ID: 955587658

View in Genome Browser
Species Human (GRCh38)
Location 3:60499083-60499105
Sequence ATGAGTGACCAAGGAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955587655_955587658 18 Left 955587655 3:60499042-60499064 CCTATAAATGCTTCATAGTGTTT 0: 1
1: 0
2: 0
3: 21
4: 260
Right 955587658 3:60499083-60499105 ATGAGTGACCAAGGAGTTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955587658 Original CRISPR ATGAGTGACCAAGGAGTTGA AGG Intronic
901051723 1:6428858-6428880 ATCAGTTACCAAGCAGTTAAGGG + Intronic
901191972 1:7418000-7418022 AGGAATGGCCAAGGAGGTGAGGG - Intronic
902482601 1:16719503-16719525 ATTAGTTACCAAGCAGTTAAGGG - Intergenic
902528892 1:17077659-17077681 ATGAGTGGCCACTGAGTGGAGGG + Intronic
902976868 1:20094916-20094938 AAGGGTGACCAAGTAGTTGATGG + Intergenic
906071940 1:43023254-43023276 ATGAGTGATTAAGGAGTTTGAGG + Intergenic
906524023 1:46484055-46484077 AAGAGTGAACAAGGAGGTGGGGG + Intergenic
907865680 1:58397172-58397194 TTGAGGGACAAAGGAGTTGTGGG - Intronic
908514825 1:64881773-64881795 ATGAGGGACCAAGGAGCTGCTGG - Intronic
911429917 1:97772770-97772792 ATGAGGGAACAAGGTGCTGAAGG + Intronic
915447073 1:155979871-155979893 ATGGGTGAAGAAGGAGGTGAAGG - Intronic
918381854 1:183963878-183963900 GTGAGTGACCCAGGAGCAGAGGG - Intronic
918984260 1:191602669-191602691 AAGAGAGACCTAGGAGCTGATGG - Intergenic
919376698 1:196803607-196803629 ATGTGTGACAAAGGTTTTGATGG - Intergenic
919386406 1:196928499-196928521 ATGTGTGACAAAGGTTTTGATGG - Intronic
919539297 1:198828701-198828723 ATGATTGACCAGAGATTTGATGG - Intergenic
920188384 1:204176701-204176723 ATGAGGGACAAAGGAATTTAAGG + Intergenic
920335859 1:205244711-205244733 AAGGGTGACAAAGGAGTTGGGGG + Intronic
924370667 1:243346716-243346738 AAGAGATACAAAGGAGTTGATGG - Intronic
1063639719 10:7817913-7817935 ATGAGTGAGTCAGGAGTTTATGG + Intergenic
1065113452 10:22461956-22461978 ATGTGTGGCCATGGAGTTGGGGG - Intergenic
1067086901 10:43246613-43246635 TTGAGTGACCATGGAGGTGTGGG - Intronic
1068694505 10:59951521-59951543 ATAATTGCCTAAGGAGTTGAGGG + Intergenic
1070084376 10:73221742-73221764 ATGAGTGACCAAAGTCCTGACGG - Intronic
1071521489 10:86334056-86334078 ATGAGTGATGTAGGAGGTGAGGG - Intronic
1072277330 10:93835991-93836013 AGGAGTGAGCAAGAAGTTAAAGG - Intergenic
1074124239 10:110515653-110515675 ACCAGTGACCAACGAGGTGAGGG - Intergenic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1077747489 11:4923602-4923624 ATGAGAGACACAGGTGTTGAGGG + Exonic
1082893492 11:58164945-58164967 ATAAGTGAGCAAAGATTTGAAGG - Intronic
1083132564 11:60639209-60639231 ATACTTAACCAAGGAGTTGAAGG + Intergenic
1083643447 11:64158201-64158223 TTGAGTCACCAAGGAGAGGATGG + Intronic
