ID: 955593524

View in Genome Browser
Species Human (GRCh38)
Location 3:60563159-60563181
Sequence AGCTACAAAGGCGAGCCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 40}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955593522_955593524 -9 Left 955593522 3:60563145-60563167 CCACACAGTTAAGAAGCTACAAA 0: 1
1: 1
2: 1
3: 26
4: 213
Right 955593524 3:60563159-60563181 AGCTACAAAGGCGAGCCCGATGG 0: 1
1: 0
2: 0
3: 9
4: 40
955593521_955593524 10 Left 955593521 3:60563126-60563148 CCAAGCAAGCATGGAGAAACCAC 0: 1
1: 0
2: 14
3: 443
4: 12089
Right 955593524 3:60563159-60563181 AGCTACAAAGGCGAGCCCGATGG 0: 1
1: 0
2: 0
3: 9
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955593524 Original CRISPR AGCTACAAAGGCGAGCCCGA TGG Intronic