ID: 955592495

View in Genome Browser
Species Human (GRCh38)
Location 3:60552623-60552645
Sequence TTACCAAGTTGGCAATGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955592495 Original CRISPR TTACCAAGTTGGCAATGAAC AGG (reversed) Intronic
900420476 1:2553986-2554008 TGACCAGGATGGCAATGACCAGG + Intergenic
903389670 1:22954952-22954974 TTGCCAGGTTGGAAATAAACGGG - Intronic
903396070 1:23002746-23002768 TTGCCAAATGGGCCATGAACTGG + Intergenic
906378683 1:45317547-45317569 TTGCCAAATGGGCCATGAACTGG - Intergenic
907293556 1:53434163-53434185 TTGCCAAATGGGCCATGAACTGG - Intergenic
908322144 1:62988647-62988669 ATACCCAGTTGGCAATGACATGG - Intergenic
909086415 1:71174152-71174174 GTACCAAGTGGGCACTGAGCTGG - Intergenic
911416910 1:97586237-97586259 TCACCAAGTGGGAAAGGAACAGG + Intronic
911581418 1:99637744-99637766 TTACCAAATTGTCCATGAACAGG - Intergenic
916101662 1:161398398-161398420 ATACCAAGTTGGCAAGGATGTGG - Intergenic
916205731 1:162314621-162314643 TTACCAAATTGGCACTGGCCTGG + Intronic
918607905 1:186451676-186451698 TTACCTAGTTGACAATCTACTGG + Intronic
918668966 1:187188979-187189001 TCTCCAATTTGGCAATGAACAGG + Intergenic
920427380 1:205889041-205889063 TTGCCAAATGGGCCATGAACTGG + Intergenic
922046387 1:221949845-221949867 CTGCCAAGTGGGCCATGAACTGG - Intergenic
924418508 1:243884711-243884733 TTAGCAATCTGGCAATAAACTGG - Intergenic
1063585742 10:7350514-7350536 TTCCCAAAGTGGCCATGAACTGG + Intronic
1063836722 10:10023056-10023078 ATACCAGGTTGGCAATTAAATGG - Intergenic
1065454373 10:25891823-25891845 GTACCAAGAGGGCACTGAACTGG - Intergenic
1065567523 10:27028848-27028870 TTACCAAATTTGCATTTAACAGG + Exonic
1068644092 10:59446272-59446294 GTACCATGTTAGCAATAAACTGG + Intergenic
1071187191 10:83059061-83059083 TTGCCAAATGGGCCATGAACTGG - Intergenic
1071472212 10:85991668-85991690 TCACCAAGGTGGCAAGGAAGAGG + Intronic
1071550831 10:86565035-86565057 TTGCCAAATGGGCCATGAACTGG + Intergenic
1072884486 10:99261529-99261551 TTGCCAAATGGGCCATGAACTGG - Intergenic
1073013972 10:100383668-100383690 TTGCCAAATGGGCCATGAACTGG - Intergenic
1073999622 10:109357243-109357265 TTACCATGTAGGCAAAGAAATGG - Intergenic
1075013445 10:118893866-118893888 TTGCCAAATGGGCCATGAACTGG - Intergenic
1080584623 11:33670211-33670233 TTACCAAGTAGACAAAGTACTGG - Exonic
1083143870 11:60743348-60743370 TTTGCAAGCTGGCAATCAACAGG + Intronic
1085336363 11:75699780-75699802 TTACCAAGCTGGTAAGAAACAGG - Intergenic
1085575164 11:77596241-77596263 TTACCATGTTGGCGTTGAATTGG - Intronic
1087591737 11:100197841-100197863 TTATCAAGTTCACAATGAAAGGG - Intronic
1088805962 11:113352108-113352130 TTCCCATGATGGCAATGCACTGG - Exonic
1089683531 11:120132732-120132754 GTACAAATTTGGCAATTAACTGG - Intronic
1089980710 11:122769814-122769836 TTTAAAAGTCGGCAATGAACTGG - Intronic