1086132230 11:83412791-83412813 GTGAGGGAACAAGGAGTTGCTGG + Intergenic
1086492207 11:87366805-87366827 ATGAGTGAGGAAAGAATTGAAGG + Intergenic
1087796684 11:102461518-102461540 ATCAGTGACCAAGGAGAAAAGGG + Intronic
1088113910 11:106295177-106295199 ATGAGTTACAAAGGCTTTGAAGG + Intergenic
1088684347 11:112272423-112272445 ATGAGTGAGCAAGGAGATGGAGG - Intergenic
1202816748 11_KI270721v1_random:49671-49693 AGGAGGGAGGAAGGAGTTGAGGG - Intergenic
1095153685 12:38826221-38826243 AAGACTGTCCAAGGAGATGAAGG + Intronic
1096705501 12:53419156-53419178 ATGAGTGATCAAGGAGCAGTGGG - Intergenic
1097256109 12:57675679-57675701 ATGTGTGATCAAGGAGTTACAGG + Intergenic
1098455415 12:70667463-70667485 ATGGGTAACCAGGGGGTTGATGG - Intronic
1099112574 12:78580424-78580446 ATGAATCACCAAGGACTTCAAGG - Intergenic
1099630621 12:85138978-85139000 AGGAGTGAACAAGGATATGATGG + Intronic
1102596865 12:113999521-113999543 ATTAGTGTCAAAGGAGATGAGGG + Intergenic
1102778330 12:115540704-115540726 ATGACTGACCAAGTAATTCATGG + Intergenic
1102787162 12:115614382-115614404 CTCAGTGTCCAAGGAGTAGATGG + Intergenic
1103176394 12:118867339-118867361 ATCACTGACCCAGGAGGTGAAGG + Intergenic
1105783479 13:23724635-23724657 ATCAGTGTCCAAGGGATTGAAGG - Intergenic
1106522741 13:30512205-30512227 ATGAGTGACTGAGGAGGTCAAGG + Intronic
1107435010 13:40374312-40374334 GTGAATGGCCATGGAGTTGATGG + Intergenic
1115740054 14:36378160-36378182 ATGAATGACCAAGAAGCTCAGGG - Intergenic
1115809122 14:37086340-37086362 ATGACTAACAAAGGAGTTGAAGG - Intronic
1115901078 14:38148832-38148854 ATGAGTGACCAATGAATGAATGG - Intergenic
1116043464 14:39714406-39714428 ATGAGAGAACAAGAAGTTCAGGG + Intergenic
1116760731 14:49010094-49010116 ATGAGGGACAAATAAGTTGAGGG - Intergenic
1118568659 14:67171285-67171307 ATAAGTGACCAAGGAAATAAGGG - Intronic
1119271158 14:73306451-73306473 ATGGATGACCAAGGGGTTGGTGG - Intronic
1119301316 14:73573562-73573584 ATGACTGAGCAAGTAGTTCATGG - Exonic
1119652196 14:76391885-76391907 GTGAGTATCCAAGGGGTTGAGGG + Intronic
1119702346 14:76763480-76763502 ATGAATGACTAAGGAGATGCAGG + Intronic
1120883819 14:89435978-89436000 ATGAGTGATGAAGGATGTGAGGG - Intronic
1126633333 15:50758992-50759014 GTGAGTCACCCAGGAGTTGAAGG - Intronic
1129116176 15:73366717-73366739 ATGAGAGACCAAGCAGATGCTGG + Intronic
1130130005 15:81133150-81133172 ATGAAGGGCCATGGAGTTGAAGG - Intronic
1133711072 16:8401646-8401668 AGCAGTGGCCAAGGAGGTGACGG + Intergenic
1134112773 16:11525539-11525561 CCGAGTGATCAAAGAGTTGAAGG - Intergenic
1135153065 16:20026827-20026849 AAAAGTGACTTAGGAGTTGAGGG - Intergenic
1135617148 16:23921210-23921232 ATGTGTGCCCAAGTAGTAGAGGG + Intronic
1135651126 16:24207819-24207841 ATGAGTGGAGAAGGAGTGGAAGG + Intronic
