ID: 955575525

View in Genome Browser
Species Human (GRCh38)
Location 3:60358653-60358675
Sequence CTGATAACACAGATACAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955575525 Original CRISPR CTGATAACACAGATACAACA TGG Intronic
909292612 1:73902706-73902728 CTGATGACATATATGCAACATGG - Intergenic
909906448 1:81201699-81201721 ATGACAACACAGTTACAAGATGG - Intergenic
910774100 1:90857774-90857796 CAGAGAACACAGAAATAACAGGG + Intergenic
910781523 1:90940816-90940838 CTGATAACAAAAATAAAACTTGG + Exonic
917613741 1:176716060-176716082 CCGATAACACAAATACAATGAGG + Intronic
921472116 1:215561990-215562012 CTGATAACACAGTCACCAAAAGG - Intergenic
921956478 1:220989802-220989824 CTGATAACACAGAAACTCAAGGG - Intergenic
923511039 1:234653825-234653847 CAGATAACCCAGTTAAAACATGG + Intergenic
924015772 1:239720112-239720134 GTAAAGACACAGATACAACACGG - Intronic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
924618646 1:245639289-245639311 CTGATACTACAGATACACAAAGG - Intronic
1064575257 10:16738903-16738925 ATGAGAACACAGGGACAACAGGG - Intronic
1064777354 10:18793483-18793505 GTAATTACACTGATACAACAAGG - Intergenic
1066331915 10:34432719-34432741 TTGATCACTCAGATTCAACATGG - Intronic
1066672201 10:37852311-37852333 CTGTTGACACATATACAACCCGG + Intronic
1068991130 10:63152025-63152047 CTGATAACTCTGATACAATTGGG - Intronic
1069457746 10:68567127-68567149 CTCAAACCACAGATACCACAAGG + Intronic
1070732080 10:78836968-78836990 CAAATGACACAGATACAGCAGGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1073664434 10:105514330-105514352 CTGGTAAAACAGATGCAACGTGG + Intergenic
1074318236 10:112378088-112378110 GTGAGACCACAGATACTACATGG + Intronic
1074546815 10:114407761-114407783 CTGATAAGACAGAAACACGAGGG + Intergenic
1081416988 11:42827798-42827820 CTGATTCCAGAGATAGAACAGGG + Intergenic
1081566487 11:44264067-44264089 CTGAGAACACAGATGCCACAAGG - Exonic
1081689033 11:45063807-45063829 CAGAAAACACACATATAACAAGG + Intergenic
1082662595 11:55931043-55931065 CTGATACCACAGAAATATCAAGG - Intergenic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1087371864 11:97294195-97294217 CTTATAACCCACATGCAACAGGG - Intergenic
1087989122 11:104725893-104725915 CTGATCAAACAAATACAGCATGG - Intergenic
1088039616 11:105362679-105362701 TTAAAAACACAGAAACAACAGGG - Intergenic
1088928015 11:114321753-114321775 CTGATAAAGCAGAGAGAACATGG - Intergenic
1092896350 12:13014587-13014609 CTGATCACACAGATATTAAAAGG - Intergenic
1094228184 12:28070792-28070814 CTGATACCACAGAAATAAAAAGG + Intergenic
1095187466 12:39217469-39217491 CTGTTAACACTGATTCCACAGGG - Intergenic
1096062659 12:48715123-48715145 ATGACAACACACATACAAAAAGG + Intronic
1096985564 12:55754054-55754076 CTGATAAGACAGGGAAAACATGG - Exonic
1098027697 12:66222488-66222510 CTGATACCACAGAAACACTAAGG - Intronic
1098130229 12:67342392-67342414 GTGATAACACAGAAATAAAAAGG - Intergenic
1099289431 12:80757730-80757752 CTGATAACACAGAAATACAAAGG + Intergenic
