ID: 955600638

View in Genome Browser
Species Human (GRCh38)
Location 3:60641841-60641863
Sequence CTATTTTCAGAGGTGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 566}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955600633_955600638 28 Left 955600633 3:60641790-60641812 CCTGACAGGACACAGATGTCATA 0: 1
1: 0
2: 0
3: 30
4: 232
Right 955600638 3:60641841-60641863 CTATTTTCAGAGGTGGAGGTTGG 0: 1
1: 0
2: 4
3: 42
4: 566
955600634_955600638 3 Left 955600634 3:60641815-60641837 CCTCTGCAACTTTGAAGAGAAAT 0: 1
1: 0
2: 1
3: 26
4: 272
Right 955600638 3:60641841-60641863 CTATTTTCAGAGGTGGAGGTTGG 0: 1
1: 0
2: 4
3: 42
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955600638 Original CRISPR CTATTTTCAGAGGTGGAGGT TGG Intronic
900216217 1:1483046-1483068 GCATTTTCGGAGGCGGAGGTGGG + Intronic
901375446 1:8835067-8835089 GCATTTTGAGAGGTGGAGGTGGG + Intergenic
901399533 1:9006496-9006518 ACATTTTGAGAGGTGGAGGGAGG - Intronic
901542044 1:9924598-9924620 GTACTTTGGGAGGTGGAGGTGGG - Intronic
901755162 1:11437009-11437031 AAATTTCCAGAAGTGGAGGTGGG + Intergenic
902006887 1:13239207-13239229 GCACTTTCAGAGGTTGAGGTGGG + Intergenic
902667272 1:17948483-17948505 GCTTTTTCAGAGGTGGGGGTTGG + Intergenic
902769052 1:18635092-18635114 CCTGCTTCAGAGGTGGAGGTGGG - Exonic
902858467 1:19226818-19226840 GCATTTTGAGAGGTCGAGGTGGG - Intronic
902862393 1:19255783-19255805 CTAATTTCAGTAATGGAGGTAGG + Intronic
903300709 1:22376677-22376699 CGATTCTCAGTGTTGGAGGTGGG + Intergenic
903523288 1:23972160-23972182 CTACTTTGGGAGGTTGAGGTGGG + Intronic
903583679 1:24391878-24391900 CTAATTTAAGAGCTGGAGGGGGG - Intronic
904001397 1:27341063-27341085 GTACTTTAAGAGGTCGAGGTGGG - Intergenic
904953475 1:34263195-34263217 TCATATTCAGAGGTGGAGGTCGG + Intergenic
905057594 1:35109276-35109298 CAACTTTCAGAGGTTGAGGCGGG - Intronic
905076124 1:35271849-35271871 CGCTATTCAGAGGTTGAGGTGGG + Intronic
905432427 1:37934176-37934198 CACTTTTGAGAGGTTGAGGTGGG - Intronic
906172428 1:43738606-43738628 CTACTTCGAGAGGTTGAGGTAGG - Intronic
906363884 1:45189066-45189088 AAATTTTGAGAGGTTGAGGTGGG + Intronic
906547431 1:46629945-46629967 CTCTTTTCTGAGCTGGAGTTGGG + Intergenic
907183887 1:52594362-52594384 ATATTTTCAGAGGTTGGGGGTGG - Intergenic
907544328 1:55246451-55246473 CTATTTACAGAGGTGAAGCCAGG + Intergenic
909114107 1:71513281-71513303 CTTTTTTGAGAGGTGGAGGTAGG - Intronic
909506948 1:76402984-76403006 ATAGTTTGAGAGGAGGAGGTTGG - Intronic
909605721 1:77506377-77506399 CTCTGTTCAGAGATGGGGGTAGG + Intronic
909986768 1:82170679-82170701 GTACTTTCGGAGGTTGAGGTGGG - Intergenic
910242597 1:85103638-85103660 GCATTTTCAGAGGCCGAGGTGGG + Intronic
911227219 1:95319297-95319319 CTATTTTCAATGGTGGGGGTGGG + Intergenic
911280594 1:95922624-95922646 GTGCTTTCAGAGGTTGAGGTGGG - Intergenic
911721096 1:101192084-101192106 CCACTTGCAGAGGTGAAGGTTGG - Intergenic
912705081 1:111905600-111905622 CTGCTTCCAGAGGTGGAGGCTGG + Intronic
912706900 1:111921429-111921451 CCATTTACAGAGGTAGAGGCAGG + Intronic
912797703 1:112702901-112702923 TCATCTTCAGAGGTGGGGGTGGG - Intronic
915044763 1:153003095-153003117 ATATTTCCTGAGGTGGAGGCTGG - Exonic
916028943 1:160859958-160859980 CACTTTTGAGAGGCGGAGGTGGG + Intronic
917023323 1:170614073-170614095 CTCTCTTCAGAGCTGGAAGTCGG + Intergenic
917565799 1:176210350-176210372 GTACTTTGAGAGGTTGAGGTAGG + Intergenic
917869721 1:179230013-179230035 CTCATTTGACAGGTGGAGGTGGG - Intergenic
919286176 1:195563116-195563138 GTATTTTCAGAGGCTGAGGAGGG + Intergenic
919528973 1:198691782-198691804 ATATTTCCAGAGTTGGTGGTTGG - Intronic
920323132 1:205139988-205140010 GTACTTTCAGAGGCTGAGGTGGG - Intergenic
920548215 1:206836418-206836440 GTGTTTTCTGGGGTGGAGGTGGG + Intronic
920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG + Intergenic
921857943 1:220008920-220008942 GCACTTTGAGAGGTGGAGGTGGG - Intronic
922213553 1:223503117-223503139 GCACTTTCAGAGGTGGAGGCAGG - Intergenic
922393067 1:225167784-225167806 CTATTCTCAGAGACAGAGGTTGG + Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
924423424 1:243930523-243930545 CAAGATTCAAAGGTGGAGGTTGG - Intergenic
924715463 1:246568813-246568835 GCACTTTGAGAGGTGGAGGTCGG - Intronic
1063935609 10:11074789-11074811 ATATTTTCCTAGGTAGAGGTTGG - Intronic
1064405965 10:15063375-15063397 ACATTTTGAGAGGCGGAGGTGGG - Intronic