1136058081 16:27705758-27705780 TCGAGTGAGCAAGGAGTTCAAGG - Intronic
1136591946 16:31222972-31222994 GTGTGTGACCAGGCAGTTGATGG + Intronic
1137434528 16:48444812-48444834 ATGAGTGACCAAGAAGCCAAAGG + Intronic
1139375451 16:66493839-66493861 TTGAGGGACCAAGAAGGTGAGGG - Intronic
1143407197 17:6685443-6685465 ACAGGGGACCAAGGAGTTGAAGG + Exonic
1144287137 17:13787747-13787769 ATGAGTAACCAAGTAGATGAAGG + Intergenic
1145828797 17:27898304-27898326 AAGAGGAACCAGGGAGTTGAGGG - Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1157220269 18:45824593-45824615 GAGAGTGACCAAGAAGTTGAAGG + Intergenic
1159762901 18:72450945-72450967 ATGTGTGAGCAAGGAAATGATGG - Intergenic
1159767772 18:72510487-72510509 ATGACTGACCAAAATGTTGATGG - Intergenic
1164561560 19:29295785-29295807 CTGAGTGACCTCGGAGTTCAGGG + Intergenic
1165467588 19:35984151-35984173 ATGGGTGACCGGGGAGTAGATGG - Intergenic
1165913833 19:39246021-39246043 AGGTGTGACGAAGGACTTGAAGG + Intergenic
1165917034 19:39266907-39266929 AGGTGTGACGAAGGACTTGAAGG - Intergenic
1166555572 19:43697544-43697566 ATGGGTGGCCAAGGAGGTGGTGG + Intergenic
1167702058 19:51054639-51054661 CTGAGTGAGCAAGGAGGAGAGGG - Intergenic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
925833158 2:7916171-7916193 ATGAGACACAAAGGAGCTGAAGG + Intergenic
929316770 2:40488598-40488620 TTAAGTGACCAAAGAGTTGGGGG + Intronic
934043328 2:88147883-88147905 ATGAGTGTCCAAAGTGGTGATGG - Intergenic
935684619 2:105672364-105672386 ATGAGTGACCCAGGAGTCTTAGG + Intergenic
936723790 2:115287789-115287811 ATACTTGACCAAGGAGGTGAGGG + Intronic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
938172554 2:129092404-129092426 ATGAGTTAACAAGGAGGGGAAGG + Intergenic
939057870 2:137384853-137384875 ATGAGTGGCCCAGGAGTTCCAGG - Intronic
941501445 2:166283351-166283373 ATGTGTGGCCATGGATTTGATGG + Intronic
941775354 2:169387392-169387414 ATGAGTGACCTAGGAAATCAAGG + Intergenic
942054458 2:172169243-172169265 ATAAGTGACTAAACAGTTGAAGG - Intergenic
943312665 2:186345833-186345855 ATGAGTGATGAAGGACTAGAAGG - Intergenic
943831323 2:192466372-192466394 CTGAGTGACTAAGAAGTTTATGG - Intergenic
944600399 2:201297476-201297498 AGGTGTGACCAATGAGGTGAAGG + Intronic
945015778 2:205514201-205514223 AAGAGTGACCAACTAATTGATGG - Intronic
946968958 2:225070535-225070557 ATGAGTGAACCTGGACTTGATGG + Intergenic
948774134 2:240272959-240272981 ATGCATCACCAAGGATTTGAAGG + Intergenic
1170968112 20:21094454-21094476 AGAAGTGCCCTAGGAGTTGAGGG + Intergenic
1172207724 20:33176354-33176376 ATGAATGACCCAGAAGCTGAGGG + Intronic
1172954914 20:38749311-38749333 ATGTTTGAGCAAGGACTTGAAGG + Intronic
1173468281 20:43301870-43301892 CTGAGTGACAAAGGAATAGAGGG - Intergenic
