ID: 955572026

View in Genome Browser
Species Human (GRCh38)
Location 3:60318086-60318108
Sequence TAAGATGCCCAGAATGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955572026_955572031 15 Left 955572026 3:60318086-60318108 CCCGCCCCATTCTGGGCATCTTA 0: 1
1: 0
2: 0
3: 19
4: 221
Right 955572031 3:60318124-60318146 AAAAAACCCTGAACACATCATGG 0: 1
1: 0
2: 2
3: 28
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955572026 Original CRISPR TAAGATGCCCAGAATGGGGC GGG (reversed) Intronic
902295509 1:15464120-15464142 TAGGAAGCCCAGAATGGGGTAGG + Intronic
902361923 1:15946614-15946636 TCAGATGCCCACTATGGGCCAGG - Intronic
903490394 1:23723826-23723848 TAAGAAGCCCGAAAAGGGGCTGG - Intergenic
903569637 1:24294818-24294840 GAAGATGCCCAGTAGGGGGAGGG + Intergenic
903610982 1:24612508-24612530 TAATATATCCAGAATGTGGCCGG - Intergenic
904109838 1:28117213-28117235 TAAGATGCGCAGCAGTGGGCCGG - Intergenic
904453433 1:30631856-30631878 GAAGATGCCAAGGATGGTGCAGG + Intergenic
904462917 1:30691068-30691090 TGAGATGCTCAGCATAGGGCTGG - Intergenic
904608045 1:31709384-31709406 TAAGATGCCCTGGCTGGGCCTGG - Intergenic
906101955 1:43269748-43269770 CAAGTTGCCCAGACTGAGGCTGG + Intronic
908154834 1:61342017-61342039 TAGCATGTCTAGAATGGGGCCGG + Intronic
909249464 1:73333364-73333386 TAAGAAGCCCAGGAATGGGCAGG - Intergenic
910187143 1:84556414-84556436 TAAGATGACCACTTTGGGGCCGG + Intronic
910298815 1:85682318-85682340 TAAGATGAACAAAATGAGGCCGG - Intronic
916732094 1:167575416-167575438 TAACATGCCCACAGTGGGCCAGG + Intergenic
917028609 1:170666602-170666624 TTAGAAGACCAGAGTGGGGCAGG + Intronic
918304011 1:183229338-183229360 TATAAAGTCCAGAATGGGGCCGG + Intronic
918602099 1:186375678-186375700 TATGGCGCCCAGAAGGGGGCGGG + Intronic
920089367 1:203441392-203441414 CTAAATGCCCAGATTGGGGCTGG + Intergenic
920100425 1:203513861-203513883 TTAGGTGCCAGGAATGGGGCTGG + Intergenic
920182030 1:204137914-204137936 TACCATGCCCAGGATGAGGCTGG - Intronic
922024358 1:221736961-221736983 TAAGATTGCCTCAATGGGGCGGG - Intronic
922060696 1:222088420-222088442 TAAAATGGACAGAATGGGACTGG + Intergenic
923522085 1:234742948-234742970 TAAAATGCCAAGAATGATGCCGG + Intergenic
1063497274 10:6521532-6521554 CAAGGTGCTTAGAATGGGGCTGG + Intronic
1065785176 10:29206269-29206291 CAAGATGCACAGAAGGGTGCAGG + Intergenic
1066258569 10:33705998-33706020 TGAGATGCAGAGAATGGGGTTGG - Intergenic
1069626079 10:69868413-69868435 TAGGAAGCCCAGGGTGGGGCAGG + Intronic
1069827066 10:71260855-71260877 CAAGAGGCCCAGGAAGGGGCGGG + Intronic
1075773215 10:124958887-124958909 TATGTTGCCCAGACTGGGACTGG - Intronic
1077485082 11:2834890-2834912 GCAGATGCCAGGAATGGGGCTGG + Intronic
1078646844 11:13148503-13148525 TAATCTGCCCATAATGGCGCTGG + Intergenic
1084105545 11:66977809-66977831 AATGGCGCCCAGAATGGGGCAGG + Intergenic
1084648203 11:70473162-70473184 ATAGATCCCCAGAAGGGGGCTGG + Intronic