1064553913 10:16529278-16529300 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
1064860806 10:19823435-19823457 CTTTTTTGGGAGGTGGAGGTGGG + Intronic
1065591314 10:27264956-27264978 CACTTTTGAGAGGCGGAGGTGGG + Intergenic
1065678251 10:28201782-28201804 CTATTTTCTGAGGTCAAGGATGG - Intronic
1065723833 10:28651286-28651308 GCATTTTCAGAGGCTGAGGTGGG - Intergenic
1065776388 10:29124232-29124254 TTATTTTGAGAGGCTGAGGTGGG + Intergenic
1066329491 10:34404418-34404440 GCATTTTCAGAGGCTGAGGTGGG + Intronic
1066358169 10:34705216-34705238 CACTTTTGAGAGGTGGAGGCAGG + Intronic
1066631807 10:37465609-37465631 CTATTTTCTGAGATGGAGTCTGG - Intergenic
1068382986 10:56282870-56282892 CTACTTTGGGAGGCGGAGGTAGG - Intergenic
1069132947 10:64728915-64728937 CAATGGTCAGAGGTGGAGGAAGG + Intergenic
1069181727 10:65369600-65369622 CTATTTACAGAGCTGTAGATAGG + Intergenic
1069502730 10:68968397-68968419 ATGCTTTCAGAGGTGGAGGCAGG - Intronic
1070499109 10:77053768-77053790 CTTTCTTAAGAGATGGAGGTAGG - Intronic
1070889092 10:79928804-79928826 GTATTTTTAGAGGTGGGGTTTGG - Intergenic
1071688750 10:87792609-87792631 ATTTTTTTAGAGGTGGGGGTGGG - Intronic
1072102067 10:92239169-92239191 CCATTATCAGAGGATGAGGTTGG - Intronic
1072126610 10:92451160-92451182 AGATTTTCAGAGGTGGAAATAGG - Intergenic
1072227946 10:93387467-93387489 CCATTTTCAGAGGTGGCTGGTGG - Intronic
1073141610 10:101252242-101252264 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
1073808627 10:107127779-107127801 TCACATTCAGAGGTGGAGGTGGG - Intronic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1075008158 10:118845251-118845273 CTCTTTGAAGAGGAGGAGGTGGG + Intergenic
1078227132 11:9402475-9402497 GTACTTTCAGAGGTCGAGGCGGG + Intronic
1078235760 11:9483238-9483260 GCATTTTCAGAGGCTGAGGTGGG - Intronic
1078432004 11:11295314-11295336 CCATTTTCAAAGGTGTGGGTAGG + Intronic
1078861867 11:15256012-15256034 CTATTTTAAGAGTTGATGGTGGG - Intergenic
1080268057 11:30422287-30422309 CTGTGTTCAGAGGTGCAGGTTGG - Intronic
1080347647 11:31343017-31343039 GTATTTTCAGAGGCCAAGGTGGG + Intronic
1082750376 11:57008344-57008366 CCATTTTCAGTGGTAGAGGGGGG + Intergenic
1083242902 11:61403051-61403073 CCATGTTCTGAAGTGGAGGTGGG + Exonic
1083305026 11:61757643-61757665 CAAATCTCAGAGGGGGAGGTGGG - Intronic
1083835705 11:65265722-65265744 GTATTTTGTGAGGTTGAGGTGGG - Intronic
1084726930 11:70947976-70947998 CTAGCTGCAGAGGTGGGGGTGGG - Intronic
1086305594 11:85478266-85478288 CCATTTTAAAAGGTTGAGGTGGG - Intronic
1086716540 11:90069356-90069378 CTTTTTTGGGAGGTCGAGGTGGG - Intergenic
1087424002 11:97967045-97967067 CCATTCTCTGAGCTGGAGGTGGG + Intergenic
1088202662 11:107356789-107356811 GCATTTTGGGAGGTGGAGGTGGG + Intronic
1088250276 11:107856446-107856468 CTACTTTGGGAGGCGGAGGTGGG + Intronic
1088472275 11:110199059-110199081 GCACTTTCAGAGGTGGAGGCAGG - Intronic
1088632611 11:111788495-111788517 ATATTTTGAGAGGCTGAGGTGGG + Intronic
1089830812 11:121326362-121326384 CCTTCTTCAGAGGTAGAGGTGGG - Intergenic
1090429937 11:126637182-126637204 CTATTTTTGGAGGTGGAGAATGG + Intronic
1090591933 11:128280612-128280634 CCACTTTGGGAGGTGGAGGTGGG - Intergenic
1090691070 11:129182678-129182700 CTATTTCCAGGGCTGGAGGGCGG + Intronic
1091721459 12:2817036-2817058 CTACTTTGGGTGGTGGAGGTGGG - Intronic
1092150296 12:6243451-6243473 CTACATTCACAGGTAGAGGTAGG + Intergenic
1092745499 12:11668830-11668852 CTATCTTCAGAGCAGGATGTTGG + Intronic
1092765816 12:11851745-11851767 CAAATTTCAAAGGTAGAGGTAGG + Intronic
1093079742 12:14795786-14795808 ATATATCCAGTGGTGGAGGTTGG + Intronic
1093550857 12:20409072-20409094 CTATTGACAGAAGTGGAGGCAGG + Intronic
1093602152 12:21040671-21040693 CTGTTGTCAGAGGGGGAGTTTGG + Intronic
1094149867 12:27270758-27270780 GTAATTTGGGAGGTGGAGGTGGG - Intronic
1094359017 12:29609893-29609915 CTACTGCCAGAGTTGGAGGTGGG - Intronic
1095267698 12:40179761-40179783 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
1095421136 12:42024980-42025002 CTATTTTCAGAGCTGACAGTGGG + Intergenic
1095587070 12:43861148-43861170 GTATTTTCAGCAGTGGAGGTGGG + Intronic
1095724275 12:45434806-45434828 CTCTTTTCATTGGTGGTGGTGGG + Intronic
1095737329 12:45571922-45571944 CTATTTTCTGATGTGGTGCTTGG - Intergenic
1096374276 12:51095188-51095210 CCGTTTTCAGAGGTGAAGGAAGG + Exonic
1097492380 12:60285912-60285934 TTACTTTGGGAGGTGGAGGTAGG + Intergenic
1097977145 12:65698763-65698785 CTATTTTGGGAGGCTGAGGTGGG + Intergenic
