ID: 955583126

View in Genome Browser
Species Human (GRCh38)
Location 3:60446457-60446479
Sequence CTGGTTTACACACACTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955583126 Original CRISPR CTGGTTTACACACACTCCAT AGG Intronic
902490741 1:16778966-16778988 CTGTTTTGGACACAATCCATTGG + Intronic
905910886 1:41653500-41653522 GTGGTCTACAAACACACCATGGG + Intronic
908126660 1:61038594-61038616 CTGGTTCACCCACACTCCCAGGG + Intronic
909265792 1:73557016-73557038 CTGATTTAAACTCACTTCATAGG - Intergenic
910899832 1:92108092-92108114 CTGGTTTTCACACAGGCCACAGG + Intronic
912503076 1:110135402-110135424 CTGGTAAACACACACAGCATGGG + Intergenic
912712218 1:111958142-111958164 CTGGCATACATACACACCATGGG + Intronic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
917443032 1:175083550-175083572 CTGGTTTTCACATATTCCATGGG - Intronic
921789345 1:219271902-219271924 CTGGTTTTCACAGACTGCCTTGG - Intergenic
923529703 1:234803569-234803591 CTGTTTTGGACACAATCCATTGG - Intergenic
1063095131 10:2902539-2902561 TTGGGATAGACACACTCCATGGG - Intergenic
1063908376 10:10803869-10803891 CTACTTTATACTCACTCCATGGG + Intergenic
1065511046 10:26478710-26478732 TTGGTCTACACTCACTCCCTTGG - Intronic
1079318953 11:19434034-19434056 CTATTTTGCACACACTCCATTGG + Intronic
1090644653 11:128757972-128757994 CTGTTTGACTCACACTCCAGGGG - Intronic
1091594907 12:1871265-1871287 CAGGTGTACACACACACCAGTGG - Intronic
1092249177 12:6882922-6882944 CTGGTTTACACACTGTTCACTGG + Intronic
1093800418 12:23365380-23365402 CTGGGTAACACAGACTCCAAAGG + Intergenic
1094330583 12:29287962-29287984 CTGGTTTAAATAAACTCCTTGGG - Intronic
1095207153 12:39451280-39451302 CTGGTTTACAGAAACTCAAGTGG - Intergenic
1095355853 12:41274168-41274190 CAGCTTTACACACACTCATTAGG - Intronic
1099498257 12:83378894-83378916 CTGGTTCACTCACACTCATTGGG + Intergenic
1100154431 12:91781131-91781153 TCTGTTTACACACAGTCCATTGG - Intergenic
1110676257 13:78249086-78249108 CTTCCTTACACACTCTCCATTGG - Intergenic
1111401411 13:87740970-87740992 CACTTTTACTCACACTCCATTGG - Intergenic
1113390303 13:109890153-109890175 CTGGTTTTGGCACACTTCATTGG - Intergenic
1114360404 14:21965923-21965945 CTGATGTACACATACTCCAGTGG + Intergenic
1120157166 14:81106224-81106246 CTGGTTTACAAACACCTCAAGGG - Intronic
1121915459 14:97833728-97833750 TTGGTTTACACACACACCTCAGG - Intergenic
1126050062 15:44677151-44677173 CTGTTTTCCACACCCTTCATTGG + Intronic
1131819487 15:96257868-96257890 CTGAGTTACAAACAATCCATGGG + Intergenic
1138873387 16:60920197-60920219 CTGCTATAAAGACACTCCATGGG + Intergenic
1142587668 17:984015-984037 CTGGTTTGGACACACTCCAGTGG - Intergenic
1143891727 17:10107477-10107499 CTGCCTTACACACAGTCCAGTGG + Intronic
1153954321 18:10083327-10083349 CTGGAGTACACACACAGCATAGG - Intergenic
1157542841 18:48524408-48524430 CTGCCTTACACACACTTAATGGG - Intergenic
1162884004 19:13682662-13682684 CTGTTTTACACACAGTCATTTGG - Intergenic
1164475295 19:28570973-28570995 TTGGTTTAAACAAAATCCATGGG - Intergenic
927211538 2:20642000-20642022 CTGCTGTATACACACACCATCGG + Intronic
929202339 2:39249459-39249481 CTGGTATATACATATTCCATTGG + Exonic
944865621 2:203858478-203858500 CTGGTGGACACATCCTCCATGGG - Intergenic
945339954 2:208640591-208640613 CTGCTTTACACAAACTCTATTGG - Intronic
948378126 2:237535685-237535707 CTGGGCCACACAGACTCCATAGG + Intronic
948381426 2:237552671-237552693 CTGCTGTCCACACACCCCATTGG + Intronic
948551334 2:238774880-238774902 GTGGACTGCACACACTCCATTGG + Intergenic
1169750938 20:8993918-8993940 CTGGGTTACCCACACTCTGTTGG + Intergenic
1178105184 21:29310616-29310638 CTTCTTTGCACACACTCCCTAGG - Intronic
1178896242 21:36561156-36561178 GTGGTTTAAACAGACTCCAAGGG + Intronic
1179396786 21:41047318-41047340 CTGGGGCACACACATTCCATGGG - Intergenic
1180027262 21:45173936-45173958 CTGGTTTAGACACAATCCATGGG - Intronic
1180728971 22:17967019-17967041 CATGTGTGCACACACTCCATGGG + Intronic