1093302191 12:17471488-17471510 TTGCCAAATGGGCCATGAACTGG - Intergenic
1095292846 12:40495466-40495488 TTAACAACATGGCCATGAACAGG + Intronic
1097423256 12:59408414-59408436 TCACAAATTTGGCAATGAAGTGG + Intergenic
1100432131 12:94540465-94540487 GAAACAAGTTGGAAATGAACGGG - Intergenic
1107713416 13:43172952-43172974 TTCCAAAGTTGGCAATGGTCTGG - Intergenic
1112076545 13:95919968-95919990 TAACCAAGATGGCATTGTACTGG + Intronic
1114221635 14:20702496-20702518 TTGCCAAATGGGCCATGAACTGG - Intergenic
1114644812 14:24249453-24249475 TGTCCAAGCTGGCAATGAGCTGG + Exonic
1117174119 14:53130376-53130398 TTAACAAATGGGCCATGAACTGG - Intronic
1118379159 14:65203819-65203841 TTGCCAAGTTGGCAGTAAGCAGG - Intergenic
1118937291 14:70299618-70299640 CTGCCAAGCTGGCCATGAACTGG + Intergenic
1119248435 14:73132432-73132454 TTGCCAAATGGGCCATGAACTGG + Intergenic
1124806019 15:32883741-32883763 TTACTAAGTAGACAATGAAAGGG + Intronic
1131302735 15:91213867-91213889 TTAACAAGTTAGCAAGGAAGTGG + Intronic
1138295729 16:55883654-55883676 TTACTAACTTGGCCATGAAGTGG + Intronic
1141136528 16:81469106-81469128 TTTCCCTGTTGGCAACGAACTGG - Intronic
1152453910 17:80401822-80401844 CTGCCAAGTGGGCCATGAACTGG - Intergenic
1155957650 18:31967289-31967311 TGACCAAGATGGCAAGGACCAGG + Intergenic
1157719671 18:49914096-49914118 GTACCAAGTGGGCACTGAGCTGG + Intronic
1158576741 18:58644751-58644773 TTGCCAAACTGGCCATGAACGGG + Intergenic
1159663905 18:71133324-71133346 TTACCAAGGTGGCAATGGTATGG + Intergenic
1161711999 19:5854023-5854045 TTGCCAAATGGGCCATGAACTGG - Intergenic
1163106403 19:15125376-15125398 TTACCTACTTGTCAATGGACAGG + Intronic
1163944492 19:20522848-20522870 TTGCCAAATGGGCCATGAACTGG + Intergenic
1163980020 19:20890496-20890518 TGAACCAGTGGGCAATGAACAGG - Intergenic
1164080757 19:21859698-21859720 TTGCCAAATGGGCCATGAACTGG - Intergenic
1166905840 19:46107848-46107870 TTGCCAAATGGGCCATGAACTGG + Intergenic
1202645171 1_KI270706v1_random:132640-132662 GTACCAAGAGGGCACTGAACGGG + Intergenic
1202645272 1_KI270706v1_random:133362-133384 GTACCAAGAGGGCACTGAACAGG + Intergenic
925937494 2:8779094-8779116 TTGCAAAAATGGCAATGAACGGG + Exonic
927134125 2:20084256-20084278 TTGCCAAATGGGCCATGAACTGG - Intergenic
929571106 2:43023655-43023677 TTACCAAGTAGGCAGAGAAGAGG + Intergenic
929674243 2:43909055-43909077 GGACCTAGTTGGCAATAAACAGG + Intronic
929968260 2:46551572-46551594 TTACCAAGTTGTCAGTCACCAGG - Intronic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
933137888 2:78759812-78759834 TTGCCAAATGGGCCATGAACTGG - Intergenic
933190955 2:79332757-79332779 TAATCAAGTTGGAAATGGACAGG - Intronic
934507680 2:94906950-94906972 GTACCAAGAGGGCACTGAACGGG + Intergenic
936676155 2:114717449-114717471 TTACCAACTAGGAAATGAAGAGG + Intronic