1098153675 12:67574706-67574728 CAATTTTTAGAGGTAGAGTTTGG - Intergenic
1098887389 12:75974432-75974454 ATTTTTTCAGAGGGGGAAGTTGG - Intergenic
1100544590 12:95589728-95589750 CTACTTTCAGAGGCCGAGGTGGG - Intergenic
1102284252 12:111642447-111642469 CTGTTTTCCCAGGTGGTGGTGGG + Exonic
1102600249 12:114024388-114024410 CTACTTTCAGGGGCTGAGGTGGG + Intergenic
1102985786 12:117277480-117277502 CTACTTGCAGGGGTTGAGGTGGG + Intronic
1104752448 12:131248316-131248338 CTATTTACAGAGGTCCAAGTAGG + Intergenic
1104779487 12:131410912-131410934 CTATTTACAGAGGTCTAGGTAGG - Intergenic
1105346323 13:19575817-19575839 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
1105420344 13:20246748-20246770 CAATTTTCAGTGGATGAGGTAGG + Intergenic
1106307580 13:28527153-28527175 ACATTTTGGGAGGTGGAGGTGGG + Intergenic
1106671900 13:31915035-31915057 CGATAGGCAGAGGTGGAGGTGGG + Intergenic
1106985264 13:35339881-35339903 TAATTTCCAGTGGTGGAGGTGGG - Intronic
1107418255 13:40221284-40221306 CTATTTTCAGAGGTGGGCAGTGG - Intergenic
1107690775 13:42950801-42950823 CTAATTTGGGAGGTGGGGGTAGG + Intronic
1107694433 13:42986496-42986518 GTACTTTGAGAGGTCGAGGTGGG + Intronic
1108363730 13:49690701-49690723 CATTTTACAGAGGTGAAGGTAGG - Intronic
1108404529 13:50086675-50086697 ATAGTTTCAGAGGTGGATGATGG + Intronic
1108678152 13:52755933-52755955 TGATTTTCAGTGTTGGAGGTGGG - Intergenic
1108819923 13:54335983-54336005 GCATTTTCAGAGGCCGAGGTAGG - Intergenic
1109550874 13:63897865-63897887 CCCTTTTCAGAGGTAAAGGTTGG + Intergenic
1110847274 13:80204285-80204307 AGACTTTCAGAGGCGGAGGTGGG + Intergenic
1111423058 13:88042867-88042889 ATGTTTTCAGAGCTGGAGATTGG + Intergenic
1112884419 13:104151199-104151221 CTATTCTCTGAGGTGGTGTTAGG + Intergenic
1113634820 13:111912362-111912384 ATACTTTGAGAGGTTGAGGTGGG - Intergenic
1113680453 13:112240091-112240113 CAATTCTCAGTGTTGGAGGTGGG - Intergenic
1115414763 14:33119394-33119416 CTATTTTTAGTGGAGGAGGGAGG + Intronic
1115746132 14:36439691-36439713 TTATTTCCAGAAGTGGGGGTAGG + Intergenic
1115822593 14:37227512-37227534 GTATTTTCACAAGTGGAAGTGGG + Intronic
1116428271 14:44816600-44816622 CTCTTTTCAGTAGTGGAGGCAGG + Intergenic
1116444351 14:44991202-44991224 GCACTTTGAGAGGTGGAGGTGGG - Intronic
1116668330 14:47807765-47807787 CTATTTCCAGAGGTAGGGTTAGG - Intergenic
1116983010 14:51190962-51190984 CTAGTTGCATAGGAGGAGGTGGG + Intergenic
1117308479 14:54498993-54499015 CTCTTTTCAGAGGTTGAGTCAGG - Intergenic
1117583145 14:57173004-57173026 ATATTTTCAGAGCTGGGAGTCGG - Intergenic
1117917970 14:60698574-60698596 GTACTTTCAGAGGCTGAGGTGGG - Intergenic
1118985825 14:70753811-70753833 CTAGGATCAGAGGTGGAGGAGGG + Intronic
1119305427 14:73604409-73604431 GCATTTTCAGAGGCCGAGGTGGG - Intergenic
1119530420 14:75356455-75356477 CTTTTATTAGAAGTGGAGGTAGG + Intergenic
1120131946 14:80818263-80818285 CCACTTTGGGAGGTGGAGGTGGG - Intronic
1120344064 14:83261739-83261761 CTATTATCAGAGATGAAGGTGGG - Intergenic
1120438831 14:84511127-84511149 GCACTTTGAGAGGTGGAGGTAGG + Intergenic
1120991209 14:90379047-90379069 GTACTTTGGGAGGTGGAGGTGGG - Intergenic
1123701854 15:22920043-22920065 CCATTTTCAGATGTTGAAGTAGG - Intronic
1123760036 15:23424866-23424888 CTCTTCTAAGAGGTGGAGTTAGG + Intergenic
1125431566 15:39599905-39599927 CTATTTTCAGAGGTATTGATAGG - Intergenic
1125812330 15:42551947-42551969 CTATTTACAGACTTGTAGGTTGG + Intronic
1125995967 15:44161318-44161340 CTATACTCAGAGGTGCAGGCAGG - Intronic
1126484406 15:49164077-49164099 CTATTTATAGAGATGGAGGCAGG + Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127175159 15:56346295-56346317 CATTCTTCAGAGGAGGAGGTGGG + Intronic
1128194911 15:65744007-65744029 CTATGTTGAGAAGTGGGGGTGGG + Intronic
1128245006 15:66127109-66127131 CACTTTACAGAGGTGGAAGTAGG + Intronic
1128296169 15:66521738-66521760 CCACTTTGGGAGGTGGAGGTGGG - Intronic
1129733927 15:77949149-77949171 ACATTTTCAGAGGCGGAGGGAGG - Intergenic
1129996992 15:80015471-80015493 CTATTCCCAGTGTTGGAGGTGGG - Intergenic
1130290767 15:82598536-82598558 GTATTTTGGGAGGCGGAGGTGGG + Intronic
1130615236 15:85400151-85400173 GCATTTTGAGAGGTTGAGGTGGG + Intronic
1130848887 15:87774275-87774297 CTTTGTTTAGAGGTGGAGATGGG - Intergenic
1130952413 15:88603606-88603628 GCATTTTAAGAGGTGGAGGTGGG - Intergenic
1131025984 15:89141912-89141934 ATATTTTTAAAGGTAGAGGTTGG + Intronic
