ID: 955593524 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:60563159-60563181 |
| Sequence | AGCTACAAAGGCGAGCCCGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 50 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 40} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955593522_955593524 | -9 | Left | 955593522 | 3:60563145-60563167 | CCACACAGTTAAGAAGCTACAAA | 0: 1 1: 1 2: 1 3: 26 4: 213 |
||
| Right | 955593524 | 3:60563159-60563181 | AGCTACAAAGGCGAGCCCGATGG | 0: 1 1: 0 2: 0 3: 9 4: 40 |
||||
| 955593521_955593524 | 10 | Left | 955593521 | 3:60563126-60563148 | CCAAGCAAGCATGGAGAAACCAC | 0: 1 1: 0 2: 14 3: 443 4: 12089 |
||
| Right | 955593524 | 3:60563159-60563181 | AGCTACAAAGGCGAGCCCGATGG | 0: 1 1: 0 2: 0 3: 9 4: 40 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955593524 | Original CRISPR | AGCTACAAAGGCGAGCCCGA TGG | Intronic | ||