1102356944 12:112245310-112245332 CTCTTAAGACAGATACAAAATGG - Intronic
1103034081 12:117642213-117642235 CTGGGAACACAGATATAAAAGGG - Intronic
1105299782 13:19122103-19122125 CTGATAACACAGATATATGAAGG - Intergenic
1106979726 13:35264083-35264105 CTGATAACACAGAAATACGAAGG + Intronic
1107743573 13:43480674-43480696 CTGATATCACAGAAATAAAAAGG + Intronic
1108103016 13:46978243-46978265 CTGATGCCACAGAAACAAAAAGG + Intergenic
1108948354 13:56053531-56053553 CTGATAACAGAGAAAAAACAAGG + Intergenic
1109153635 13:58876242-58876264 TTGATTACACACATAGAACATGG + Intergenic
1109243673 13:59925843-59925865 CTGATACCACAGAAATAAAAAGG - Intronic
1109563363 13:64078704-64078726 CTGAAAACACAGAGACACCCCGG + Intergenic
1109601171 13:64630350-64630372 TTGATAACAGAGAAAGAACACGG - Intergenic
1110113780 13:71785203-71785225 CAGATGACAAAGATACAACCGGG - Intronic
1110181067 13:72617362-72617384 CTGATGACAAACATAGAACAGGG + Intergenic
1116441896 14:44963064-44963086 CTGAGAACGCTTATACAACAAGG + Exonic
1117238609 14:53804789-53804811 CTGCTATCACAGATAAAGCAAGG - Intergenic
1118213812 14:63789466-63789488 CTGATAAATCAAATACAAGATGG - Intergenic
1118509718 14:66458382-66458404 CAGACACCACAGACACAACAGGG - Intergenic
1118784837 14:69037489-69037511 CTGATGACACAGATTCAAACAGG - Intergenic
1119062679 14:71492184-71492206 CTGATGGCACAGTTACAGCAAGG + Intronic
1122113657 14:99517404-99517426 CTGATAGCACAGAGGCAAGAGGG + Intronic
1123144667 14:106116942-106116964 CTGCAAACACAGAGACAACCTGG + Intergenic
1123175285 14:106410795-106410817 CTGCAAACACAGAGACACCAAGG + Intergenic
1123186176 14:106518883-106518905 CTGCAAACACAGAGACACCAAGG + Intergenic
1123189716 14:106557249-106557271 CTGCAAACACAGAAACACCAAGG + Intergenic
1123200420 14:106658030-106658052 CTGCAAACACAGAGACACCAAGG + Intergenic
1202943404 14_KI270726v1_random:4984-5006 CTGCAAACACAGAGACACCAAGG - Intergenic
1123459561 15:20457231-20457253 CTGAAATCACAGATCCAACGTGG + Intergenic
1123658500 15:22543190-22543212 CTGAAATCACAGATCCAACGTGG - Intergenic
1124020448 15:25917217-25917239 CTGATACCACAGAAATAAAAAGG - Intergenic
1124312365 15:28637682-28637704 CTGAAATCACAGATCCAACGTGG - Intergenic
1127613490 15:60659711-60659733 CTGATAAATCACAGACAACAAGG + Intronic
1128005931 15:64240855-64240877 CTGATAAAGCAGATACACAAAGG + Intronic
1128917952 15:71583232-71583254 CTGATATGACAGAAACAAAAAGG - Intronic
1130039761 15:80396307-80396329 CTGGTTACTCTGATACAACAGGG - Intronic
1130718384 15:86360513-86360535 CTGATACCAAAGAGACAAAAAGG - Intronic
1131767716 15:95698404-95698426 CTGATAACACAGATACAAGATGG - Intergenic
1131955095 15:97727079-97727101 CTGAGATCCCAGATACTACAGGG - Intergenic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1135291974 16:21247620-21247642 CTGATAATACAGATACTAAGGGG - Intronic
1136795028 16:33009295-33009317 CTGCAAACACAGAGACAACCTGG - Intergenic
1136874884 16:33845087-33845109 CTGCAAACACAGAGACAACCTGG + Intronic
