ID: 955600036

View in Genome Browser
Species Human (GRCh38)
Location 3:60635430-60635452
Sequence AGAAAACGGCTTATGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955600036_955600048 28 Left 955600036 3:60635430-60635452 CCCTCCTTCATAAGCCGTTTTCT 0: 1
1: 0
2: 1
3: 15
4: 166
Right 955600048 3:60635481-60635503 CTTTCCCCACCTCTACTACCTGG 0: 1
1: 0
2: 2
3: 23
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955600036 Original CRISPR AGAAAACGGCTTATGAAGGA GGG (reversed) Intronic
901549896 1:9988389-9988411 AGAAAGCTGCTTAAGAAGAAAGG + Intergenic
902233477 1:15043070-15043092 AGAAAACAGCTCATGCAGGAGGG + Intronic
903159900 1:21479612-21479634 AGAATACAGCTTTTGAAGTATGG - Intronic
905420693 1:37841432-37841454 AGGAAACGGCTGCTGATGGATGG + Intronic
905438280 1:37974806-37974828 GGAATATGGCTTATGAGGGAGGG - Intronic
905790620 1:40787386-40787408 AGAGAAGGGCTCAGGAAGGAGGG + Intronic
905867501 1:41383983-41384005 AGAAAATGACTTGGGAAGGAGGG + Intergenic
906960459 1:50416711-50416733 AGAAAACGGTTTAATAAAGAAGG - Intergenic
909098870 1:71324730-71324752 AGAAAACAGCTTCTGAACCATGG - Intergenic
911584420 1:99674141-99674163 ATAAAAGGGCATATGGAGGAAGG - Intronic
912466192 1:109876453-109876475 AGAAAACAGCATTTGAAGCAAGG - Intergenic
914361288 1:146938536-146938558 AGAAAACGAGTAATGGAGGACGG - Intergenic
914380581 1:147112450-147112472 AGAATACAGCTTTTGAAGTATGG + Intergenic
915252417 1:154600048-154600070 AGAAAACGGCTTAGGGAGGAGGG + Intronic
917959357 1:180129965-180129987 AGAAAACGGCTGATGAGGCCGGG + Intergenic
918862498 1:189849453-189849475 AGAAAAAGGCTTATTGAGCATGG - Intergenic
921563760 1:216691012-216691034 AGAAAATGGCAAATGAAGGCAGG - Intronic
924135231 1:240958812-240958834 AGAAAAGGTCTCATGAGGGAGGG - Intronic
1064475277 10:15681708-15681730 GGCAAAAGGCATATGAAGGATGG + Intronic
1065451705 10:25865456-25865478 AGAAAAGGGCTTGTGAAGGCTGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1069743321 10:70699375-70699397 AGAAAACTATTTATAAAGGATGG + Intronic
1069875468 10:71560343-71560365 AAAAAAGAGCTTAGGAAGGAAGG - Intronic
1071816008 10:89233342-89233364 GGAAAAGGGCTGATGAAGAAAGG + Intronic
1072818842 10:98536365-98536387 ACAAAACTGCTAATGAAGCAGGG + Intronic
1074376527 10:112945528-112945550 GGTAATCGGCTTATGAAGGCAGG + Intergenic
1078103193 11:8342028-8342050 AGAAAAGGGCTTTTAAAGGTGGG + Intergenic
1078292658 11:10028546-10028568 AGAAAACAGCTTCTGCAGAATGG + Exonic
1078941321 11:16009376-16009398 AGAAAATGACTTGTCAAGGATGG + Intronic
1080263598 11:30377212-30377234 ACAAAAGGGCATGTGAAGGAGGG - Intergenic
1082614174 11:55338450-55338472 AGAAGAGGGCTTCAGAAGGACGG - Intergenic