1174602493 20:51736038-51736060 ATGGGTGGCCAGGGAGGTGAGGG + Intronic
1175015815 20:55788877-55788899 ATGAATGCTCAAAGAGTTGAAGG - Intergenic
1177525482 21:22285363-22285385 ATTTGTTACCAATGAGTTGATGG + Intergenic
1179094168 21:38297012-38297034 GTGAGTGACCAGGTAGTAGACGG + Exonic
1180694874 22:17745308-17745330 TTGAGAGGCCAAGGAGTTGGGGG - Intronic
1181483152 22:23213747-23213769 CTGAATGACCCAGGAGTTCAAGG + Intronic
1182452627 22:30430216-30430238 GTGAGTGAGCAAGGAATTGGTGG - Intergenic
1183452174 22:37902722-37902744 ATGTGTGAACAAGGTGTGGAAGG + Intergenic
949395899 3:3614526-3614548 ATGAGTGTCCAAGAAGATGATGG + Intergenic
951867696 3:27325889-27325911 AGGAGGGGCCAAGGTGTTGATGG - Intronic
954001973 3:47565043-47565065 ATATGTGATGAAGGAGTTGAGGG - Intronic
954168824 3:48783010-48783032 GTCATTGACCAAGGAGATGATGG - Exonic
954533311 3:51339175-51339197 ATGTGCCACAAAGGAGTTGAGGG - Intronic
955587658 3:60499083-60499105 ATGAGTGACCAAGGAGTTGAAGG + Intronic
957799235 3:85053397-85053419 ACAAGTGACCAAGAATTTGAAGG + Intronic
958061270 3:88484614-88484636 ATGAGGGAAAAGGGAGTTGATGG + Intergenic
960899024 3:122535551-122535573 ATTAGTGACTGAGGAGTAGAGGG + Intronic
962696864 3:137957932-137957954 AGGAGTAACTAAGTAGTTGAGGG - Intergenic
963833681 3:150034983-150035005 ATGAGTGTCCAAGAAATTTATGG - Intronic
967413894 3:189195711-189195733 ATTGGTGTCCAAGGTGTTGATGG + Intronic
967475484 3:189911862-189911884 ATTAATGACTAAGGAGCTGATGG - Intergenic
969940736 4:10728541-10728563 ATCAGTGACCACTGAGGTGATGG - Intergenic
970695690 4:18674223-18674245 ATGAGAGACAAAGGAGTCAATGG + Intergenic
973537757 4:51901144-51901166 CTGAGTGACCCAGGGGCTGAAGG - Intronic
974528804 4:63080566-63080588 ATATGTGTCCAAGGTGTTGATGG - Intergenic
977564944 4:98571265-98571287 ATGAGTGGCCACGGACTTCAGGG - Intronic
979189919 4:117843789-117843811 TTGGGTGACCAAGGGGTTTATGG + Intergenic
980208821 4:129758276-129758298 GAGAGGGACAAAGGAGTTGATGG - Intergenic
983050978 4:163047580-163047602 CTGAGTGACCAAAGAGTAAATGG - Intergenic
986023239 5:3824653-3824675 ATGGGTGAGCTAGGAGTTGTGGG + Intergenic
988642656 5:33058497-33058519 ATGCTTGAACAAGGACTTGATGG + Intergenic
989153495 5:38322329-38322351 ATGAGTACCCAAGGAGTGGATGG + Intronic
993094461 5:83465458-83465480 CTGAGAGAGGAAGGAGTTGATGG + Intergenic
994247368 5:97494767-97494789 AAGTGTGACCAAGGAGTGGTAGG + Intergenic
994759203 5:103832608-103832630 ATGAGGGACTACTGAGTTGAAGG + Intergenic
997583426 5:135031059-135031081 ATGAGGGTCAAAGGGGTTGAAGG + Intronic
997894225 5:137701710-137701732 AAGAGTGACCAAGTCCTTGATGG - Intronic
999195656 5:149779872-149779894 ATGATTGAGAAAGGAGTAGATGG + Intronic
1001218370 5:169876999-169877021 ATCAGTGACCTAGCAGATGAGGG + Intronic