1084854854 11:71976651-71976673 GAATATACCCAGAATGGGCCAGG - Intronic
1085768917 11:79307943-79307965 TGAGAAGCCCAGGATGGGGTAGG - Intronic
1087135955 11:94720362-94720384 TCAGAAGCCCAGACTGTGGCTGG + Intronic
1088147993 11:106706904-106706926 TAATATGCCCAGAATTGTGTTGG + Intronic
1091188773 11:133671699-133671721 TAAAGTGCCAAGAGTGGGGCAGG + Intergenic
1091621083 12:2089567-2089589 TAACATGCCCCGGATGGGCCCGG - Intronic
1091738821 12:2945295-2945317 TAAAATGCCCAGGATCTGGCCGG + Intergenic
1091806539 12:3360933-3360955 TAAAAGGCTCAGAAAGGGGCCGG - Intergenic
1093401748 12:18754341-18754363 TTACAGGCACAGAATGGGGCAGG + Intergenic
1095457354 12:42402132-42402154 TAAGAACCTCAGAATGGGCCGGG - Intronic
1096170262 12:49462865-49462887 TTATAGGCACAGAATGGGGCAGG + Intronic
1096260532 12:50087414-50087436 TCAGATGCCGAGGATGGGGAAGG + Exonic
1097318899 12:58203837-58203859 TGAGATGCCCAGAATAAGTCTGG - Intergenic
1099964339 12:89429382-89429404 TGAGATGCACAGCATGGGGGAGG + Intronic
1100916880 12:99433967-99433989 TAAGATGCCCAGCATATGGTAGG + Intronic
1101135765 12:101741403-101741425 TATGAGGCCAAGAATGAGGCTGG - Intronic
1101517813 12:105453060-105453082 TAAGGTGCCCTGAATGGCGCAGG - Intergenic
1103053874 12:117803381-117803403 TAAGCTCCCCAGCATGGGGTCGG - Intronic
1104804657 12:131577549-131577571 TAAGAGGGCCAGAAAGGGCCTGG + Intergenic
1107236113 13:38172939-38172961 TTAGATGCCCACAGTGGGCCAGG + Intergenic
1108408870 13:50128220-50128242 TAAGCTGACCAGATTGGGGTTGG - Intronic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1111294134 13:86257693-86257715 TAAGAGGCAGAGAAAGGGGCTGG - Intergenic
1115525763 14:34279302-34279324 TACGATGCCAAGGATGGGGGTGG - Intronic
1119110801 14:71972153-71972175 TAATATGTCCAAAATTGGGCTGG - Intronic
1119187286 14:72651816-72651838 AGAGCTGCCCAGCATGGGGCAGG + Intronic
1119576796 14:75731012-75731034 TAAGAATCCTAGAATGAGGCCGG - Intronic
1120072272 14:80117131-80117153 TCAGATTCCCAGAATATGGCAGG - Intergenic
1121633297 14:95437080-95437102 CAAGATGCCCAAAATGGCGACGG + Intronic
1122327817 14:100893003-100893025 GCAGATGCCCAGAGTGGGGTTGG + Intergenic
1122806919 14:104264529-104264551 CAAGATGCCAATACTGGGGCGGG - Intergenic
1125185455 15:36924712-36924734 TAAAATGTCCAGAATTGTGCAGG - Intronic
1125202411 15:37111493-37111515 TAATTTCCCCAGACTGGGGCAGG - Intergenic
1125999890 15:44198767-44198789 TAGGATGCCCAGAATGGAAAGGG + Intergenic
1126609186 15:50511699-50511721 TAAAATACCCAGAATAGGCCAGG + Exonic
1128891811 15:71338274-71338296 AAAGAAGCTCAGAGTGGGGCGGG - Intronic
1129870485 15:78937056-78937078 TCAGATGGCAGGAATGGGGCAGG + Intronic
1130908369 15:88255254-88255276 GGAAATGCCCAAAATGGGGCTGG + Intronic
1131765228 15:95668516-95668538 AAAGATCCCCAAAATGGGGGTGG + Intergenic
1134754606 16:16655716-16655738 AAAGATGCCAAGGAGGGGGCTGG - Intergenic
1134822609 16:17258908-17258930 GAAGGTGAGCAGAATGGGGCTGG + Intronic