1134158002 16:11859748-11859770 GCATTTTGAGAGGCGGAGGTGGG - Intergenic
1134288174 16:12880512-12880534 GTACTTTGAGAGGCGGAGGTGGG + Intergenic
1134292704 16:12915212-12915234 ACACTTTGAGAGGTGGAGGTGGG + Intronic
1134456304 16:14398017-14398039 CTCTTCTAAGAGGTGGAGTTAGG - Intergenic
1134587199 16:15422032-15422054 GCATTTTGAGAGGTGGAGGTGGG + Intronic
1134867253 16:17619618-17619640 CTAATCTCAGAGGTGGTGATGGG + Intergenic
1135003197 16:18794368-18794390 TTATTTTCTGAGGTGGAAGAGGG - Intronic
1135033003 16:19053927-19053949 GTGCTTTGAGAGGTGGAGGTGGG - Intronic
1135035485 16:19073380-19073402 CTAATTTGAGAGGCCGAGGTGGG + Intronic
1135700817 16:24630925-24630947 CTGTTTGCTGGGGTGGAGGTGGG + Intergenic
1136359652 16:29770585-29770607 CTATTTGAAGAGGAGGAGCTGGG + Intergenic
1136362244 16:29788397-29788419 ATTTTTTAAGAGATGGAGGTAGG + Intergenic
1136464599 16:30433604-30433626 GCAGTTTCAGAGGTGGAGGCAGG + Intergenic
1137405996 16:48189923-48189945 CTAATCTCAGAGGTGGGAGTGGG - Intronic
1138816792 16:60211875-60211897 CTATTTTCAGAAGGAGAGTTAGG + Intergenic
1139164061 16:64545463-64545485 GTATTTTTAGAGTTGGAGGCAGG + Intergenic
1139897298 16:70297963-70297985 GCATTTTGGGAGGTGGAGGTGGG - Intronic
1140510990 16:75508457-75508479 CTTTTTTCATTGGTGGAGGAAGG - Intergenic
1140711181 16:77678810-77678832 ATACTTTGGGAGGTGGAGGTGGG + Intergenic
1140712146 16:77688644-77688666 TTACTTTGGGAGGTGGAGGTGGG - Intergenic
1140840773 16:78836902-78836924 CTTTTTTCAGAGTCAGAGGTTGG + Intronic
1142518162 17:446807-446829 GCATTTTGGGAGGTGGAGGTGGG + Intergenic
1142534829 17:606874-606896 GTTTTTCCAGAGGTGGGGGTGGG - Intronic
1142861200 17:2762920-2762942 GTACTTTCAGAGGCTGAGGTAGG - Intergenic
1143227681 17:5321061-5321083 ATATTTTGGGAGGTTGAGGTGGG + Intronic
1143521749 17:7448136-7448158 GTATTTTGGGAGGTGGAGGCGGG + Intronic
1144544961 17:16185717-16185739 CTATTTTGGGAGGTAGGGGTGGG + Intronic
1144720735 17:17468153-17468175 CTAGTTTCCTAGGTGGAAGTTGG - Intergenic
1145036657 17:19545600-19545622 CTATTTCCAGAGGCTGAGGTGGG - Intronic
1147012809 17:37465034-37465056 CTACTTTGGGAGGTTGAGGTAGG + Intronic
1147803335 17:43110726-43110748 CCATTTTGGGAGGTGGAGGTGGG + Intronic
1148590898 17:48816277-48816299 TTGTTTTAAGAGATGGAGGTGGG - Intronic
1149444776 17:56705114-56705136 CTATCTACAGAGGCGGAGGATGG + Intergenic
1149775804 17:59356053-59356075 CTATTTTCCAAGGAGGAGGCTGG - Intronic
1150110256 17:62492849-62492871 CTATTTTGGGAGGCCGAGGTGGG + Intronic
1151495747 17:74457212-74457234 ACCTTTTCAGTGGTGGAGGTGGG + Intergenic
1151902634 17:77026993-77027015 CCATCTTCAGAGGAGGGGGTTGG + Intergenic
1152789437 17:82270952-82270974 GTAATTCCAGAGGTGGAGGGTGG - Intronic
1152871329 17:82754767-82754789 GTGTGTTCAGATGTGGAGGTGGG + Intronic
1153068441 18:1076491-1076513 ACACTTTCGGAGGTGGAGGTGGG + Intergenic
1153305462 18:3626657-3626679 CTACTTTGGGAGGTGGAGGTGGG + Intronic
1153316890 18:3731653-3731675 GCATTTTGGGAGGTGGAGGTGGG - Intronic
1153414548 18:4832217-4832239 CTGCTTTCAGAGGTGTAGGCAGG - Intergenic
1153825835 18:8874041-8874063 AAATAATCAGAGGTGGAGGTGGG - Intergenic
1154482074 18:14840289-14840311 ATATTTTCGGAGGGCGAGGTGGG + Intronic
1155291860 18:24350451-24350473 CTTTTTTTAGGGGTGGGGGTAGG + Intronic
1157043325 18:44065054-44065076 TTATTTTGAGTGGTGGGGGTGGG - Intergenic
1157771778 18:50354680-50354702 GTATTTTGAGAGGCTGAGGTGGG + Intergenic
1158092435 18:53729570-53729592 CTGTTTTCAGATTTGGAAGTAGG + Intergenic
1159040172 18:63317921-63317943 CTTTGTCCAGAGGAGGAGGTAGG + Intronic
1159857998 18:73612787-73612809 CTATTTACAGAGGTGTGGGTGGG + Intergenic
1161193772 19:2974742-2974764 GTACTTTGGGAGGTGGAGGTGGG + Intergenic
1161990183 19:7680444-7680466 GCATTTTCGGAGGCGGAGGTGGG - Intronic
1162058929 19:8083045-8083067 GTATTTTGGGAGGTCGAGGTGGG - Intronic
1162836993 19:13326537-13326559 CTGCTTTGGGAGGTGGAGGTAGG + Intronic
1162940314 19:14005687-14005709 CTGGTTCCCGAGGTGGAGGTTGG + Intronic
1165024543 19:32950099-32950121 CCACTTTGGGAGGTGGAGGTGGG - Intronic
1165134252 19:33656645-33656667 CTATTTTGGGAGGCTGAGGTGGG - Intronic
1165485963 19:36096347-36096369 CCACTTTGAGAGGTCGAGGTGGG - Intronic
1167253158 19:48411944-48411966 CTATGTTGGGAGGTTGAGGTGGG + Intronic
1167663299 19:50809016-50809038 CTAAGTCCAGAGGTGGAGGCAGG - Intergenic
1167858173 19:52259811-52259833 GCACTTTGAGAGGTGGAGGTAGG - Intergenic