937172797 2:119893353-119893375 TTACTAAGTTGGGAAAGACCTGG + Intronic
939642002 2:144651566-144651588 TTTCCAAGTTGGCATTTAAATGG - Intergenic
941444611 2:165585088-165585110 TTAAAAAGTTGGGAATGAAAAGG + Intronic
944134470 2:196383645-196383667 TCACCCAGTTGGCAATGACAAGG + Intronic
944250988 2:197580052-197580074 TTGCCAAGTGGGCCATGAACTGG - Intronic
945364872 2:208940188-208940210 TTATGAAGTTGACAATGGACAGG - Intergenic
946598769 2:221336158-221336180 TTAGAAAGTTGGCAATTATCAGG - Intergenic
1169076249 20:2761329-2761351 TTACCATGTTTGCAATGGCCTGG + Intergenic
1176606614 21:8839380-8839402 GTACCAAGAGGGCACTGAACAGG - Intergenic
1176606720 21:8840103-8840125 GTACCAAGAGGGCACTGAACGGG - Intergenic
1178402889 21:32302484-32302506 TTACCAAGTCAGCAAAGAAACGG - Intronic
1180008739 21:45035489-45035511 GTACCAAGGTTGCAATGACCGGG - Intergenic
1180356687 22:11849082-11849104 GTACCAAGAGGGCACTGAACAGG - Intergenic
1180356791 22:11849804-11849826 GTACCAAGAGGGCACTGAACGGG - Intergenic
1180381469 22:12142527-12142549 GTACCAAGAGGGCACTGAACGGG + Intergenic
1180381574 22:12143249-12143271 GTACCAAGAGGGCACTGAACAGG + Intergenic
1182237183 22:28884393-28884415 TTTCAAAGTTGGCATTCAACAGG - Intronic
1184896708 22:47411659-47411681 TTACCAGGTGTGCAAAGAACTGG + Intergenic
949288647 3:2437142-2437164 TGAGCACTTTGGCAATGAACAGG - Intronic
951253421 3:20420545-20420567 TTGGCAAGTTGGCAGAGAACTGG + Intergenic
951272598 3:20645121-20645143 TTAGCATGGTGGAAATGAACTGG + Intergenic
952107416 3:30086335-30086357 TTGCCAAGTTTGAAATTAACTGG + Intergenic
952292994 3:32036543-32036565 TTACTAAGTTGGGAAGGCACTGG - Intronic
953986598 3:47448071-47448093 TTATCAAATTTGCAAAGAACTGG + Intronic
955592495 3:60552623-60552645 TTACCAAGTTGGCAATGAACAGG - Intronic
955678277 3:61472421-61472443 TTCCCAAGTTGGGAATGCAAAGG - Intergenic
955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG + Exonic
955852587 3:63237026-63237048 TTACCAAGTTGGGAGTAAAGGGG - Intronic
957155160 3:76536448-76536470 CCACCAAGTGGGCCATGAACTGG + Intronic
958548149 3:95582923-95582945 TTGCCTAGTTGCCACTGAACAGG - Intergenic
959861549 3:111221940-111221962 TCACCAAGTTGGATATGAATGGG - Intronic
963111885 3:141695056-141695078 TTGCCAAATGGGCCATGAACTGG + Intergenic
963879604 3:150514211-150514233 ATACGGAGTTGGCAATGTACTGG + Intergenic
965940407 3:174172691-174172713 TAACCAAATTGGCATTGTACTGG - Intronic
966549920 3:181193587-181193609 TGTCCAAGTTGGAAATGAAAAGG + Intergenic
968848091 4:3058474-3058496 AAACCAAGATGGCAATGAAAGGG - Intergenic
971044374 4:22788784-22788806 TTACAAAGTTGGCAAAGGGCTGG - Intergenic
972071179 4:35020578-35020600 TTGCCAAATGGGCCATGAACTGG + Intergenic
973371392 4:49251054-49251076 GTACCAAGAGGGCACTGAACGGG + Intergenic