1184768712 22:46586055-46586077 CTTCCTTAGACACACTCCATAGG - Intronic
1184768848 22:46586518-46586540 CTTCCTTAGACACACTCCATAGG + Intronic
954387281 3:50250718-50250740 CTTCTTTACACAGACTCCCTGGG + Intronic
955427315 3:58805542-58805564 ATAGTTAACACACCCTCCATAGG + Intronic
955583126 3:60446457-60446479 CTGGTTTACACACACTCCATAGG + Intronic
957676611 3:83376048-83376070 CAAGTTTACACACACTCTTTTGG - Intergenic
961473831 3:127134847-127134869 CCCGTTCACACACACACCATGGG - Intergenic
965469229 3:169070001-169070023 CTGGTTTACATTCCCACCATTGG - Intergenic
968703858 4:2069275-2069297 CTGGATTACACTCCCTCCAGGGG - Intergenic
969250379 4:5964284-5964306 CTGGTTCACACTCACTCCTAGGG - Intronic
970202461 4:13623713-13623735 CTGGTTTAAACACACTAAACTGG + Intronic
970202562 4:13624738-13624760 CTGGTTTAAACACACTAAACTGG + Intronic
971066531 4:23039013-23039035 ATGGTTTAGAAAAACTCCATTGG + Intergenic
971145304 4:23969825-23969847 ATGGATTACACACTCTCCACAGG + Intergenic
973209003 4:47594178-47594200 CTGGATTTCACACTCTCCTTAGG + Exonic
974107294 4:57484829-57484851 CTGGTTTAAACACCCTCCTCAGG + Intergenic
974318541 4:60313772-60313794 GTGGTTTAAACACATTCCTTAGG - Intergenic
976328115 4:83795844-83795866 CTGGTTTACACATCTGCCATTGG + Intergenic
977786595 4:101042304-101042326 CTGGTTTTCACACACCCTCTGGG - Intronic
979086357 4:116415332-116415354 CTAATTTACACTCACTCCAACGG + Intergenic
982069242 4:151681175-151681197 TTGGTTAACACACACTCCATTGG - Intronic
985049603 4:185975678-185975700 CTGGTTTTCAAACCCTTCATTGG + Intergenic
989666111 5:43856380-43856402 CTTGTGTACACAAACTCTATAGG + Intergenic
991356899 5:65778117-65778139 CTGGTTTTAAAACTCTCCATCGG - Intronic
992406734 5:76465606-76465628 CTGGTTTATAGAAAATCCATAGG + Intronic
997817697 5:137034559-137034581 CTGGCTTTGTCACACTCCATGGG + Intronic
1003965547 6:11249146-11249168 CTGCTTTACTCAAAGTCCATTGG - Intronic
1010343131 6:74780904-74780926 CTGGCTTAAATACTCTCCATAGG - Intergenic
1011134393 6:84084764-84084786 CTGGTGCACACAAACTCAATGGG - Intronic
1012656427 6:101828258-101828280 CTGCTTTTCACACATTCCAGAGG - Intronic
1014921465 6:127218710-127218732 CAGTTTTACCCACACTCAATGGG + Intergenic
1015858678 6:137652894-137652916 GTGGTTCACACACACCCCAATGG + Intergenic
1020690188 7:11345331-11345353 CTGTTCTACACACACTTCTTAGG - Intergenic
1022646149 7:32230202-32230224 ATGGTTTTCAGACGCTCCATGGG - Intronic
1023576756 7:41636048-41636070 CTGGTGGACACACAATTCATAGG - Intergenic
1024064439 7:45720735-45720757 CTGGTTACCACAGTCTCCATGGG + Exonic
1024598889 7:50962481-50962503 CTGGTTGACTCACACTCCGCGGG - Intergenic
1027910792 7:84247698-84247720 ATGGTTTACGCACTCTCCAGTGG - Intronic
1030240976 7:107324130-107324152 CTGCTTTACACACTCTACGTAGG + Intronic
1033625393 7:143105868-143105890 ATTATTTACCCACACTCCATTGG + Intergenic
1037868330 8:22466434-22466456 CTGATTTACACACCCACCAACGG + Intronic
1040780956 8:51108692-51108714 CTGGTTTACCCACACTCCTAGGG - Intergenic
1041109801 8:54473579-54473601 CTGGTCTACACTTACTTCATAGG + Intergenic
1042712861 8:71737515-71737537 CTGTTTTAAAGACACTCCCTGGG - Intergenic
1045403631 8:101843375-101843397 GTGGTTTAAACACCCTCCAGGGG + Intronic
1046606744 8:116380129-116380151 CTGGGTTACTCACATTCCTTGGG - Intergenic
1049179144 8:141212160-141212182 CCCGTTTACACACATTCCAGTGG - Intronic
1051329682 9:16011038-16011060 TTGCTTTACATACACTCCATTGG - Intronic
1052571031 9:30224216-30224238 CTGTTTTACACACATGCAATTGG + Intergenic
1060251104 9:121987421-121987443 GTGGTGTCCAGACACTCCATAGG - Intronic
1187073603 X:15912563-15912585 GTGGTTTGCACACCCTGCATGGG - Intergenic
1188051431 X:25491667-25491689 CTGGTTTACAAAACCTCCAGTGG - Intergenic
1193078561 X:77382086-77382108 CTGGTTTAAATGCCCTCCATGGG - Intergenic
1193355376 X:80513823-80513845 CTTGTTTACACAGTCTCCCTGGG - Intergenic
1193846275 X:86475033-86475055 CTGGTATAAACACATTACATAGG - Intronic