925072609 2:983064-983086 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072633 2:983245-983267 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072649 2:983351-983373 GAAGTTGCAGAGGTGGAGGTCGG + Intronic
926067993 2:9859630-9859652 GCACTTTGAGAGGTGGAGGTGGG - Intronic
927595488 2:24393193-24393215 CTATTTACAGAGGTGTGGGCAGG - Intergenic
927732333 2:25485252-25485274 GCATTTTGGGAGGTGGAGGTGGG - Intronic
927870203 2:26618544-26618566 CTACTTTAGGAGGTCGAGGTGGG - Intronic
928164844 2:28963072-28963094 GCATTTTCAGAGGCTGAGGTGGG - Intronic
928436371 2:31257173-31257195 CTGTTTGCAGAGGTGGGGGTTGG + Intronic
928762873 2:34605264-34605286 CAATTTTCAGAAGTAGAGGTAGG + Intergenic
929693084 2:44090738-44090760 CTATTTACAAAGGTGCAGGCAGG - Intergenic
930073101 2:47384348-47384370 CCACTTTCAGAGGCTGAGGTGGG - Intronic
930330808 2:49980717-49980739 CTAATTGCAGCAGTGGAGGTAGG - Intronic
930417079 2:51102850-51102872 CCACTTTGAGAGGTGGAGGTGGG + Intergenic
930653010 2:53980996-53981018 GCATTTTATGAGGTGGAGGTGGG - Intronic
931686435 2:64797868-64797890 ATATTTTCAAATGTGGACGTTGG + Intergenic
931841179 2:66150582-66150604 CTAGTTTCTGTTGTGGAGGTAGG + Intergenic
932866481 2:75348229-75348251 CTGTTTTCAGAGGTGAGGGGAGG + Intergenic
934100454 2:88648392-88648414 GCACTTTCGGAGGTGGAGGTGGG + Intergenic
935078817 2:99772084-99772106 TTGTTTTCTGAGGTGGAGGATGG - Intronic
935149270 2:100418872-100418894 ACATTTTGAGAGGCGGAGGTAGG + Intergenic
935585390 2:104796219-104796241 CTGTTTACAGAGGTGGAGTGAGG + Intergenic
936140126 2:109932233-109932255 CTACTTACAAAGGTGGGGGTGGG - Intergenic
936176815 2:110230178-110230200 CTACTTACAAAGGTGGGGGTGGG - Intergenic
936204570 2:110439253-110439275 CTACTTACAAAGGTGGGGGTGGG + Intronic
936649976 2:114414497-114414519 GTATTTTTGGAGGTCGAGGTGGG - Intergenic
937404636 2:121615548-121615570 GCATTTTCAGAGGCTGAGGTGGG + Intronic
937540367 2:122943737-122943759 ATATTTTCAGAGACAGAGGTGGG + Intergenic
937640495 2:124205646-124205668 GCATTTTGGGAGGTGGAGGTGGG - Intronic
938692481 2:133805085-133805107 TTATTATCAGTGTTGGAGGTGGG - Intergenic
938848687 2:135238167-135238189 TTAGTTTCAGAGGTGGAGTTGGG + Intronic
940957930 2:159749592-159749614 GTACTTTGAGAGGTGGAGGCAGG - Intronic
941002491 2:160216694-160216716 CCATTTAGGGAGGTGGAGGTTGG - Intronic
941065655 2:160899723-160899745 CTATTCACAGAGGTGTGGGTAGG + Intergenic
941543492 2:166816114-166816136 CTGGTTTCTGAAGTGGAGGTTGG + Intergenic
941814131 2:169783554-169783576 GTACTTTCAGAGGCTGAGGTGGG + Intergenic
942477251 2:176340401-176340423 GCACTTTGAGAGGTGGAGGTGGG - Intergenic
943585508 2:189734715-189734737 ATATTTTGGGAGGTCGAGGTGGG + Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
943804257 2:192102815-192102837 ATACTTTCGGAGGTTGAGGTGGG - Intronic
943907775 2:193521654-193521676 CTAGTCTCACAGTTGGAGGTTGG + Intergenic
944389477 2:199202684-199202706 TTATTTAGAGAGGTGGAGATAGG - Intergenic
945442378 2:209895428-209895450 CTATTTTCAAAGGCGAGGGTGGG - Intronic
945806162 2:214492258-214492280 CTATCCCCAGAGGTAGAGGTTGG + Intronic
946014857 2:216595670-216595692 GCATTTTGAGAGGTCGAGGTGGG - Intergenic
947309785 2:228788800-228788822 CTACAGTCAGTGGTGGAGGTGGG + Intergenic
948060386 2:235039182-235039204 GTAATTTCACAGGAGGAGGTAGG + Intronic
948674648 2:239589745-239589767 CTATTGGCAGGGATGGAGGTAGG + Intergenic
1169251148 20:4062401-4062423 TGATTTTGAGAGGTGGAGGAAGG + Intergenic
1169335322 20:4751219-4751241 GCAGTTTGAGAGGTGGAGGTAGG - Intergenic
1171089147 20:22267718-22267740 CTGTTTTCAGAGGAGCAGTTTGG - Intergenic
1171254251 20:23675267-23675289 GTATTTTGAGAGGCTGAGGTGGG - Intergenic
1171260752 20:23730529-23730551 GTATTTTGAGAGGCTGAGGTGGG - Intergenic
1171269874 20:23806390-23806412 GTATTTTGAGAGGCTGAGGTGGG - Intergenic
1171507834 20:25653386-25653408 GCACTTTGAGAGGTGGAGGTGGG - Intergenic
1172125977 20:32625597-32625619 GTATTTTGGGAGGTCGAGGTGGG + Intergenic
1172316519 20:33959240-33959262 GCACTTTGAGAGGTGGAGGTGGG + Intergenic
1172423128 20:34834714-34834736 GCACTTTCGGAGGTGGAGGTAGG + Intergenic
1172831334 20:37837728-37837750 AAGTTTTCAGTGGTGGAGGTGGG - Intronic
1173102422 20:40099143-40099165 TAATTTTCAGTGTTGGAGGTTGG - Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173281414 20:41631586-41631608 GCATTTTGGGAGGTGGAGGTGGG + Intergenic
1173766480 20:45614871-45614893 CAATTTTCTAAGGTGCAGGTGGG + Intronic