973389510 4:49543534-49543556 GTACCAAGAGGGCACTGAACAGG - Intergenic
974926140 4:68300317-68300339 TTATCAAGATGGCTATGAAATGG + Intergenic
977099956 4:92798817-92798839 TTACCAAGTCAGCAAGGAAGGGG + Intronic
978303273 4:107294216-107294238 TTGCCAAATGGGCCATGAACTGG + Intergenic
982318765 4:154058191-154058213 TTGCCAAATGGGCCATGAACTGG - Intergenic
982765602 4:159344869-159344891 TTTCCTAGTTGGAACTGAACAGG + Intronic
987275890 5:16362131-16362153 TGACCAATTTGGCACTGAACAGG + Intergenic
987397328 5:17436990-17437012 TTACCAAGGAGGCAAGGAAATGG + Intergenic
987883465 5:23781036-23781058 TTACCCAGTTGGGAATGCAGTGG + Intergenic
989615193 5:43331742-43331764 TTGCCAAATGGGCCATGAACTGG + Intergenic
989688945 5:44118501-44118523 TTGCCAAATGGGCCATGAACTGG + Intergenic
993773566 5:91962632-91962654 GTACCAAGATGGCACTGAGCTGG + Intergenic
994324828 5:98436478-98436500 TTGCCAAATGGGCCATGAACTGG - Intergenic
994685572 5:102947227-102947249 TTGCCAAGTGGGCTATAAACAGG + Intronic
996143916 5:119949776-119949798 AAACCAAGATGGCAATGAAAGGG + Intergenic
998435731 5:142107477-142107499 TTTCCAAGTTGGCAGTGTAGAGG - Intergenic
999382773 5:151133121-151133143 TTCCCAAGATGTAAATGAACTGG + Exonic
999835200 5:155362961-155362983 TTATCAAATTGACAATGAAATGG + Intergenic
1000606886 5:163335957-163335979 TTGCCAAATGGGCCATGAACTGG - Intergenic
1001659970 5:173383973-173383995 TTACCAAGTTGTAAATTAAAAGG - Intergenic
1001917029 5:175570319-175570341 TTATGAAGCTGGCAATAAACAGG + Intergenic
1001998712 5:176183065-176183087 GTTCCAAGTTGGCAATGAATGGG + Intergenic
1002169851 5:177368899-177368921 CTACCTGGTGGGCAATGAACAGG + Exonic
1002650280 5:180686688-180686710 GTTCCAAGTTGGCAATGAATGGG + Intergenic
1003940921 6:11025377-11025399 ATACAAATTTGGAAATGAACTGG + Intronic
1010510591 6:76713768-76713790 TCACCATGTTGGCCATGAATAGG + Intergenic
1010733236 6:79412896-79412918 ATACCAAGTGGGTACTGAACTGG - Intergenic
1012354985 6:98302921-98302943 TTGGCAAGTTTGCAATGAAAAGG - Intergenic
1014464242 6:121736337-121736359 TTACTAAGTGGGCAAAGGACAGG - Intergenic
1016012538 6:139153331-139153353 TTACAATGTTTACAATGAACTGG - Intronic
1016189094 6:141238328-141238350 CTCCAAAGTTGCCAATGAACAGG + Intergenic
1018670453 6:166172603-166172625 TTCCCAAGGTGGCTATGAAAGGG - Intergenic
1019620423 7:1989068-1989090 TTACAAAGTGGGCAATGGATGGG + Intronic
1021560531 7:21964865-21964887 GTACCAAGAGGGCACTGAACAGG + Intergenic
1021660576 7:22915055-22915077 TTGCCAAATGGGCCATGAACTGG - Intergenic
1023754356 7:43402193-43402215 ATACCAAGAAGGCAATGAATTGG + Intronic
1024141674 7:46468492-46468514 TTACAATGTTGGCAAAGATCTGG + Intergenic
1027158272 7:75783835-75783857 CTGCTAAGTGGGCAATGAACTGG - Intronic
1027354372 7:77341608-77341630 TTGCCAAATGGGCCATGAACTGG - Intronic
