199054 20:23226435-23226457 GATCCCATTCCAGATTCCCAGGG - Intergenic
1172358897 20:34298633-34298655 GAGTCTTTTCTAAACTCCCCTGG - Intronic
1172856687 20:38009692-38009714 GAGGCCATACTAGGTTGCCCAGG + Intronic
1176895418 21:14372688-14372710 AATTCCATGCTATATTCCCCAGG + Exonic
1178184576 21:30205523-30205545 AAGTCCATCCTAAATTCACCTGG + Intergenic
1178279936 21:31273259-31273281 GGGACCATTCTTGATTCCTCTGG - Intronic
1180200970 21:46223942-46223964 GAGTCTTCTCTAAATTCCCCCGG - Intronic
1180743470 22:18070588-18070610 GAGTCCCTTCAAGATGGCCCTGG + Intergenic
1182434009 22:30318592-30318614 GAGTCCATTCTGGAGCCCTCTGG - Intronic
1182442517 22:30372596-30372618 GAAGCCATTCTGGATTCCCATGG - Intronic
952966624 3:38625002-38625024 GAGATCATTCTAGATTATCCAGG + Intronic
953294143 3:41696118-41696140 GAGTCTTTTCTAAACTCCCCCGG - Intronic
954645474 3:52128977-52128999 GAGTGCATTCTAGAATTTCCAGG + Intronic
955570616 3:60301020-60301042 GAGTCCATTCTAGATTCCCCCGG + Intronic
960456238 3:117876008-117876030 GAGCCCATTCTAAAGTCACCTGG + Intergenic
962490300 3:135887216-135887238 GAGTCCATTCTGTGTTTCCCAGG - Intergenic
965439799 3:168698940-168698962 GAGTCTTTTCTAAACTCCCCCGG + Intergenic
965643971 3:170860519-170860541 GAGTCTTTTCTAAACTCCCCCGG - Intergenic
966036427 3:175422787-175422809 TAGTTCATTCTAAATTCACCTGG + Intronic
966959777 3:184923624-184923646 GAATACATTCTAGATTCCTTAGG + Intronic
972337299 4:38118579-38118601 GGGCCCTTTCTAGATTCCCTTGG + Intronic
973245218 4:48003905-48003927 GAGTCTTTTCTAAACTCCCCTGG - Intronic
978531403 4:109718032-109718054 AAGTCCATTAAAGATTCTCCAGG + Intronic
987128939 5:14842585-14842607 CAGTCCATTTTAGTTTTCCCAGG - Intronic
987717748 5:21593860-21593882 GAGTCTCTTGTAGATTTCCCAGG - Intergenic
987752906 5:22065086-22065108 GAGGCCATTATAGTTTCCCTGGG - Intronic
988954124 5:36296867-36296889 GAGTCCATTCTTGGTTGCTCTGG - Intronic
992078649 5:73214541-73214563 GAGTTCATTAAAGACTCCCCAGG - Intergenic
992897383 5:81256988-81257010 GCATCCATACCAGATTCCCCTGG - Exonic
996226733 5:121008460-121008482 GAGTCCATTGTCTATTCTCCTGG - Intergenic
996284424 5:121771416-121771438 GAGTATATTCTAGATTATCCAGG + Intergenic
997467810 5:134099948-134099970 GGGTCCATCCCACATTCCCCAGG + Intergenic
997792554 5:136773877-136773899 AAGTGCATTCTAGATTCCCTAGG + Intergenic
999951335 5:156654276-156654298 CAGACCATTCTATGTTCCCCAGG - Intronic
1000035479 5:157444519-157444541 GTTTCCATTCAGGATTCCCCAGG + Intronic
1000255795 5:159537089-159537111 GAGACCATTTTAGATTCCAATGG + Intergenic
1000909503 5:167005140-167005162 GAATCCATACTATATTCCCTTGG - Intergenic
1001682832 5:173571172-173571194 GAGCCCATGCTAGGTTGCCCAGG - Intergenic
1001817813 5:174685242-174685264 GAGTCTATTTTAGATACCTCAGG - Intergenic
1004672773 6:17813562-17813584 GAGTCAATTATATTTTCCCCAGG - Intronic
1006990313 6:38209630-38209652 GAGTCCTTTTTAAATTCCTCAGG + Intronic
1008942931 6:57066822-57066844 GAGTCCTTCCTAGGTTCCCTGGG + Intergenic
1010607364 6:77907697-77907719 AAGTCAGTTCTAGATTCCTCAGG - Intronic
1010661801 6:78580162-78580184 TAGTTCATCCTAGATTCACCTGG + Intergenic
1014005777 6:116416205-116416227 GAGATTATTCTAGATTACCCAGG - Intronic
1015655913 6:135518962-135518984 GATTCAATTCTCGATTCCCCAGG + Intergenic
1020719933 7:11730357-11730379 GAGTGCATTCAGTATTCCCCAGG - Intronic
1025144821 7:56493887-56493909 GGGTCCTTTCTAGATACCCCTGG + Intergenic
1026057718 7:66999248-66999270 GAGTCCATTATCGATGCCCATGG + Intronic
1026720389 7:72825780-72825802 GAGTCCATTATCGATGCCCATGG - Intronic
1027187107 7:75979305-75979327 GAGTCCCTTCTAAGTTCCTCTGG - Intronic
1030926161 7:115457441-115457463 GAGTCTATTTTAAATTCCTCAGG - Intergenic
1032909509 7:136413364-136413386 AAGTCCATTCCAGACTCCCTGGG - Intergenic
1033452578 7:141474860-141474882 GAGTCCATTCTAAATGCCTCTGG - Exonic
1034261615 7:149760305-149760327 GGTTCCATTTAAGATTCCCCAGG + Intergenic
1036104075 8:5821243-5821265 AAGTTCATCCTAGATTCTCCAGG - Intergenic
1038123234 8:24641944-24641966 GAGATCATTCTAGATTACTCAGG + Intergenic
1038475341 8:27862348-27862370 GAGTCCAATCCAGATTGCTCAGG - Intergenic
1039305038 8:36252154-36252176 GAGTCCTATATAGGTTCCCCAGG + Intergenic
1039392041 8:37189237-37189259 GAGTCTTTCCTAGATTCCCAGGG + Intergenic
1049003393 8:139840069-139840091 GAGTCTGTACTAAATTCCCCTGG + Intronic
1054977110 9:71160649-71160671 GAGGCCTTCCTAGATTCCACTGG + Intronic
1059792918 9:117660057-117660079 GAGTCCCTATTAGATTTCCCAGG - Intergenic
1062148855 9:135007186-135007208 GTGTCCCTTCTAGAAGCCCCTGG + Intergenic
1062395207 9:136350003-136350025 GAGCCCAGCCTAGAGTCCCCAGG - Intronic
1189033997 X:37477834-37477856 GAGGCCATTATAGTTTCCTCAGG + Intronic
1193966761 X:87997296-87997318 GAGACCATTATAGTTTCCTCAGG - Intergenic
1194106693 X:89778383-89778405 GAGTCCATTATAATTTCCTCAGG - Intergenic
1200015984 X:153164208-153164230 GAGTACATTTTAGATCCCACAGG - Intergenic
1200458657 Y:3426247-3426269 GAGTCCATTATAATTTCCTCAGG - Intergenic