1137477899 16:48826663-48826685 AAGAGAACACATATACAACATGG - Intergenic
1139028848 16:62854374-62854396 CTGATGGCACAGCTACAATAGGG + Intergenic
1139334534 16:66222598-66222620 GTGAAAACACAGACACAAGATGG + Intergenic
1140679381 16:77369173-77369195 CTGATACCACAGAAATAAAAAGG - Intronic
1141349827 16:83284055-83284077 TTGATAACACACAGACTACAGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147397060 17:40152062-40152084 CTCATCACACACATACAAAAAGG - Intronic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1155439189 18:25843549-25843571 CAGATAGTACAGATATAACAAGG + Intergenic
1156060623 18:33070926-33070948 CACATTACAAAGATACAACAGGG + Intronic
1156930008 18:42630064-42630086 CTGATGATACAGATATACCAAGG - Intergenic
1157886683 18:51374463-51374485 CTGATACCACAGAAACTAAAAGG + Intergenic
1158170794 18:54596908-54596930 CTGATGACACAAAGACAGCAGGG - Intronic
1159064287 18:63552501-63552523 CTAATAACACAGATTCAAATAGG - Intergenic
1159950032 18:74476205-74476227 CTCATCACACACATAAAACAAGG + Intergenic
1163362770 19:16858284-16858306 CTAATATCACAGAAATAACAGGG - Intronic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1166598751 19:44074510-44074532 CTGATCACCCAGATACCACCAGG + Intronic
1167965943 19:53146698-53146720 CTGATACCATAGATACACAAAGG + Intronic
926254476 2:11178296-11178318 ATTGTAACACAGATACAACAGGG + Exonic
927954149 2:27196558-27196580 ATGACAACACAAATACAACTTGG + Intergenic
928740554 2:34347227-34347249 CTGATAAAACAGAATCTACATGG + Intergenic
930860516 2:56067050-56067072 CTGATACCACAGAAATAAAAAGG - Intergenic
934043707 2:88152648-88152670 CTGATAACACAGAAATTAAAAGG + Intergenic
936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG + Intergenic
938952822 2:136271886-136271908 CTGATATCACAGAAATACCAAGG + Intergenic
939733610 2:145816025-145816047 GTGATGAGACAGATGCAACAGGG + Intergenic
940151467 2:150607197-150607219 CTGATAACATAAATAAAACTAGG - Intergenic
940733908 2:157427597-157427619 CTGATAACAGAGAAAGAAAATGG + Intronic
943552701 2:189359883-189359905 CTGATAACACAGAAATACAAGGG - Intergenic
943778006 2:191788479-191788501 GTGATAACACAGCTCCAACTTGG - Intergenic
943895386 2:193351205-193351227 CTAATAAAACATGTACAACATGG + Intergenic
943901096 2:193437682-193437704 ATGTTAACACAAATACAATAAGG + Intergenic
945174330 2:207026947-207026969 CTGATAACACAGAAATACAAAGG + Intergenic
1168945495 20:1752367-1752389 CTGATACCACAGAAATACCAAGG + Intergenic
1173952408 20:47003853-47003875 CTGAAAACACAGCTACAAAGTGG - Intronic
1175747728 20:61471340-61471362 CTGATAACACAGAAACGCAAAGG - Intronic
1176728970 21:10470784-10470806 CCGATAGCACAGATACACAATGG - Intergenic
1180018322 21:45102242-45102264 CTGATAACAGACAGACACCAAGG - Intronic
1181505109 22:23349812-23349834 TTGATAACACAGAAACACAAAGG - Intergenic
1181710377 22:24681881-24681903 TTGATAACACAGAAACACAAAGG - Intergenic
1181918850 22:26303385-26303407 CTGATATTAGAGATACAAAAAGG + Intronic
951404760 3:22282062-22282084 CTGATAACACAGAAATACAAGGG - Intronic