1173963277 20:47091490-47091512 CCACTTTCAGAGGCCGAGGTGGG + Intronic
1174133456 20:48362234-48362256 CTATTTGCTGAGGTTAAGGTGGG + Intergenic
1174604566 20:51751506-51751528 GCATTTTGAGAGGCGGAGGTGGG - Intronic
1174687081 20:52466333-52466355 CATTTTTGGGAGGTGGAGGTGGG + Intergenic
1174869141 20:54167393-54167415 GCACTCTCAGAGGTGGAGGTGGG + Intronic
1175166180 20:57046485-57046507 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
1175430420 20:58898271-58898293 CTTTTTTCCGTGGTGGTGGTGGG + Intronic
1176798530 21:13396329-13396351 GTATTTTCGGAGGGCGAGGTGGG - Intergenic
1176973472 21:15291308-15291330 CTTTTTTCAGAGTTTGAGCTGGG - Intergenic
1177184330 21:17776678-17776700 CTATTATAAGGGGTGGAGCTGGG - Intergenic
1177597804 21:23267994-23268016 CTATTTGCAGGGGTGGGGATGGG - Intergenic
1177649004 21:23936750-23936772 TGATTTTCAGGGGTGGTGGTGGG + Intergenic
1178101877 21:29278683-29278705 GTACTTTGGGAGGTGGAGGTGGG + Intronic
1178300401 21:31448356-31448378 GTATTTTGAGAGGAGGAGGCGGG + Intronic
1178669356 21:34577349-34577371 GCACTTTGAGAGGTGGAGGTGGG + Intronic
1178814256 21:35913065-35913087 CTATTTCCAGAGGTAAAGATGGG + Intronic
1179076195 21:38123835-38123857 CTATTTACACAGGTGTGGGTGGG - Intronic
1180579224 22:16813614-16813636 ATGTTTCCAGATGTGGAGGTGGG - Intronic
1180997940 22:19974735-19974757 CTATTGTCAGTGGGGGAGGGTGG - Intronic
1181042233 22:20197616-20197638 CTCTTCTCAGAGCTGGAGTTGGG - Intergenic
1181076358 22:20380150-20380172 GTTCTTTCAGAGGTTGAGGTGGG + Intronic
1181562177 22:23711886-23711908 GCATTTTCAGAGGCTGAGGTAGG + Intergenic
1181620255 22:24086258-24086280 CACTTTTCAGATGTGGAAGTAGG - Intronic
1182337777 22:29596477-29596499 GTATTTTGAGAGGCGGAGGCGGG - Intergenic
1182593017 22:31396939-31396961 GTGCTTTCAGAGGTTGAGGTGGG - Intergenic
1182944096 22:34305813-34305835 GCACTTTCAGAGGTCGAGGTGGG + Intergenic
1183296099 22:37030403-37030425 CTTTGTGCAGAGGTGGACGTAGG + Intergenic
1183670905 22:39272094-39272116 ATATTTTCAGGAGTGGTGGTTGG + Intergenic
1185022942 22:48390815-48390837 GTATTTCCAGAGAAGGAGGTTGG + Intergenic
1185399733 22:50609590-50609612 CCAGTTTCAGGGGTGGGGGTGGG + Intronic
949364759 3:3269029-3269051 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
949980183 3:9497864-9497886 GCATTTTCAGAGGCTGAGGTGGG - Intergenic
950351832 3:12362437-12362459 CTAATGCCAGAGGTGGACGTTGG + Intronic
950459413 3:13112349-13112371 CCCTTTTCAGAGGGAGAGGTCGG - Intergenic
951492032 3:23281524-23281546 CTATTCTGAGAGGCTGAGGTGGG + Intronic
951553214 3:23895886-23895908 GTACTTTGGGAGGTGGAGGTGGG + Intronic
952675565 3:36026211-36026233 CTATTTTCAAAAGTGTAAGTAGG - Intergenic
954341021 3:49953884-49953906 GTACTTTGAGAGGTGGAGGCGGG + Intronic
954584718 3:51723172-51723194 TTATTTCCAGAGGGCGAGGTGGG - Intergenic
955485183 3:59427976-59427998 CTAGAGCCAGAGGTGGAGGTGGG + Intergenic
955600638 3:60641841-60641863 CTATTTTCAGAGGTGGAGGTTGG + Intronic
956004260 3:64762066-64762088 ATATTTTGAGAGGTGGAGGAGGG - Intergenic
956101756 3:65775692-65775714 GCATTTTCAGAGGCGGAGGTGGG + Intronic
956463967 3:69500523-69500545 CTACTTGCAGAGGTGTAGGATGG + Intronic
956609814 3:71111250-71111272 CTACTTTCATAGCTGAAGGTGGG - Intronic
956721605 3:72122853-72122875 GCATTTTGGGAGGTGGAGGTGGG + Intergenic
956943042 3:74186133-74186155 CTATTTTCAGATATGGATTTTGG + Intergenic
956952566 3:74299094-74299116 CTATTTGGGGAGGTTGAGGTGGG + Intronic
957249079 3:77750000-77750022 TTTTTTTTAGAGGGGGAGGTGGG + Intergenic
959562258 3:107796095-107796117 CTTCATTCAGAGATGGAGGTTGG - Intronic
959592228 3:108092834-108092856 CAACCTTCAGAGGTGGAGATCGG + Intergenic
960217982 3:115066242-115066264 CTATTTTAGGAGTAGGAGGTTGG - Intronic
960427014 3:117521093-117521115 GTATTTTGAGAGGCCGAGGTGGG + Intergenic
960899986 3:122544568-122544590 ACATTTTCGGAGGTGGAGGCAGG + Intronic
961259960 3:125594594-125594616 TTATTTCCCGAGGTGGAGGTAGG - Intronic
961993372 3:131215752-131215774 CTCTTTGCAGAGGTGGGGATTGG + Intronic
962478569 3:135779035-135779057 CTATTTTGACAGGAAGAGGTAGG + Intergenic
962715115 3:138119013-138119035 CTATTTCCTGAGGTGTAGGAGGG - Intergenic
963137381 3:141919361-141919383 GCATTTTCAAAGGCGGAGGTGGG - Intronic
963611020 3:147468369-147468391 ACATTTTGAGAGGTGGAGGTAGG - Intronic
964639948 3:158898470-158898492 TGATTTTCAGAGGTGGAAGATGG + Intergenic
965026667 3:163311064-163311086 GCACTTTCAGAGGTCGAGGTGGG + Intergenic