1134991455 16:18703326-18703348 AAAGATGCCAAGGAGGGGGCTGG + Intergenic
1135120455 16:19761852-19761874 TTAGATGTCCAGAGTAGGGCAGG + Intronic
1135124612 16:19798045-19798067 TAAGAGGCAGAGAAAGGGGCTGG + Intronic
1137953055 16:52801915-52801937 AAAGATGCCAATAATGTGGCAGG - Intergenic
1138046679 16:53732344-53732366 TAAGAAGACCACAATGGGCCAGG - Intronic
1138199392 16:55077793-55077815 TAAGAGTCCCAGAAAAGGGCCGG + Intergenic
1138223146 16:55270146-55270168 TAAGATCCCCAGGGTGGGGCAGG + Intergenic
1140852493 16:78948135-78948157 TAAGTTGCTCAGAATGAGACAGG + Intronic
1141177545 16:81730720-81730742 CAGGATGCCCAGAATGGGCGGGG + Intergenic
1142027839 16:87824019-87824041 AAGGCTGCCCAGAATGGGGTAGG + Intergenic
1142524618 17:531250-531272 TGACAGGCCCAGAATGGGGAGGG - Intronic
1142773052 17:2113667-2113689 TAAGATCTCCAGAATGGAGTAGG - Intronic
1144784238 17:17823128-17823150 TAAGATGCCCACAATAGGCAGGG + Intronic
1144943684 17:18959068-18959090 TATTAGGCCCAGGATGGGGCCGG + Intronic
1146224748 17:31055749-31055771 TAAGGTACCCAGAAAAGGGCAGG + Intergenic
1148468506 17:47878860-47878882 TAAGGTGCCAACAATGGGGCGGG - Intergenic
1148881409 17:50730643-50730665 TAAGATGTCCTTAATGGGCCTGG + Intronic
1150386470 17:64765526-64765548 TCAGATGCTGAGAATGGGGAGGG - Intergenic
1150450554 17:65263594-65263616 TAATATGTCAAGCATGGGGCTGG + Intergenic
1151141413 17:71996009-71996031 TAATATGCTAAGAATGGGCCAGG + Intergenic
1156498703 18:37543345-37543367 GAAGATGCCCAGCTTGGGGGAGG - Intronic
1156904055 18:42333564-42333586 TAAGAAGGGCAGAGTGGGGCTGG - Intergenic
1157769767 18:50335538-50335560 TAAAATGCCTAGAAAAGGGCCGG + Intergenic
1158573341 18:58615107-58615129 TAAAATGTCCAGAATAGGCCGGG - Intronic
1159610058 18:70514775-70514797 AAAGATGACCAAGATGGGGCAGG - Intergenic
1159625728 18:70691815-70691837 TAGGATGCCTAGAATGAGGCAGG - Intergenic
1159742544 18:72190418-72190440 TAAAAGACCCAGAATGGGCCAGG - Intergenic
1162720743 19:12661051-12661073 TAAGAAGTCCAGCATGAGGCCGG - Intronic
1163691942 19:18743048-18743070 GAAGCTCCCCACAATGGGGCAGG - Intronic
1163730104 19:18944036-18944058 TAAGAGTCACAGAAAGGGGCTGG + Intergenic
1163754746 19:19100022-19100044 TAATATGACCAGAGTGGGGCTGG - Intronic
1164023222 19:21327585-21327607 TAAGGTGAGCAGAATGGGGTGGG - Intronic
1164515810 19:28934289-28934311 TAAAATGCCCAAATTGGGCCAGG + Intergenic
1165087524 19:33361392-33361414 CAAGATGCCCATCCTGGGGCTGG - Intergenic
1165185926 19:34021267-34021289 GAAAATGTCCAAAATGGGGCCGG - Intergenic
1166539003 19:43593455-43593477 TAATGATCCCAGAATGGGGCAGG + Intronic
1166590994 19:43998237-43998259 TAAGTTGCCCAGTATGAGGCTGG - Intronic
926961521 2:18363328-18363350 TATGATGCCCAGCATGTGGTGGG + Intergenic
928152572 2:28845289-28845311 TATGTTGCCCAGACTGGTGCTGG + Intronic
929315031 2:40466692-40466714 TAATATGCACAGCATGGGCCTGG - Intronic
930919620 2:56736495-56736517 TAAAAAGCCCAGAATAGGGTTGG - Intergenic
933514520 2:83283790-83283812 TAAGATGGCCTTAATGGGCCAGG + Intergenic