951706445 3:25548690-25548712 CTGATAACACATATTAAAAAAGG - Intronic
952523996 3:34190569-34190591 CTGTTTTCACAGAGACAACACGG + Intergenic
953134114 3:40167969-40167991 CTAAAAACTCTGATACAACAAGG - Intronic
953687110 3:45086582-45086604 CTGAAAACTAAGATACAACCTGG - Intronic
955575525 3:60358653-60358675 CTGATAACACAGATACAACATGG + Intronic
957810123 3:85211104-85211126 CTGATAACACAGAAATTAAAAGG - Intronic
958005717 3:87808432-87808454 CTGATATCACAGATACACAAAGG - Intergenic
959300416 3:104592511-104592533 ATGATAACATACATACAACATGG - Intergenic
961084935 3:124058721-124058743 GTGAAAAGACAGATACTACAGGG - Intergenic
961871396 3:129991105-129991127 CTGATAAAACAGAGGCACCATGG + Intergenic
962352807 3:134667956-134667978 TTGATAACAGGGAAACAACAGGG + Intronic
964965289 3:162484420-162484442 CTGATCACACAGAAATAAAATGG - Intergenic
965688454 3:171330363-171330385 CTGCTAACAAAGATAGAAGAAGG + Intronic
965811534 3:172595905-172595927 GTAATAACACAAAAACAACATGG - Intergenic
966744762 3:183265005-183265027 CAGATATCTCAGATACAACCTGG - Intronic
968344770 3:197992462-197992484 CTGATACCACAGAAACACAAAGG + Intronic
971484184 4:27142608-27142630 CACATAACACATCTACAACATGG + Intergenic
972251395 4:37306157-37306179 CTGATACCACAGACACAAAAAGG - Intronic
973003796 4:44985601-44985623 CTCATTACACAGAGACAGCAGGG - Intergenic
973043761 4:45509021-45509043 CTGATACCACAGATATAAAAAGG - Intergenic
974685598 4:65223824-65223846 CAGATTACACTGATTCAACATGG - Intergenic
975159479 4:71109448-71109470 CTGATCACAGAGATGCAACAGGG - Intergenic
975964133 4:79949201-79949223 ATGAGAACACAGAAATAACATGG + Intronic
979735607 4:124079016-124079038 CTGATAGCACAGAAATAAAAAGG + Intergenic
981180629 4:141739292-141739314 CTGATACCACAGAAATAAAAAGG + Intergenic
981276612 4:142906041-142906063 TTGGTAACACAGATATACCAAGG - Intergenic
981743139 4:148024014-148024036 CTGGCAACACTGAAACAACAGGG - Intronic
983176883 4:164599393-164599415 CTGATACCACAGATATACAAGGG - Intergenic
983588260 4:169379422-169379444 CTGATAACTCAGAAATAAAAAGG + Intergenic
985019859 4:185676012-185676034 TTATTAACACAGATACAAAAAGG + Intronic
986890852 5:12303227-12303249 CTGATAACACAGAAATACAAAGG + Intergenic
988236626 5:28553842-28553864 CTGATAACACAGAAACTCAAAGG - Intergenic
988413616 5:30917606-30917628 CTGATCACACACAAACAAAATGG + Intergenic
989184989 5:38615174-38615196 CTGATAAGAGTGACACAACAGGG + Intergenic
989566590 5:42907215-42907237 GTGAGAACACAGCTACAACATGG + Intergenic
989567970 5:42919949-42919971 GTGAGAACACAGCAACAACATGG - Intergenic
989574264 5:42974826-42974848 GTGAGAACACAGCTACAACATGG - Intergenic
990053231 5:51534392-51534414 CTGATACCACAGAAATAAGAAGG - Intergenic
990613689 5:57485603-57485625 CAGATAACAGGTATACAACACGG + Intergenic
990967071 5:61460491-61460513 CTGTTAACATACATAGAACATGG + Intronic
991094795 5:62728385-62728407 CTGAAACCACAGCAACAACATGG + Intergenic
991387357 5:66105137-66105159 CTGATATCACAGAAACAAAAAGG + Intergenic