1028241706 7:88429055-88429077 TTTCCAATTTGGCAATGGTCTGG - Intergenic
1031670485 7:124537483-124537505 TTACCAAGTGTTCAATGAACTGG + Intergenic
1033084670 7:138330939-138330961 TTGCCAAATGGGCCATGAACTGG - Intergenic
1033465080 7:141582586-141582608 TTGCCAAATGGGCCATGAACTGG + Intronic
1035733285 8:1868039-1868061 TTACCCAGATGGCAGTGAATTGG + Intronic
1039907286 8:41796384-41796406 TTCCAAAGTTGGCTATGATCAGG + Intronic
1041917583 8:63152102-63152124 TTGCCAAATGGGCCATGAACTGG + Intergenic
1042596429 8:70452872-70452894 TTACAAAGATTGCAAGGAACTGG + Intergenic
1042706040 8:71666341-71666363 TTGCCAAATGGGCCATGAACTGG - Intergenic
1044400987 8:91771756-91771778 TTATGAAGTTGGCAATGTATTGG + Intergenic
1044798029 8:95923933-95923955 TTACAGAATTGGCATTGAACTGG + Intergenic
1046027632 8:108744702-108744724 TTATCAGGGTGGAAATGAACAGG + Intronic
1047986496 8:130240192-130240214 TTACCAACTTGCCTATGAACTGG + Intronic
1049913555 9:294383-294405 TTACCAACTGGGCATTAAACTGG + Intronic
1050396721 9:5205632-5205654 TTCCCATGATGGCAATGAAGAGG - Intergenic
1054353417 9:64040485-64040507 GTACCAAGAGGGCACTGAACGGG - Intergenic
1055819331 9:80242885-80242907 TTGTCAAGGTGGCAATGAATAGG + Intergenic
1058428998 9:104901408-104901430 ATATCATGTTGGCAATGAAAGGG - Intronic
1203695935 Un_GL000214v1:96845-96867 GTACCAAGAGGGCACTGAACAGG + Intergenic
1203741749 Un_GL000218v1:9595-9617 GTACCAAGAGGGCACTGAACAGG - Intergenic
1203741854 Un_GL000218v1:10317-10339 GTACCAAGAGGGCACTGAACAGG - Intergenic
1203701938 Un_KI270742v1:4185-4207 GTACCAAGAGGGCACTGAACAGG - Intergenic
1203702044 Un_KI270742v1:4908-4930 GTACCAAGAGGGCACTGAACGGG - Intergenic
1203553922 Un_KI270743v1:190240-190262 GTACCAAGAGGGCACTGAACAGG - Intergenic
1203554024 Un_KI270743v1:190963-190985 GTACCAAGAGGGCACTGAACGGG - Intergenic
1203640338 Un_KI270751v1:7218-7240 GTACCAAGAGGGCACTGAACAGG - Intergenic
1189806341 X:44739100-44739122 TTAAAAAGTGGGCAAAGAACAGG - Intergenic
1191014242 X:55792078-55792100 TTGCCAAATGGGCCATGAACTGG + Intergenic
1191805859 X:65133433-65133455 TTGCCAAATGGGCCATGAACTGG + Intergenic
1192699485 X:73452625-73452647 TTACCAAGTAGGTAGTGAATGGG - Intronic
1192731562 X:73806687-73806709 TTGCCAAATGGGCCATGAACTGG + Intergenic
1193731173 X:85105744-85105766 TTGCAAACTTAGCAATGAACAGG + Intronic
1194163351 X:90483305-90483327 GTACCAAGAGGGCACTGAACTGG - Intergenic
1195000623 X:100639803-100639825 TTACTGAGTTGGGATTGAACTGG - Intronic
1196160529 X:112477715-112477737 TTACAAAATAGGCAATGAGCGGG + Intergenic
1200509620 Y:4061030-4061052 GTACCAAGAGGGCACTGAACTGG - Intergenic
1201155280 Y:11127049-11127071 GTACCAAGAGGGCACTGAACAGG - Intergenic
1201155382 Y:11127772-11127794 GTACCAAGAGGGCACTGAACAGG - Intergenic
1201724858 Y:17140470-17140492 TTGCCAAATGGGCCATGAACTGG + Intergenic