1083651498 11:64207234-64207256 GGAAAGCCGCTCATGAAGGAGGG - Intronic
1084753201 11:71217753-71217775 AGAAAAAGGCTTATGGAATAAGG + Intronic
1086538777 11:87882822-87882844 AGGAAATGGCTTATGAGGCATGG + Intergenic
1087022892 11:93621097-93621119 AGAAAACAGCATGGGAAGGATGG - Intergenic
1087288326 11:96291421-96291443 AAACAAAGGCTTATGAAGGCCGG - Intronic
1087832500 11:102834680-102834702 AGAAGAAGGTTTGTGAAGGAAGG - Intergenic
1087869697 11:103277409-103277431 TGAAAAAGGCAGATGAAGGAGGG - Intronic
1088023362 11:105147615-105147637 AGAAAAGGGCATCTGTAGGAAGG - Intergenic
1089906121 11:122040565-122040587 AGAAATCGGCTTCTGGAGGAAGG - Intergenic
1091725185 12:2841386-2841408 AGAGAAGGGCTTAAAAAGGAAGG + Intronic
1095254764 12:40021982-40022004 AGAAAATGACTTACGAAGGTAGG + Intronic
1096739220 12:53679839-53679861 AGAAAACAGTAGATGAAGGAAGG + Intergenic
1096770584 12:53933720-53933742 AGAAAAGGGCTGAGGAAGGAGGG + Intergenic
1099112850 12:78584582-78584604 AGAAAACTGATAATGCAGGAAGG - Intergenic
1100354860 12:93819305-93819327 AAAATAAGGCTAATGAAGGAGGG + Intronic
1100623922 12:96309273-96309295 CAAAAACGGCCTATGAATGAAGG - Intronic
1101193773 12:102361788-102361810 AGAAAACGACGAAGGAAGGAAGG + Intergenic
1101844368 12:108350608-108350630 ACAAAAAGTATTATGAAGGATGG - Intergenic
1102397926 12:112603214-112603236 AGAAAACAGCTGAAGCAGGAAGG - Intronic
1105612060 13:21977357-21977379 AGAAAACAGCTGAAGCAGGAAGG - Intergenic
1105829960 13:24155430-24155452 AGAATACTGCTTGTGAAGGATGG + Intronic
1108182163 13:47851786-47851808 ACAAAAAGGCTTATGAATGAGGG - Intergenic
1109663428 13:65496582-65496604 AGAAAAAAGCTTATGAAATAAGG - Intergenic
1110428648 13:75398419-75398441 AGGAAACGGCTACTGAAGGCGGG + Intronic
1118152853 14:63208547-63208569 AGAAAATGTTTTAGGAAGGAGGG - Intronic
1120051439 14:79871417-79871439 AGAATATGGGTTATGGAGGAAGG - Intergenic
1121855317 14:97263978-97264000 AGAAAAATGCTTATAGAGGAAGG + Intergenic
1125628006 15:41124850-41124872 AAAACATGGTTTATGAAGGAAGG - Intergenic
1126694285 15:51313063-51313085 TGAAAATGGCTCATGAAGGGAGG - Intronic
1137645612 16:50070753-50070775 AGAAAACGGACTGGGAAGGAGGG - Intronic
1138037148 16:53620337-53620359 AGAAAATGTCTTTTGAAAGAAGG - Intronic
1138411644 16:56845225-56845247 AGAAAAAGCCTTAAGAAGGAAGG + Intronic
1140295610 16:73706741-73706763 AGGAGATGGCTTTTGAAGGATGG - Intergenic
1140425944 16:74861460-74861482 AAAAAAGGTTTTATGAAGGATGG - Intergenic
1140679783 16:77373831-77373853 ATAAAACTGCATATGAGGGATGG - Intronic
1141927194 16:87177617-87177639 TGAAGACGGATTATGAATGAAGG + Intronic
1144890494 17:18491410-18491432 AGAAAGCGGTTTAGCAAGGAGGG + Intronic
1145132068 17:20363486-20363508 GGGAAACGGCTTCTGAAGTACGG - Intergenic
