ID: 955593531

View in Genome Browser
Species Human (GRCh38)
Location 3:60563182-60563204
Sequence GAAGCGGTAGGGACTTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955593522_955593531 14 Left 955593522 3:60563145-60563167 CCACACAGTTAAGAAGCTACAAA 0: 1
1: 1
2: 1
3: 26
4: 213
Right 955593531 3:60563182-60563204 GAAGCGGTAGGGACTTGAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955593531 Original CRISPR GAAGCGGTAGGGACTTGAGT TGG Intronic
900072995 1:788926-788948 GGAACGGAATGGACTTGAGTGGG + Intergenic
911942781 1:104068992-104069014 GAAGAGGTAGGGCCTGGAATGGG + Intergenic
912473690 1:109923001-109923023 GAAGAGGATGGGACTAGAGTGGG - Intronic
914258543 1:145979822-145979844 GATGCTGTAGGGAATTCAGTCGG - Intergenic
916817401 1:168367247-168367269 GAAGGAGTTGGGATTTGAGTTGG + Intergenic
922934590 1:229413300-229413322 GAAGGGGTAGAGACATGAGAAGG - Intergenic
1067285549 10:44905160-44905182 GAAGCGGAAAGGAATTGAGGTGG + Intergenic
1073267030 10:102234018-102234040 GAAGGGGTAGAGAGCTGAGTGGG + Intronic
1076065910 10:127447703-127447725 GAAGCAGTAAGGACTCCAGTGGG + Intronic
1077941190 11:6845534-6845556 GAAGAGGAAGGGTCTTGTGTTGG - Intergenic
1083048352 11:59755745-59755767 GAAGCGGTGGGGGCTTGGGGAGG - Intronic
1085279491 11:75320649-75320671 GAAGAGTTGGGTACTTGAGTGGG - Intronic
1089484655 11:118836073-118836095 GAAGCAGTAGGGAGTGGAGAAGG - Intergenic
1094008098 12:25777108-25777130 GCAGCGGTAGGGACCAGAGAAGG - Intergenic
1096148199 12:49293536-49293558 AAGGCGGTAGGGACGTGAGCAGG + Intronic
1096590943 12:52658983-52659005 AAAGGGGTAGAGACGTGAGTGGG + Intergenic
1096602808 12:52742349-52742371 GAAGCAGCAGGGACTGGAGGGGG - Intergenic
1096817531 12:54210846-54210868 GAAGAGGAAGGGACTGGAGGTGG - Intergenic
1098268185 12:68744814-68744836 GAAGTGGTGGGCACCTGAGTGGG + Exonic
1103021762 12:117540021-117540043 GAAGCGGGAGGGACTTCGGAAGG - Intronic
1104846738 12:131850806-131850828 GCAGCGGAAGGGGCTCGAGTCGG - Intronic
1106319994 13:28628429-28628451 GAAGAGGAAGGGAGTGGAGTGGG - Intergenic
1107676282 13:42800846-42800868 GAAGATGTTGGGAATTGAGTTGG - Intergenic
1111540868 13:89665595-89665617 GAAGAGGTATGGACTTGAAGGGG + Intergenic
1112130098 13:96514061-96514083 GAAGCAGTAGGGATGTGAGTAGG + Intronic
1122923926 14:104891241-104891263 GATGGGGTAGGGAGTTGGGTGGG + Intronic
1124566924 15:30824571-30824593 AAAGCATTTGGGACTTGAGTAGG + Intergenic
1128736908 15:70058607-70058629 GGAGCGGCAGGGACTGGAGCTGG - Intronic
1135783502 16:25327060-25327082 GAACTGGGAGAGACTTGAGTAGG + Intergenic
1148928154 17:51105925-51105947 GAAGAGGTAGGCACTTTAGATGG - Intronic
1152491270 17:80636248-80636270 GTAGAAGTAGGGACTAGAGTTGG - Intronic
1156181830 18:34613660-34613682 GAAGAGTTAGGGCCTTGAGCTGG - Intronic
1158649083 18:59270924-59270946 GATGTGGTAGGGAATTGAGTGGG - Intronic
1160990786 19:1859556-1859578 GTGGAGGTAGGGACTTGAGGTGG - Intronic
1163939132 19:20476861-20476883 GAGGCGGGAGGGACTGGAGGAGG + Intergenic
1167788384 19:51654876-51654898 GAAGTGGTGGGGACATGAGCTGG + Intergenic
929821677 2:45279052-45279074 GAAGTGGTAGGAACTAGAATTGG - Intergenic
934763343 2:96868115-96868137 GAAGCGGGGAGGAGTTGAGTTGG + Intronic
939718054 2:145610273-145610295 AAAGCAGTAGAGAGTTGAGTTGG + Intergenic
944443629 2:199767555-199767577 TAAGAGGTAGGGACTTCAGGAGG + Intronic
946631876 2:221678176-221678198 AAAGTGGTAGGGGCTGGAGTTGG + Intergenic
1169719269 20:8655735-8655757 AAAGCTGGAGGCACTTGAGTTGG + Intronic
1173677855 20:44853301-44853323 GAAGAGGTGGGGACTTTAGGAGG - Intergenic
1174682205 20:52419673-52419695 TGAGAGGTAGGGACTTTAGTAGG + Intergenic
1174708082 20:52677202-52677224 GAAGGGGCAAGGACTAGAGTTGG - Intergenic