1001323202 5:170699834-170699856 ATGAGTCAGCAAGGAGAGGAAGG + Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006908953 6:37551502-37551524 ATCAGGGACCAAGGAGATAAGGG - Intergenic
1008465443 6:51825292-51825314 TTGCTTGACCAAGAAGTTGATGG + Intronic
1011974232 6:93274056-93274078 CTGAGTTACCCAGGAGTTGCTGG + Intronic
1018475108 6:164132688-164132710 ATGAGTAACAAAGGACATGATGG - Intergenic
1018492861 6:164313707-164313729 ATTGGTCACCAAGGACTTGAGGG + Intergenic
1020241132 7:6396051-6396073 AGGAGTAACAAAGGCGTTGAAGG + Intronic
1021885422 7:25132857-25132879 ATTATTGACCACTGAGTTGATGG + Intergenic
1026157510 7:67839889-67839911 ATTAGTGACCAATAAGTTCAGGG - Intergenic
1027470613 7:78568998-78569020 AGGAGTGACCAAGCAGGTGTCGG - Intronic
1030988750 7:116274027-116274049 ATAAGTGACCCAGGAGGAGAAGG + Intergenic
1033268526 7:139909979-139910001 AGGGGTGACAAAGGAGGTGAGGG - Intronic
1034422958 7:150998844-150998866 ATGAGGGACCCTGGAGATGAAGG + Intronic
1034948477 7:155280055-155280077 ATGAGTGACCAGGTCGTGGAGGG - Intergenic
1037424729 8:18743462-18743484 ATGAGATAACAAGGAGGTGAAGG + Intronic
1037460121 8:19100456-19100478 ATGAGAAACCAAGGAATAGAAGG + Intergenic
1040930455 8:52729388-52729410 ATGAGGGGCCAAGGAATCGAAGG + Intronic
1041960476 8:63609650-63609672 ATGAGTGAGGAAGAAGTTCAAGG - Intergenic
1042413408 8:68491269-68491291 GTTAGTGACAAAGGAATTGATGG - Intronic
1042417783 8:68544313-68544335 TTGAGTGACCAAGAAATTCAGGG - Intronic
1048838915 8:138547517-138547539 AGGACTGAGCAAGGTGTTGAAGG - Intergenic
1049513259 8:143040251-143040273 ATGAGTGCCTAAGGAGCTCAAGG - Intronic
1050505316 9:6342282-6342304 GTAGGTGTCCAAGGAGTTGATGG - Intergenic
1050635736 9:7610471-7610493 ATAAGTGAACCAGGAGTAGAAGG - Intergenic
1050673184 9:8021113-8021135 ATAAGTGATAAAGGAATTGAGGG - Intergenic
1050777514 9:9284542-9284564 ATGATTGACCAAGATGTTCATGG - Intronic
1051449969 9:17185646-17185668 TTCAGAGACCAAGGAGGTGAGGG + Intronic
1055911106 9:81353040-81353062 ATACCTAACCAAGGAGTTGAAGG - Intergenic
1059098004 9:111439720-111439742 ATGAGAAACCAAGGATTTTAAGG + Intronic
1185875337 X:3697451-3697473 ATTAGTGACCCAGGAGATAAAGG - Intronic
1190305675 X:49080163-49080185 GTGGGTGACCAAGGGGCTGAGGG - Intronic
1190743953 X:53309733-53309755 TTGAGTCACAAAGGATTTGAGGG + Intronic
1191028638 X:55943130-55943152 ATGAGTGACAGAGCAGTTGGTGG + Intergenic
1194435642 X:93865891-93865913 TTGAGTAAAGAAGGAGTTGAAGG - Intergenic
1195007822 X:100703808-100703830 ATGAGTGAAAAAGTAGTTGTAGG + Intronic
1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG + Intronic
1200411406 Y:2865627-2865649 ATCAGTGAACATGGAGTTGATGG + Intronic
1201585758 Y:15559361-15559383 ATCAGTAACCAAGGAGTTGGGGG + Intergenic