ID: 955575751

View in Genome Browser
Species Human (GRCh38)
Location 3:60361033-60361055
Sequence AATACTGGTGTAATACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955575744_955575751 22 Left 955575744 3:60360988-60361010 CCCCACAAATTCATATACCTCCC 0: 1
1: 0
2: 1
3: 30
4: 334
Right 955575751 3:60361033-60361055 AATACTGGTGTAATACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 100
955575748_955575751 2 Left 955575748 3:60361008-60361030 CCCACTGCTTAGCTTATCTATTT 0: 1
1: 0
2: 0
3: 8
4: 223
Right 955575751 3:60361033-60361055 AATACTGGTGTAATACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 100
955575745_955575751 21 Left 955575745 3:60360989-60361011 CCCACAAATTCATATACCTCCCA 0: 1
1: 0
2: 0
3: 22
4: 349
Right 955575751 3:60361033-60361055 AATACTGGTGTAATACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 100
955575747_955575751 5 Left 955575747 3:60361005-60361027 CCTCCCACTGCTTAGCTTATCTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 955575751 3:60361033-60361055 AATACTGGTGTAATACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 100
955575746_955575751 20 Left 955575746 3:60360990-60361012 CCACAAATTCATATACCTCCCAC 0: 1
1: 0
2: 1
3: 42
4: 770
Right 955575751 3:60361033-60361055 AATACTGGTGTAATACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 100
955575749_955575751 1 Left 955575749 3:60361009-60361031 CCACTGCTTAGCTTATCTATTTC 0: 1
1: 0
2: 1
3: 21
4: 251
Right 955575751 3:60361033-60361055 AATACTGGTGTAATACATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955575751 Original CRISPR AATACTGGTGTAATACATCC TGG Intronic
905327324 1:37164307-37164329 AATACTGGTGAAATGAATCAAGG - Intergenic
907157390 1:52346914-52346936 AATGCTGATGGAATACACCCAGG + Intronic
912187527 1:107296239-107296261 AATACTGATATCATTCATCCAGG - Intronic
913501339 1:119475338-119475360 AATCATGCTGTGATACATCCAGG - Intergenic
914909610 1:151773998-151774020 AATACTGCTGTGTTACTTCCAGG - Exonic
917606751 1:176639015-176639037 AATACTTGGTTAATAGATCCTGG + Intronic
918775608 1:188626060-188626082 GATTCTGGTGTGATAGATCCTGG + Intergenic
920262904 1:204701861-204701883 AACATTGGTCTAATACAGCCAGG - Intergenic
920263401 1:204704779-204704801 AACATTGGTCTAATACAGCCTGG - Intergenic
1067397583 10:45936596-45936618 AATATTTGCGTAATACAACCTGG + Intergenic
1067865900 10:49905689-49905711 AATATTTGCGTAATACAACCTGG + Intronic
1068396776 10:56471988-56472010 AATAAAGGTGTAATACATTTGGG + Intergenic
1074329843 10:112495092-112495114 AATACTGTGGTAAAACATTCAGG - Intronic
1086555197 11:88102122-88102144 AATAGTAGAGTCATACATCCTGG - Intergenic
1095527743 12:43148086-43148108 AATACTTGTGGAGAACATCCTGG + Intergenic
1097374731 12:58828018-58828040 AATACTGCTGTAATAAATATGGG - Intergenic
1098117260 12:67193038-67193060 AACACTGTAGTAATACTTCCTGG + Intergenic
1100608947 12:96174945-96174967 AATAGTGCTGCAATACATACAGG + Intergenic
1110896913 13:80764683-80764705 AAGACTGGAATAATACATCAAGG + Intergenic