965281421 3:166758899-166758921 GTATTTTGGGAGGTTGAGGTTGG - Intergenic
965554922 3:170008876-170008898 GCATTTTGGGAGGTGGAGGTAGG - Intergenic
966121660 3:176528463-176528485 CGATTTCCAGTGTTGGAGGTGGG - Intergenic
966842198 3:184099083-184099105 CTATTTTTAGAAGTGTGGGTGGG - Intronic
967006400 3:185387190-185387212 TGATTTTCAGTGTTGGAGGTGGG + Intronic
967145177 3:186600271-186600293 CCATTTTGGGAGGAGGAGGTGGG + Intergenic
967233277 3:187361127-187361149 CAATTTCCAGAGGTGGACCTGGG + Intergenic
967630990 3:191742815-191742837 CTATTTTGTGAGATGTAGGTAGG + Intergenic
967881475 3:194304886-194304908 GCATTTTTGGAGGTGGAGGTGGG - Intergenic
968281910 3:197483713-197483735 TCATTTTCTGAGGTGGCGGTGGG + Intergenic
968711467 4:2122426-2122448 CTGTGTTCAGAGGTAGAGGAGGG + Intronic
970062353 4:12049554-12049576 CTAGTGTTAGAGGTGGAGGCTGG + Intergenic
970271783 4:14355706-14355728 TTGTTTTCAGTGTTGGAGGTGGG - Intergenic
970973511 4:22014504-22014526 GCATTTTCAGAGGCGGAGGCTGG + Intergenic
971000439 4:22316661-22316683 GAATTTTCAGAGGTGGGCGTGGG - Intergenic
971018678 4:22513400-22513422 GTACTTTGAGAGGTGGAAGTGGG - Intronic
971087380 4:23294611-23294633 CTATTTTCAAAGGTGAAGGCAGG - Intergenic
971754449 4:30689340-30689362 AAAGTTTCAGAGTTGGAGGTTGG - Intergenic
972020356 4:34305544-34305566 CAATTTCCAGTGTTGGAGGTGGG - Intergenic
972367557 4:38390657-38390679 TTATTCTCAGTGTTGGAGGTGGG + Intergenic
972621602 4:40752328-40752350 GTACTTTTGGAGGTGGAGGTGGG + Intronic
973184070 4:47303058-47303080 TTAGTTTGAGAGGTGGTGGTAGG + Intronic
974030192 4:56769773-56769795 GTATTTTGAGAGGCTGAGGTGGG + Intergenic
974587129 4:63894065-63894087 CTATTTTCACAAGTGGAAGAAGG + Intergenic
975172515 4:71248197-71248219 TTATTATCAGGGCTGGAGGTGGG + Intronic
975174875 4:71276799-71276821 GCACTTTGAGAGGTGGAGGTAGG + Intronic
975424169 4:74207144-74207166 ACATTTTGAGAGGTGGAGGCAGG - Intronic
975756557 4:77577583-77577605 CTATTGACAGCAGTGGAGGTAGG + Intronic
975811577 4:78175526-78175548 CTCTTTTCAGAGGTGAGGGCAGG + Intronic
975815153 4:78209572-78209594 CTATTGACAGAGGTGTGGGTAGG - Intronic
975860077 4:78667878-78667900 CTATTCTCAGAGGGGGAAGTGGG - Intergenic
975905726 4:79209797-79209819 ATACTTTCAGAGATGGAGGTGGG + Intergenic
976083266 4:81380000-81380022 CTATTTTAACAAATGGAGGTGGG + Intergenic
976912999 4:90331649-90331671 CTATTTTCAGATTTGGTTGTGGG - Intronic
977045882 4:92069073-92069095 CAATCTTCAGTGTTGGAGGTGGG + Intergenic
977207493 4:94179334-94179356 TTATTTTCAGAGGCCGAGGCAGG - Intergenic
977237824 4:94529509-94529531 CTATTTTAAGATATTGAGGTTGG - Intronic
977306237 4:95327186-95327208 GTTTTTTTAGGGGTGGAGGTTGG - Intronic
977792436 4:101123582-101123604 GCATTTTGGGAGGTGGAGGTGGG + Intronic
978515630 4:109565947-109565969 CTACTTTCGGAGGGTGAGGTGGG - Intronic
978566963 4:110093604-110093626 TTATTTTCAAAGGTGGAAATAGG - Intronic
978762398 4:112368162-112368184 GTACTTTGGGAGGTGGAGGTGGG - Intronic
978846479 4:113279026-113279048 CTAGATTCAGAGGTGGTGGGAGG + Intronic
978987609 4:115033360-115033382 GCACTTTGAGAGGTGGAGGTGGG - Intronic
979411232 4:120382620-120382642 ATATTTTCAGAGGTCGACGAGGG + Intergenic
980041177 4:127942446-127942468 GCACTTTCAGAGGTTGAGGTAGG + Intronic
980678244 4:136119063-136119085 ATAATTTGAGAGGTTGAGGTGGG - Intergenic
981242798 4:142498540-142498562 GCATTTTGGGAGGTGGAGGTGGG + Intronic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981311221 4:143299821-143299843 CTCTTTTCAAAGGTGAAAGTAGG - Intergenic
981752723 4:148108347-148108369 GTACTTTGGGAGGTGGAGGTGGG - Intronic
982155762 4:152519050-152519072 GCATTTTGAGAGGTGAAGGTGGG + Intronic
982244472 4:153336776-153336798 CTTTTTTCAGAGGTTGATTTGGG - Exonic
982401427 4:154972218-154972240 CTATTTACAGAGGTGTGGGCGGG + Intergenic
982708792 4:158738827-158738849 CTACTTTGAGAGGCCGAGGTAGG - Intergenic
983193598 4:164781053-164781075 GCACTTTGAGAGGTGGAGGTGGG - Intergenic
983193931 4:164783750-164783772 ATTTTTTCAGAGATGGAGGTGGG - Intergenic
984272293 4:177561412-177561434 TTACTTTCAGAGGTGCAAGTTGG + Intergenic
985570668 5:643101-643123 CTATTTTGGGAGGTAGAGGCAGG + Intronic
986481052 5:8188741-8188763 CTATCTTGGGAGGCGGAGGTGGG + Intergenic
986744084 5:10729299-10729321 CTATTTTCAAAGATGGTGGTGGG - Intronic
986865590 5:11982555-11982577 ATATATTTAGGGGTGGAGGTGGG + Intergenic