1145141723 17:20452908-20452930 AGAAAGCGGTTTAGCAAGGAGGG - Intronic
1151141946 17:72001795-72001817 GGAAAAAGGCTTATAAAGTAAGG - Intergenic
1151442059 17:74135885-74135907 TGACAGCGGCTGATGAAGGATGG - Intergenic
1157365845 18:47063601-47063623 AGAAAAAGACTTAGGAATGAAGG + Intronic
1158946166 18:62448699-62448721 AGGAAACGTCTTGTTAAGGAGGG - Intergenic
1159408231 18:68034346-68034368 AGAAAATGACTTAAGAAAGAAGG - Intergenic
1159411479 18:68081289-68081311 AGAAAATGGTTTCTGGAGGAAGG + Intergenic
1159480633 18:68986849-68986871 TGAAGACATCTTATGAAGGAAGG + Intronic
1160927731 19:1555165-1555187 AGAAAACGGCTTCGGACGAAAGG + Exonic
1161835871 19:6645824-6645846 AGAAAAAGCTTTATGGAGGAAGG + Intergenic
1165242083 19:34476976-34476998 GGATAACGGGTTATGAGGGAAGG - Intergenic
925663142 2:6224080-6224102 AGAAAAAGGCTTCTGAAAAAGGG + Intergenic
926847520 2:17158681-17158703 AGATAGAGGCTTATGAAGGATGG - Intergenic
928706294 2:33953112-33953134 AAAAGAGGGCTTATGAAGGGAGG - Intergenic
930888319 2:56353849-56353871 AGAAAATGCCTTGTGAAGGGTGG + Intronic
933941345 2:87247572-87247594 AGAAAACGGCAGAAGCAGGAAGG + Intergenic
936338877 2:111614016-111614038 AGAAAACGGCAGAAGCAGGAAGG - Intergenic
937807424 2:126161939-126161961 AGAAATCGGCTTCAGAAGGTGGG + Intergenic
940146823 2:150553844-150553866 AGAAAATATCTTATGAAAGATGG - Intergenic
941476227 2:165954069-165954091 AGGAAACGGAGTATGAAGAAGGG + Intergenic
942181886 2:173388015-173388037 AGAAAATGGTTTTTAAAGGAAGG + Intergenic
942815749 2:180051745-180051767 AGAAAAAAGCTTATGAAGTCAGG - Intergenic
944595919 2:201260524-201260546 AGCAAACGTCTAATGAAGGACGG - Intronic
944855860 2:203766014-203766036 AGGAAAAGGCTTATGAATAATGG + Intergenic
946049749 2:216852620-216852642 AGAAAATGGGGTACGAAGGAGGG - Intergenic
947448617 2:230184252-230184274 AAAAAACTGCTTATAAAGGGGGG + Intronic
1169745046 20:8935080-8935102 AGAAAACGGCCCAGGAAGGCTGG - Intronic
1169920190 20:10726759-10726781 AGAAAACGGCTATTCTAGGATGG + Intergenic
1175639285 20:60614025-60614047 AGGAAAGGGCTTATGAGGGTTGG - Intergenic
1177000208 21:15603316-15603338 AGAAATCTGCTTTTGAAGGTAGG + Intergenic
1178759236 21:35384785-35384807 GGAAAAGGCCTTATGGAGGAGGG - Intronic
1182247003 22:28966653-28966675 AGAAAAAAGCTTATGAAATAAGG + Intronic
1182427205 22:30280438-30280460 AGAAAAAAGCTTATGCAGTAAGG + Intergenic
1182939654 22:34263367-34263389 AGAAAACTGCTTATGAAGAGAGG + Intergenic
1184044418 22:41963817-41963839 AGAAAGTGGCTTTTCAAGGAAGG + Intergenic
950063526 3:10092400-10092422 AGAAAAGGGGTTATCCAGGATGG - Intronic
950353098 3:12376477-12376499 TGAAACAGGCTTATGGAGGAGGG - Intronic
951736235 3:25868117-25868139 AAAAAAGGGCATAGGAAGGAAGG + Intronic