1113137395 13:107107865-107107887 AATACTGCTGTAATAAATGTGGG + Intergenic
1121750801 14:96354157-96354179 GATACATGTGTAGTACATCCAGG + Intronic
1124358926 15:29020194-29020216 AAAAAAGGTTTAATACATCCTGG + Intronic
1125051549 15:35303939-35303961 AAAAATGGTGTAATACTGCCAGG + Intronic
1127202864 15:56676067-56676089 AAAACTGGTGGAAGCCATCCAGG + Intronic
1127888838 15:63229473-63229495 AATACTGGAGAAATACATTAAGG - Intronic
1131935056 15:97494539-97494561 AACACTGGTATAATACATTTTGG - Intergenic
1132919186 16:2375709-2375731 AATGGAGGTGTAAGACATCCAGG + Intergenic
1147548510 17:41421599-41421621 AATAATGGGGTAAGAGATCCAGG + Intronic
1149242516 17:54666816-54666838 AATAATGATGTAATACCTTCAGG + Intergenic
1153161131 18:2205817-2205839 AATACTGAAGAAATACATCCAGG - Intergenic
1155532713 18:26783446-26783468 AATAATGGTTTAACACCTCCTGG + Intergenic
1157054961 18:44216650-44216672 AATAATGGTATAAGACATCTTGG + Intergenic
1158223520 18:55175563-55175585 AATAGTGTTGTAATACAACATGG - Intergenic
1158536415 18:58312016-58312038 AATACTGATGAACTACATTCAGG - Intronic
1159370157 18:67518239-67518261 AGTTCTGGAGTAATACATTCTGG - Intergenic
1159411380 18:68080239-68080261 AATACTGTTCTAAAAAATCCAGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
927160897 2:20259725-20259747 AATAATGGTGCAATATATACTGG + Intronic
929323678 2:40578605-40578627 AATACTGAAGTAATACTTCTGGG + Intronic
930724028 2:54665342-54665364 CATGCTGGTGTAATACAGGCCGG + Intronic
931047026 2:58365777-58365799 AATAATGGTGTATTATATTCAGG + Intergenic
933334633 2:80941705-80941727 AATGCTTGTGTAATTTATCCAGG + Intergenic
935021999 2:99240640-99240662 AACACTGGGGGAATACATTCAGG + Intronic
936923543 2:117713354-117713376 AATACTGATGTAAAACTTCAGGG - Intergenic
937831964 2:126434116-126434138 AACACTTGTGTAGTCCATCCAGG + Intergenic
940781744 2:157940594-157940616 AATACTGGTTAAATACATGAAGG - Intronic
940864264 2:158801457-158801479 AATACAGGTGAAATAAATCAAGG - Intronic
941166739 2:162090923-162090945 AATACTGGTGTATTGCATTCAGG + Intergenic
943317180 2:186404287-186404309 AATACTACTGCAATAAATCCTGG + Intergenic
943963821 2:194304368-194304390 AATACTGATATGATACATGCTGG + Intergenic
1173351299 20:42247969-42247991 GATGCTGGTGTAGTACATCTTGG + Intronic
1177261797 21:18738773-18738795 AAGACTTGTGTAATACATGGGGG + Intergenic
1177281939 21:18992370-18992392 AATACTGGTCAAATTCTTCCTGG + Intergenic
1181372673 22:22430726-22430748 AATTCTGGCATGATACATCCTGG - Intergenic
1181926146 22:26360367-26360389 AATACTTCTGGAATACATACAGG + Intronic
1182265354 22:29110536-29110558 ACTACTGCTGTGATAGATCCTGG + Intronic
949608190 3:5676991-5677013 AATGCTGGTGTCATGCTTCCTGG + Intergenic
950797828 3:15524754-15524776 AACATTGGTGGAATAAATCCTGG + Intergenic
952021545 3:29027667-29027689 GACACTGGTATAATACATACAGG - Intergenic
955575751 3:60361033-60361055 AATACTGGTGTAATACATCCTGG + Intronic
963553622 3:146757884-146757906 AATACAACTGTAATAAATCCTGG - Intergenic
964620891 3:158719196-158719218 AAGACTTGTGTACTACAGCCTGG + Intronic
