ID: 955600036

View in Genome Browser
Species Human (GRCh38)
Location 3:60635430-60635452
Sequence AGAAAACGGCTTATGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955600036_955600048 28 Left 955600036 3:60635430-60635452 CCCTCCTTCATAAGCCGTTTTCT 0: 1
1: 0
2: 1
3: 15
4: 166
Right 955600048 3:60635481-60635503 CTTTCCCCACCTCTACTACCTGG 0: 1
1: 0
2: 2
3: 23
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955600036 Original CRISPR AGAAAACGGCTTATGAAGGA GGG (reversed) Intronic