951945411 3:28130405-28130427 AGAAAACTGCTTATGAGGCCAGG - Intergenic
952983558 3:38757801-38757823 TGAAGATGGCCTATGAAGGAAGG + Intronic
953034723 3:39201798-39201820 AGCAAACGCCTGATGAATGAGGG + Intergenic
955600036 3:60635430-60635452 AGAAAACGGCTTATGAAGGAGGG - Intronic
956112368 3:65882319-65882341 AGAAATCGCCTTAGGAAGGTAGG + Intronic
956419694 3:69074238-69074260 AGGAAAGGGTTTATGGAGGATGG - Intronic
956996732 3:74834367-74834389 AGAAAAAGGCTTATCAAATAAGG - Intergenic
957589593 3:82178621-82178643 ATAAATTGGCTTATGAAGGATGG + Intergenic
960106539 3:113803945-113803967 TGAAGAAGGCTTCTGAAGGAGGG - Intronic
967101502 3:186219747-186219769 AAAAAAAGGCTGAGGAAGGAGGG + Intronic
967507686 3:190271541-190271563 AGAAAACAGCAAATGCAGGAAGG - Intergenic
970477818 4:16441523-16441545 AGGAAAAGGCTCAGGAAGGAAGG + Intergenic
970859204 4:20682644-20682666 AGAGAAAGGCTCATGAGGGAGGG + Intergenic
972802266 4:42489346-42489368 AGAGAATGCCTTATAAAGGAGGG - Intronic
977453267 4:97225556-97225578 ATAAAACGGCCTAAGAAGGCAGG - Intronic
977597683 4:98901532-98901554 AGAAGAATGCCTATGAAGGATGG - Intronic
980867410 4:138569550-138569572 AGAAAAAGGCTTATAGAAGAAGG - Intergenic
984332415 4:178341773-178341795 AGAAAACGTTTAATGAAAGACGG + Intergenic
985125225 4:186687022-186687044 AGATAAAGGCTAATGAGGGATGG - Intronic
985804722 5:2034223-2034245 AGAAAAATGCTTGTGAATGAAGG - Intergenic
990244764 5:53853660-53853682 AGAAATAGGCTTCTGAAGGTCGG - Intergenic
993254364 5:85569695-85569717 AGAATATGACTTCTGAAGGATGG + Intergenic
994013088 5:94930913-94930935 TGAAAAAGGCTTATTAAGGAAGG - Intronic
994848169 5:105017505-105017527 ATAAAACGCCTCAAGAAGGAAGG + Intergenic
996167607 5:120244503-120244525 AGAAAGCTCCCTATGAAGGAGGG + Intergenic
997613229 5:135229652-135229674 AGAAAGAGGCTGATGAATGATGG - Intronic
998449054 5:142220408-142220430 AGAAATCTGCATATGAAGCAGGG + Intergenic
999739019 5:154535096-154535118 AGGAAGTGGCTTTTGAAGGATGG + Intergenic
1000703806 5:164486577-164486599 AGAAAACTGGTTTAGAAGGATGG + Intergenic
1005586828 6:27285056-27285078 AGAAATCGGCTGATGAGAGATGG - Intergenic
1008860814 6:56147973-56147995 AGAAGACAGCCTATGAGGGAGGG - Intronic
1010515205 6:76764216-76764238 ATAAAACAGATTATGAGGGAAGG - Intergenic
1011952366 6:92982598-92982620 AGAAAACTGTTAATGAAGGTTGG + Intergenic
1012848109 6:104415004-104415026 ATAAATCTGCTTTTGAAGGAGGG - Intergenic
1013165099 6:107583025-107583047 AGACAATGGCTTAACAAGGAGGG - Intronic
1014107808 6:117586808-117586830 AGAAAAGGTCTTATGAAGAATGG - Intronic
1014117301 6:117679885-117679907 AGAAAATGGCTTGTGTAGAAAGG + Intronic
1017468258 6:154715088-154715110 AGAAAACGGATTAAGACAGAGGG + Intergenic