991557759 5:67914698-67914720 CTGAGAACACAATTACACCATGG + Intergenic
991708028 5:69378666-69378688 ATAAAAACACATATACAACAAGG - Intronic
995446190 5:112246707-112246729 CAGATAACACAGACAAAATAGGG - Intronic
996451316 5:123628909-123628931 CTGATAACACAGAAATATAAAGG + Intergenic
996731786 5:126724165-126724187 CTGAAATCACAGAGAAAACAAGG + Intergenic
996975993 5:129435348-129435370 CTGATACCATTGATAGAACAAGG - Intergenic
998276140 5:140754818-140754840 CTGATACCACAGAAATAAAAAGG - Intergenic
1001364877 5:171126646-171126668 CTGATAGCACAGAAATACCAAGG + Intronic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1004844052 6:19619091-19619113 CTTATAACAAAGATGCAAGAAGG + Intergenic
1009534890 6:64869139-64869161 CTTATCACTCAGATACATCAAGG + Intronic
1010780162 6:79936535-79936557 TTGTTAACAGAGATACAGCAAGG - Intronic
1010799496 6:80158607-80158629 CTGATTGCACAGATCCCACAGGG - Intronic
1011227855 6:85127393-85127415 CTCATAACACAATTACAGCAAGG + Intergenic
1012257663 6:97052290-97052312 CTGTCAACTCAGATACCACAAGG + Intronic
1012485564 6:99718178-99718200 CTGATAACACAGAAACGCAAAGG - Intergenic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1013470960 6:110464472-110464494 CTGATAACACAGAAACACAAAGG + Intronic
1013876567 6:114837910-114837932 CTGATAACACAGAAAATTCATGG - Intergenic
1014788970 6:125649810-125649832 ATGCTAACACAAATAAAACAAGG - Intergenic
1015700682 6:136032989-136033011 CTTAGAAAACAGCTACAACAAGG - Intronic
1016236942 6:141879215-141879237 CTGAAAACATAGATATTACAAGG - Intergenic
1017829521 6:158113452-158113474 CTGATTCCACAGGTACCACATGG + Exonic
1021260226 7:18447124-18447146 ATGATACCACAGATACACTAGGG - Intronic
1021288101 7:18807264-18807286 CTGATACCACAGAAATAAAAAGG - Intronic
1022189545 7:28004013-28004035 CTGCCAACACACATACAAAAAGG + Intronic
1022402577 7:30053900-30053922 ATGAAAACACACATAAAACAAGG - Intronic
1023384059 7:39637322-39637344 CTGATAATAAAGATCAAACAAGG - Intronic
1023525613 7:41099516-41099538 CAGAATTCACAGATACAACAGGG + Intergenic
1023547183 7:41330488-41330510 CTGATTACACAGAAACAAAAAGG + Intergenic
1023721533 7:43100084-43100106 CTAATAACACACATCCAAAAAGG + Intergenic
1023740337 7:43275031-43275053 CTGATAACTCAGTGACACCATGG - Intronic
1024729502 7:52238789-52238811 CAGATAAGACAGGGACAACAAGG - Intergenic
1025018270 7:55459685-55459707 CTGATACCACAGAAACACAAAGG - Intronic
1025095022 7:56090011-56090033 CAGAGAACACAGTCACAACAAGG - Intronic
1027685118 7:81270164-81270186 TTGAAAACACAGAATCAACAAGG - Intergenic
1027974722 7:85137415-85137437 CACATAACACAGACACTACAGGG + Intronic
1028119950 7:87046083-87046105 CTGATAAAAAAAATTCAACAAGG + Intronic
1028198058 7:87930081-87930103 CTGATAACACAGAAATACAAAGG + Intergenic
1029006620 7:97216780-97216802 CTAATAACACAAAAACAAAAAGG - Intergenic
1029013260 7:97285405-97285427 CTGATAATACAAATAGAATATGG + Intergenic
1029806219 7:102999727-102999749 CTGATACCACAGAGATACCAAGG - Intronic