967709532 3:192688788-192688810 AATACTGCTGCAATACACACGGG - Intronic
973080448 4:45984842-45984864 TATTCTGGTGGAATGCATCCTGG - Intergenic
974522261 4:62997114-62997136 AATATTGTTGTAAATCATCCAGG + Intergenic
975870493 4:78775105-78775127 AATATGGGTGTAAAACATTCAGG - Intergenic
986860194 5:11918582-11918604 AACAATGGTATAATAAATCCAGG + Intergenic
989661192 5:43799358-43799380 AATTCTGGTGTAATAAGACCTGG - Intergenic
994529953 5:100956696-100956718 AATACTCATGTACTACATCAAGG + Intergenic
997710992 5:136004624-136004646 AACACTGCTGTAATAAATCTTGG - Intergenic
998421928 5:141995388-141995410 AATCCTTTTGAAATACATCCAGG + Intronic
1000721309 5:164711010-164711032 AATACTGCTGTCATACATATCGG + Intergenic
1001172919 5:169438402-169438424 AACACTTGGGTAATACATCTTGG - Intergenic
1006431244 6:33998090-33998112 ACTACAGGTGTGTTACATCCAGG + Intergenic
1010323930 6:74543693-74543715 AATTTTGATTTAATACATCCTGG + Intergenic
1010485515 6:76407816-76407838 AATAGTGGTGCAATACATATGGG + Intergenic
1013057923 6:106603053-106603075 AATCCTTGTGTAATATATCTTGG - Intronic
1013340823 6:109213891-109213913 GATACTGGTGTAGTACATGGTGG + Intergenic
1015931364 6:138363393-138363415 AATATTGTTGCAATATATCCAGG - Intergenic
1024402382 7:48939831-48939853 AATTCTGGTTTAATAGATCAGGG + Intergenic
1033000681 7:137501309-137501331 AATACTGCTGTAATAAACTCAGG + Intronic
1033190422 7:139273628-139273650 AATAATGGTGTAAGTCATACTGG + Intronic
1036253298 8:7183057-7183079 AATAATGGTCAAATCCATCCAGG + Intergenic
1036364198 8:8104421-8104443 AATAATGGTCAAATCCATCCAGG - Intergenic
1036894353 8:12620771-12620793 AATAATGGTCAAATCCATCCAGG + Intergenic
1037654134 8:20868433-20868455 AATACTGGGGTAATTCGTCAGGG - Intergenic
1041459861 8:58099122-58099144 AAAACTGGTGTAATACCTCAAGG + Intronic
1046389220 8:113546498-113546520 AATACTGAAGTATTAAATCCAGG + Intergenic
1046420919 8:113981447-113981469 AAGAATGTTGTAATACAGCCAGG + Intergenic
1049079925 8:140434569-140434591 AATACTTGTGTAAAATTTCCTGG - Intronic
1050397014 9:5209573-5209595 AATACTGCTGCAATAAATACGGG - Intergenic
1055411893 9:76039250-76039272 AACACAGGTTTAATGCATCCCGG + Intronic
1061968566 9:134030598-134030620 AATACTGGCATAATGCTTCCAGG - Exonic
1185911750 X:3987605-3987627 AATACTGAACTAATACTTCCTGG - Intergenic
1186587586 X:10892458-10892480 AATATTGGTATAAGACATACAGG + Intergenic
1187177901 X:16913431-16913453 AATAATGTTGTAATAGATCATGG + Intergenic
1187840605 X:23483250-23483272 AATACTGTTGTAACACTTCTTGG - Intergenic
1188512029 X:30946665-30946687 AATACTTGTCTAATAGTTCCAGG + Intronic
1188828594 X:34868202-34868224 AAAAATGGACTAATACATCCTGG - Intergenic
1191633324 X:63349364-63349386 AACACTGCTGTAATACATACTGG - Exonic
1194042457 X:88959008-88959030 AATACTGCTGTAATAAACACGGG + Intergenic
1194223102 X:91221554-91221576 AATACTTGTGTAGTACATTGTGG - Intergenic
1194850473 X:98862792-98862814 AATACAGGTGAAAGAAATCCAGG - Intergenic
1196749531 X:119102602-119102624 AATTATGGTGTAAGCCATCCAGG + Intronic
1200559583 Y:4684974-4684996 AATACTTGTGTAGTACATTGTGG - Intergenic