1176116553 20:63434136-63434158 GGAGCGGTTGGGGCTTGACTCGG + Intronic
1178093315 21:29187501-29187523 GAAGAGCTGGGGACTTGGGTGGG - Intergenic
1178428970 21:32502435-32502457 GGAGGGGTAGGGAGTTGAGGGGG + Intronic
1182110770 22:27721676-27721698 GAAGGGGTAGGGGCTTAGGTTGG - Intergenic
1182934912 22:34211643-34211665 GAAGCAGTAGGGATTAGTGTAGG + Intergenic
1183411319 22:37656490-37656512 GGAGCGGTAGGGGCTTCTGTGGG - Intronic
1183932762 22:41245728-41245750 GGAGCGGTAGGGTCTGGACTGGG - Exonic
1203273742 22_KI270734v1_random:74129-74151 AGAGCGGTAGGGGCTTGAGATGG - Intergenic
955593531 3:60563182-60563204 GAAGCGGTAGGGACTTGAGTTGG + Intronic
967687212 3:192431648-192431670 GAAACGCTTGGTACTTGAGTTGG - Intronic
975516797 4:75257145-75257167 GAAGCGATGGGGACTTGAGCTGG - Intergenic
976299811 4:83507023-83507045 GAGGCGGGAGGGACTGGAGGAGG + Intronic
976713233 4:88095676-88095698 AAAGTGGTAGGGACTTGAAGAGG - Intronic
983501972 4:168509880-168509902 GAAGCAGTAGGCTCTTGAGCTGG + Intronic
985286921 4:188345121-188345143 GAAGCGGTAGGAACATGGGGAGG + Intergenic
987284441 5:16441581-16441603 GAAGGGGTAGGGCCTTGGGCAGG + Intergenic
990185315 5:53204463-53204485 GAGGCGGGAGGGACTGGAGGAGG - Intergenic
994438852 5:99775389-99775411 GAAGTGCTAGGGACTAGAGATGG - Intergenic
999124755 5:149238955-149238977 GAAGTGGCAGGGACTTGACTTGG - Intronic
1000296234 5:159916064-159916086 CAGGTGGGAGGGACTTGAGTCGG - Intergenic
1006092987 6:31639167-31639189 GAAGCGCTGGGGACTGTAGTTGG + Exonic
1006280296 6:33047285-33047307 GCAGCGGAAGGGACTTGTTTTGG - Intergenic
1006519544 6:34563343-34563365 GAAGGGGTAGGGACTTGTAGGGG + Intergenic
1008969334 6:57348439-57348461 GAAAAGTTATGGACTTGAGTTGG + Intronic
1014392218 6:120876792-120876814 AAATCGGTAGGGATTTGTGTAGG + Intergenic
1016568402 6:145485376-145485398 GAAGTGGTGGGTAATTGAGTGGG + Intergenic
1019228011 6:170531256-170531278 GAAGAGGTAGGGAGTTGGGTGGG + Intergenic
1019313903 7:375962-375984 GAAGACGTTGGGGCTTGAGTTGG - Intergenic
1022003478 7:26246749-26246771 GAGGCGGGAGGGACTGGAGGAGG - Intergenic
1023822673 7:43988636-43988658 GGAGCTGGAGGGACTTAAGTTGG - Intergenic
1029227983 7:99042079-99042101 AAAGAGGTAGGGAATTGAGTTGG - Intronic
1029750938 7:102542051-102542073 GGAGCTGGAGGGACTTAAGTTGG - Intronic
1029768891 7:102641162-102641184 GGAGCTGGAGGGACTTAAGTTGG - Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1038423336 8:27448154-27448176 GAAGAGGCAGGGGCTTCAGTAGG + Intronic
1038696681 8:29812580-29812602 GAAGTGGTTGGGACCTGGGTTGG - Intergenic
1042693440 8:71529266-71529288 GAAGCAGTAAGGCCTAGAGTTGG - Intronic
1047209883 8:122832725-122832747 GAGGCGGGAGGGACTGGAGGAGG + Intronic
1055058912 9:72048838-72048860 GAATGGATAGGGGCTTGAGTGGG + Intergenic
1055590248 9:77805164-77805186 GATGAGGAAGGGACTAGAGTAGG - Intronic
1060897414 9:127226194-127226216 GCAGTGGTAGGGACCAGAGTGGG + Intronic
1061734388 9:132643306-132643328 GAAGCTCTATGCACTTGAGTTGG + Intronic
1186497309 X:10021864-10021886 GAAGGGCAAGGGACTTGAGCTGG + Intronic
1190677665 X:52796071-52796093 GAAGAGGTAGGCATTTGAGAAGG - Intergenic
1198854731 X:141003758-141003780 GAAGAGGTAGGCATTTGAGAAGG + Intergenic
1198877283 X:141241384-141241406 GAAGAGGTAGGCATTTGAGAAGG - Intergenic
1198907965 X:141583605-141583627 GAAGAGGTAGGCATTTGAGAAGG - Intergenic
1198908826 X:141590819-141590841 GAAGAGGTAGGCATTTGAGAAGG + Intronic
1198918247 X:141697337-141697359 GAAGAGGTAGGCATTTGAGAAGG - Intronic
1199073823 X:143508661-143508683 GAAGAGGTAGGCATTTGAGAAGG - Intergenic
1199092815 X:143711882-143711904 GAAGAGGTAGGCATTTGAGAAGG - Intergenic
1199243278 X:145573645-145573667 GAAGTGTTTGGGACTTGGGTGGG + Intergenic