935795772 2:106640426-106640448 TCAGATGTCCCGAGTGGGGCAGG - Intergenic
937341557 2:121094506-121094528 TAAAATTCTCAGAATGGGCCAGG + Intergenic
937980644 2:127612623-127612645 TCTGATGCTCTGAATGGGGCCGG - Intronic
940195515 2:151090256-151090278 AAAGATGCCTAGAATAGTGCTGG + Intergenic
940262211 2:151792833-151792855 GAAGATGCCCAGAGTGGTGGTGG + Intronic
940881006 2:158946829-158946851 TAAAATCACCATAATGGGGCTGG - Intergenic
941067460 2:160919443-160919465 CAAGATGCCCATGATGGGGAGGG - Intergenic
941606688 2:167606022-167606044 TAAGGTGACAGGAATGGGGCAGG - Intergenic
944608761 2:201378634-201378656 TAAGTGTCCCTGAATGGGGCAGG - Exonic
945170742 2:206992146-206992168 TAATTGGCCCAGATTGGGGCAGG + Intergenic
948001086 2:234567961-234567983 TAAGATGCCCTTATTGGGACAGG + Intergenic
948256367 2:236571346-236571368 AAAGCTGCCCAGGATGGGGGTGG + Intronic
1169239945 20:3968310-3968332 AAAAATGCTCAGAAAGGGGCTGG + Intronic
1169952287 20:11058620-11058642 TGAGATGCCAAGTTTGGGGCTGG - Intergenic
1171426446 20:25051539-25051561 GCAGATGCCCAGAACGGGGACGG - Intronic
1173368151 20:42407321-42407343 GAAAATGCTCAGAATGAGGCTGG - Intronic
1173569020 20:44065013-44065035 TAAAGTGCCCAGAATGAGCCTGG - Intronic
1174013519 20:47469771-47469793 TAAGATGCACTGAATAGAGCTGG + Intergenic
1175499377 20:59439050-59439072 TCAGATGCCCAAAGAGGGGCAGG + Intergenic
1176105256 20:63382729-63382751 TCAGCTGCCCAGAATAGCGCTGG + Intergenic
1177879912 21:26680325-26680347 TATGCTACCCAGAATGTGGCTGG + Intergenic
1177961533 21:27672676-27672698 TCATATCCCCAGAATGGGGCAGG + Intergenic
1178360500 21:31945329-31945351 TAAGATGCCCAGGAAGAGGGGGG - Intronic
1179899729 21:44383390-44383412 TGAGAAGCCCAGCATCGGGCGGG - Intronic
1179908302 21:44435381-44435403 GAATATGCCCGAAATGGGGCAGG + Intronic
1180126067 21:45791032-45791054 TGGGATGCCCAGGATGGGGGTGG + Intronic
1180782416 22:18528688-18528710 GAAGAGTCCTAGAATGGGGCTGG + Intronic
1183397392 22:37579854-37579876 AAAGATGAACAGAGTGGGGCAGG + Intronic
1183608080 22:38878624-38878646 TAAGATGCCCAGAATTCTGCAGG - Intergenic
1183844576 22:40530591-40530613 TAAGATGGACATTATGGGGCCGG - Intronic
1185016477 22:48346149-48346171 AACGCTGCCCAGAATGGGGAGGG + Intergenic
949407677 3:3731852-3731874 GAATATACCCAGAATAGGGCAGG - Intronic
952498274 3:33935189-33935211 TAAGATGTCCAGAATAGGCCGGG - Intergenic
952735756 3:36690154-36690176 TAAAGTGCCCAGCATGAGGCAGG - Intergenic
953377072 3:42437653-42437675 TAAAATGTCCAGAATAGGCCAGG + Intergenic
953430503 3:42835896-42835918 TAAGATGCCCAGGCTCGGGTGGG - Intronic
954279247 3:49564296-49564318 GAAGATGCCCAGCATGAGGCTGG - Intronic
954316783 3:49805795-49805817 TGAGGGGCCCAGAATGGGGCTGG + Intronic
955351273 3:58195110-58195132 AAAGATGCCCAGGATCTGGCTGG - Intronic
955572026 3:60318086-60318108 TAAGATGCCCAGAATGGGGCGGG - Intronic
956204076 3:66738127-66738149 TAGGATGGCCAGAAAGGGGATGG + Intergenic