1020659392 7:10965044-10965066 AGAAAAAGGCTTCAGAAGGTCGG - Intergenic
1021439337 7:20660502-20660524 GGAAAATGGCTTATGGAGAAGGG + Intronic
1022068828 7:26889275-26889297 AGAAAACAGCTGAAGCAGGAAGG - Intronic
1026438470 7:70421133-70421155 AGAAAAAGGCATAAGAAGGTAGG + Intronic
1027737290 7:81949810-81949832 ATAAAATGCCTTATGAAGAACGG - Exonic
1032282558 7:130516312-130516334 AGAAAACTGGTTTTGAATGAGGG + Intronic
1033709153 7:143921195-143921217 AGAAAATCGTTTATGAAGGTGGG + Intergenic
1034074218 7:148216230-148216252 AGGAAAAGGCTGATGCAGGAAGG + Intronic
1035301197 7:157898357-157898379 ACAAAACAGCTGAAGAAGGAAGG + Intronic
1036069782 8:5427923-5427945 AGAAAAGAGCTTTTGAAAGATGG - Intergenic
1037576043 8:20203892-20203914 GGAAAAGAGCTTCTGAAGGACGG - Intronic
1038513527 8:28162968-28162990 AGAAAATGGCAGATGCAGGAAGG - Intronic
1042193969 8:66216049-66216071 AGAAAACTGATTATGAAATAAGG - Intergenic
1042672317 8:71278349-71278371 AGAAAACAGCGTATTAAGGAAGG - Intronic
1043353096 8:79384803-79384825 AGAAAATTGCTTATGTAGTACGG - Intergenic
1043557739 8:81452751-81452773 AGTATAAGGCTTATGAGGGAAGG - Intergenic
1044166971 8:88997146-88997168 AGCAAAGGGCTTATAAAGGAAGG + Intergenic
1044257945 8:90088090-90088112 AGAAAAATGCTGAAGAAGGAAGG - Intronic
1050382290 9:5042646-5042668 AGAAAACGGCCTTTGGATGAGGG - Intronic
1051751609 9:20348480-20348502 CGAATACAGCTTATGAAAGATGG + Intronic
1052381073 9:27771543-27771565 AGAAAATAGCATATGAATGAAGG - Intergenic
1052743313 9:32415162-32415184 AGGAGAGGGCTTATAAAGGATGG + Intronic
1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG + Intronic
1055700039 9:78934134-78934156 AGAAAAAGTCTCAGGAAGGAAGG + Intergenic
1056844666 9:90026763-90026785 AGAAATAGGCTGGTGAAGGAAGG - Intergenic
1056899569 9:90585149-90585171 AGAAAAGGGCCCAGGAAGGATGG + Intergenic
1057894942 9:98901635-98901657 AGAAAACCGCGTAGGAATGATGG - Intergenic
1058415487 9:104784585-104784607 AGAAAACTGTGTGTGAAGGAGGG + Intronic
1059977824 9:119736810-119736832 AGGAAGCGGATTGTGAAGGAAGG + Intergenic
1062187003 9:135223577-135223599 AGAGAAGGGCGTATGCAGGAGGG + Intergenic
1190313015 X:49130636-49130658 TGAAAAAGGATTGTGAAGGATGG + Intergenic
1190474940 X:50816903-50816925 AGGAAACTGCATATCAAGGAAGG + Intergenic
1190714619 X:53093222-53093244 GGAAAACTGTTTAAGAAGGAAGG - Intergenic
1193413501 X:81194727-81194749 AGATCACAGCTTATGAAGAATGG + Intronic
1195568659 X:106374819-106374841 AGAATACAGCTAATGAGGGAAGG + Intergenic
1195669512 X:107457804-107457826 AGAAAAGCCTTTATGAAGGAGGG - Intergenic
1199281941 X:146011585-146011607 AGAAAACAGCTTATGGAATAAGG + Intergenic
1201664618 Y:16435940-16435962 TGAGAAAGGCTTATGAAGGCAGG - Intergenic