1030782035 7:113612669-113612691 CTGATAACACAGTTAAGAAATGG - Intergenic
1031287533 7:119888926-119888948 CTGATACCACAGAAATACCAAGG - Intergenic
1031567061 7:123313525-123313547 CTGATAAAACAAATACAGAATGG - Intergenic
1032526577 7:132582317-132582339 CTGGTAACACATTTACAAGATGG + Intronic
1032919565 7:136529897-136529919 CTGATAACACTGAGACTAGAAGG + Intergenic
1034096664 7:148415102-148415124 CTGAGAACAGAGAAACAAAAAGG - Intronic
1035913314 8:3593249-3593271 CTGAACACACAGACACAACGCGG - Intronic
1036073484 8:5468435-5468457 CTGATAACTCAGTTTCAAGATGG + Intergenic
1036295472 8:7531804-7531826 CTGATGACAAAGATAGAACAAGG - Intergenic
1036327097 8:7789215-7789237 CTGATGACAAAGATAGAACAAGG + Intergenic
1037095633 8:14983042-14983064 CTGATAATACAAATACCTCAAGG + Intronic
1037384095 8:18318947-18318969 CTGACAACACAGAGTCTACAGGG + Intergenic
1038538002 8:28368422-28368444 CTGAGAACACAGGTTCAAAAAGG + Intronic
1038660810 8:29495078-29495100 CTGATAACACAGTTGAAAGAAGG + Intergenic
1041173641 8:55170986-55171008 CTGATACCAAAAATACCACAGGG - Intronic
1042981028 8:74528475-74528497 CTGATAACATAGATATACAAAGG + Intergenic
1045041970 8:98233834-98233856 ATGTTAACAAAGATACAAAAAGG - Intronic
1045876038 8:106981565-106981587 CAGGTAAAACAGATACAACTTGG - Intergenic
1046431147 8:114129832-114129854 CTGATACCACAGAAATAAAAAGG - Intergenic
1047844256 8:128788909-128788931 CTGTTATCACAAATACATCATGG - Intergenic
1051368505 9:16338544-16338566 CTGTGTACACAGATACCACACGG - Intergenic
1051426494 9:16937202-16937224 CTGATACCACAGAAACACAAAGG + Intergenic
1051937450 9:22460297-22460319 CTTATATTACAGATACAAGATGG - Intergenic
1054801216 9:69350692-69350714 GTGAGAACAAAGATACATCAAGG - Intronic
1055666161 9:78555203-78555225 CTGATAAAAGAGATATAAGAAGG + Intergenic
1056918427 9:90764345-90764367 CTGATTACATAGATATAACTGGG - Intergenic
1059097700 9:111436323-111436345 CTGATGACACAGACACAGTAAGG + Intronic
1059656386 9:116361408-116361430 CTGGTAACACAGATAAAGCGTGG - Intronic
1061353865 9:130088189-130088211 CTGAGATCAGAGAGACAACAGGG - Intronic
1203585278 Un_KI270746v1:63286-63308 CCGATAGCACAGATACACAATGG + Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1186556386 X:10564113-10564135 GTGAGAACACAGATAAAGCATGG - Intronic
1188401749 X:29754220-29754242 CTGATAACTCAGATTCATCCTGG + Intronic
1188579478 X:31692590-31692612 CTGATAACACAGAAATACAAAGG + Intronic
1188767160 X:34108133-34108155 CTGATACCACAGAAACTAAACGG - Intergenic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1194570960 X:95554103-95554125 CTGGTTACACAGACACAACCAGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196557252 X:117102484-117102506 ATGGTACCACAGATACAAAATGG + Intergenic
1197030346 X:121805501-121805523 CTGATACCACAGACACACAAAGG - Intergenic
1198190306 X:134298116-134298138 CTGATACCACAGAAATAAAAAGG + Intergenic
1198866705 X:141130714-141130736 TTGACAACAAAGCTACAACATGG - Intergenic
1199656746 X:150003833-150003855 CTAATAACATGGATACCACAAGG + Intergenic