956425887 3:69134642-69134664 TGAGATGTCCAGAATGCGGAGGG + Intergenic
956865565 3:73365639-73365661 TAAGATACCCACAATAGGCCAGG - Intergenic
957963616 3:87293257-87293279 TAAAAGGCCCAGGATGAGGCTGG - Intergenic
959784999 3:110285337-110285359 TAAGAAACCCAGAATAGGCCTGG - Intergenic
959874189 3:111362474-111362496 TAATTTGACCAGAATGGGGTTGG - Intronic
963960346 3:151302990-151303012 TATGATGCCCAGGTTGTGGCAGG + Intronic
964098803 3:152964110-152964132 TAATAGCCCCAGAATAGGGCTGG - Intergenic
964722620 3:159782234-159782256 TTAGATGCCCATACTGGGGCAGG + Intronic
965921314 3:173918339-173918361 TAAAATGCATAGAATGGGCCGGG + Intronic
966017607 3:175161502-175161524 TAAAATTCCCAGAATGGAGCAGG + Intronic
968576391 4:1368157-1368179 GAAGATGCCCAGGAGGGGTCCGG - Intronic
969245617 4:5930831-5930853 CATGATGCCCAGCATGGGCCTGG + Intronic
971054810 4:22900061-22900083 TATGATGCCCAGAATCCTGCAGG + Intergenic
971823188 4:31586308-31586330 TAGAAAGCCCAGGATGGGGCCGG + Intergenic
972066509 4:34952968-34952990 TTATAGGCACAGAATGGGGCAGG - Intergenic
972590037 4:40476937-40476959 TAAAAAGACCAGAATGGGCCGGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
978731453 4:112031877-112031899 TAAGAAGCCTAGAATGGGGGAGG - Intergenic
980749566 4:137070803-137070825 TAAAATGCTCAGTAGGGGGCAGG + Intergenic
985920554 5:2968638-2968660 TAAGATGACCAGTATAGAGCAGG - Intergenic
986622641 5:9691659-9691681 TAAAATGGCCAGGCTGGGGCTGG + Intronic
988158055 5:27480034-27480056 ACAGAGGCCCAGCATGGGGCGGG + Intergenic
990948118 5:61270720-61270742 GAAGGTGCCCAGCTTGGGGCAGG + Intergenic
991147552 5:63324385-63324407 CACGTTGCCCAGATTGGGGCTGG + Intergenic
991499474 5:67262803-67262825 AAATATGCCCTGAAAGGGGCAGG + Intergenic
993495171 5:88600662-88600684 AAAAAAGCCCAGAATGTGGCCGG - Intergenic
996396149 5:123016235-123016257 TAAGATACCTAGATTTGGGCAGG + Intronic
997502674 5:134389241-134389263 TAAGATGACCAGAACTGGCCTGG - Intronic
997881658 5:137597452-137597474 TAAAATGCCCAGAAAGTGGAAGG - Intronic
998409789 5:141900921-141900943 TAAGATGCCCAGCAGAGGCCGGG - Intergenic
998798810 5:145847213-145847235 AAAAATGCCTAGAATGGGGTAGG - Intergenic
999264113 5:150255418-150255440 GAAGGTGCCCAGGATGAGGCTGG + Intronic
1000005506 5:157179805-157179827 TAAGAATCTCAGAATGGGGGAGG + Intronic
1000482843 5:161801284-161801306 TAAGATTCACCAAATGGGGCTGG - Intergenic
1002187526 5:177461391-177461413 TAAGAAGGCCAGAAGGGGCCGGG - Intronic
1005833276 6:29687956-29687978 TAAGATGTTAACAATGGGGCTGG - Intergenic
1005868795 6:29957856-29957878 AACGATGCCCATGATGGGGCTGG - Intergenic
1006054909 6:31377221-31377243 TCAGCAGCCCAGAATGGTGCTGG + Intergenic
1006983497 6:38163314-38163336 TCAGATGCCCTGAAGTGGGCAGG - Intergenic
1008015333 6:46512219-46512241 TAAGATGCTCAGACAGGGCCTGG - Intergenic
1008893361 6:56522449-56522471 TAAGATCCCCAGTAAGGGGAAGG - Intronic
1010402710 6:75465192-75465214 AAAGAAGCCCAGAAAGGAGCAGG + Intronic
1011472729 6:87723953-87723975 AAAGAGACCCAGAATGGGGCTGG - Intergenic
1016558782 6:145370683-145370705 TCAGCTGCCCAGACTTGGGCAGG - Intergenic
1018219334 6:161562674-161562696 TGAGATGAGCAAAATGGGGCAGG - Intronic
1020733588 7:11916501-11916523 AAAAATGCACAGATTGGGGCTGG + Intergenic
1022128207 7:27378327-27378349 TGAGATGCCCAGACTCGGGAGGG + Intergenic
1022283924 7:28937396-28937418 CAAGATGCCTAGTACGGGGCTGG + Intergenic
1024258359 7:47556469-47556491 TCAGATGCCCAGACTCAGGCCGG - Intronic
1024388204 7:48777426-48777448 TTAGATTCCCAGAATTTGGCAGG + Intergenic
1024503130 7:50134965-50134987 TAAGAAGACGAGAACGGGGCAGG - Intronic
1032475835 7:132211035-132211057 CACGCTGCCCAGACTGGGGCTGG + Exonic
1033653340 7:143358255-143358277 TAAGATGCCTAGAAAGGGATAGG - Intronic
1034195158 7:149240417-149240439 TGACATTCCCAGAATGGGGATGG - Intronic
1034463805 7:151213784-151213806 TAAGATAACCAGCAAGGGGCTGG + Intronic
1036723304 8:11198866-11198888 TAAGATGCCAGGAATGAAGCAGG - Intronic
1037913052 8:22755776-22755798 CCAGATGCCCAGGATAGGGCGGG - Intronic
1041328405 8:56695673-56695695 TAAGAACCCCAGAAAGTGGCTGG - Intergenic
1045417190 8:101979126-101979148 GAAGATTCCAAGAGTGGGGCTGG + Intronic
1047664791 8:127079634-127079656 AAAGATGCCAAGAATGGGGAAGG + Intergenic
1048334675 8:133493509-133493531 TCAGATGTACAGAATGGGGCAGG + Intronic
1049274160 8:141711415-141711437 TAAGAGGCTCAGACTGGAGCAGG - Intergenic
1050220278 9:3380221-3380243 TAATTTGCCCATAATGAGGCTGG - Intronic
1050458638 9:5857983-5858005 TCAGGTGCCCAGGATGTGGCAGG + Intergenic
1050640892 9:7666532-7666554 TAATATGCCTGGAGTGGGGCTGG + Intergenic
1055459165 9:76500987-76501009 TGAAGTGCTCAGAATGGGGCAGG + Exonic
1056468948 9:86886548-86886570 TGAGATGTCCAGTATGGGACAGG - Intergenic
1058001330 9:99869092-99869114 TTAGAGGCCCAGCATGGGGATGG - Intergenic
1059295233 9:113264577-113264599 TAAGATGTCCATATTGTGGCCGG + Intronic
1059323123 9:113484483-113484505 TAAAATGCCCAGCCTGGGGCTGG + Intronic
1062392118 9:136338031-136338053 TCAGATTCCCAGCTTGGGGCGGG - Intronic
1185569823 X:1126400-1126422 TAAGATGCTAAGAATAGGCCAGG - Intergenic
1186247888 X:7633527-7633549 TAAAAGACACAGAATGGGGCCGG + Intergenic
1187567913 X:20470776-20470798 AAAGATGCCCAGAATGGTCATGG + Intergenic
1188070698 X:25715027-25715049 ATAGATGCCCAAAATGAGGCAGG + Intergenic
1188184487 X:27097184-27097206 GAATATGCCCAGAGAGGGGCAGG + Intergenic
1188502194 X:30839650-30839672 TAGGATGCTGATAATGGGGCAGG + Intronic
1189480309 X:41387559-41387581 TAAAATGTCCAGAATAGGCCGGG + Intergenic
1189561472 X:42195446-42195468 TAGGAAGCACAGAATGGGGGTGG + Intergenic
1190454205 X:50610185-50610207 TGAGCTGACCAGAATGGGGGAGG - Intronic
1192167235 X:68833649-68833671 TAAGGAACCCAGAATGTGGCTGG - Intronic
1195016293 X:100785007-100785029 TAACATGGACAAAATGGGGCAGG - Intergenic
1197869836 X:131054282-131054304 TAAAATGCCAAGAGTGAGGCTGG - Intergenic