987456013 5:18147688-18147710 GTATTTTGAGAGGCGAAGGTGGG - Intergenic
987864218 5:23519795-23519817 GCACTTTGAGAGGTGGAGGTGGG + Intronic
988101715 5:26688142-26688164 GTATTTTGAGAGGCTGAGGTGGG + Intergenic
988521707 5:31951312-31951334 CTATTTTGAGAGGCTGAGGCAGG - Intronic
988837335 5:35046212-35046234 CAATGTTCAGAGGTTGGGGTAGG + Intronic
989164763 5:38423437-38423459 ATTTTTTAAGAGGTGGGGGTAGG - Intronic
990428683 5:55713138-55713160 CCATTTTGAGAGGCTGAGGTGGG + Intronic
991128621 5:63095522-63095544 CTTTTTTCAGAGGAGAAGGTAGG + Intergenic
992204581 5:74418818-74418840 GTATTTTTACAGGTGGAGGTGGG - Intergenic
992208508 5:74454421-74454443 CTAATATTAGAGGTGGGGGTGGG - Intergenic
993477143 5:88379906-88379928 GTATTTTCGGAGGTTGAGGTTGG - Intergenic
993574120 5:89580413-89580435 ATTTTTGTAGAGGTGGAGGTGGG + Intergenic
993697502 5:91079179-91079201 TTATTTTCAGAAATGGAGCTTGG - Intronic
994121874 5:96123535-96123557 CTATTTTCAAAATTGAAGGTTGG + Intergenic
994267009 5:97729252-97729274 GCATTTTGAGAGGTCGAGGTGGG + Intergenic
994708377 5:103233887-103233909 CTTATTTCAGAGTTGGAGTTGGG - Intergenic
995194997 5:109356909-109356931 ATATGTTCAGGGGTGGAGGAAGG - Intronic
995971375 5:117975001-117975023 TAATTTTCAGTGCTGGAGGTGGG - Intergenic
996230565 5:121058650-121058672 ATATTTTCAGAAGTGGAGTCTGG + Intergenic
996370930 5:122751775-122751797 CTATTTACAGAGGTGTAGGTAGG - Intergenic
997919761 5:137967644-137967666 GTATTTTCAGAGGCTGAGGTGGG + Intronic
998035101 5:138908419-138908441 GCATTTTCAGAGGTCAAGGTCGG + Intronic
998454568 5:142261430-142261452 ACATTTTGAGAGGTTGAGGTGGG - Intergenic
998465824 5:142342881-142342903 CTATTTTGAGATGAGGACGTAGG + Intergenic
999084002 5:148871149-148871171 CCTTTTTGGGAGGTGGAGGTAGG - Intergenic
999644786 5:153707005-153707027 CTATTTCAGGAGGTTGAGGTAGG + Intronic
999661715 5:153871224-153871246 CTATGATTAGAGGAGGAGGTAGG + Intergenic
1000965418 5:167650017-167650039 CTATCTTCCAAAGTGGAGGTGGG - Intronic
1001280215 5:170381408-170381430 CTACCTTCAGAGTTGGAGGGTGG + Intronic
1001519609 5:172381695-172381717 CTGTCCACAGAGGTGGAGGTGGG - Intronic
1002050446 5:176567737-176567759 GCACTTTGAGAGGTGGAGGTGGG - Intronic
1002144930 5:177172710-177172732 GCATTTTGAGAGGTTGAGGTGGG + Intronic
1002953858 6:1842725-1842747 CTATTTTGAGGGGTGGGGATAGG + Intronic
1003055595 6:2816083-2816105 GCACTTTGAGAGGTGGAGGTAGG - Intergenic
1004285222 6:14315250-14315272 CCATTTTGGGAGGTCGAGGTGGG + Intergenic
1004362241 6:14981506-14981528 ACACTTTGAGAGGTGGAGGTGGG - Intergenic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1004797166 6:19099663-19099685 CCACTTTCTGAGGTCGAGGTAGG + Intergenic
1004917799 6:20348034-20348056 CTAGTTTCACAGGTTTAGGTAGG + Intergenic
1005398255 6:25405926-25405948 GAATTTTCAGAGGTGGAAATAGG + Intronic
1005459815 6:26057126-26057148 CTCTTTTCATAGATGGGGGTGGG + Intergenic
1006001068 6:30965592-30965614 GTAGTTTCAGAGGCTGAGGTGGG - Intergenic
1007226292 6:40317453-40317475 CTATTTTGGGAGGCAGAGGTGGG + Intergenic
1007541036 6:42644776-42644798 GTATTTTGCGAGGTGGTGGTAGG + Intronic
1007794560 6:44337322-44337344 CTATTTACAGAGGTGAAGGTGGG + Intronic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1008141521 6:47837668-47837690 CTATTTCCAGGTTTGGAGGTGGG - Intergenic
1009871000 6:69451874-69451896 TTAGTTTCAGAGGAGGAGGAAGG - Intergenic
1009976704 6:70678761-70678783 CTAGTTTCAAAGATGGAGGAAGG - Intronic
1010169313 6:72956650-72956672 ACATTTTGGGAGGTGGAGGTGGG - Intronic
1010430466 6:75772266-75772288 CTATGTTCGGAGATGTAGGTAGG + Intronic
1011920809 6:92575311-92575333 ATTTTTTCAGGGGTGGAGGTGGG + Intergenic
1012762668 6:103321486-103321508 CTAATCACAGGGGTGGAGGTGGG + Intergenic
1012902218 6:105019491-105019513 CTGTTTTCACATGTGTAGGTAGG + Intronic
1012907212 6:105081712-105081734 CTTTGCCCAGAGGTGGAGGTTGG + Exonic
1013796915 6:113898550-113898572 CTCTCTTCAGAGTTGGAGGATGG + Intergenic
1014578914 6:123109865-123109887 TAATTTTCAGAGGCTGAGGTGGG - Intergenic
1014993657 6:128114369-128114391 GCACTTTCAGAGGCGGAGGTGGG + Intronic
1015029334 6:128575427-128575449 GTACTTTCAGAGGTCAAGGTAGG + Intergenic
1015417752 6:132968993-132969015 CAATTTTGAGAGACGGAGGTGGG - Intergenic
1016437829 6:144056083-144056105 ATTTCTTCAGAGGTGGGGGTGGG - Intronic
1016646337 6:146412867-146412889 CTATTTTAAAAGGAGGAGATGGG - Intronic
1017456955 6:154609529-154609551 GTATTTTGGGAGGTCGAGGTGGG - Intergenic
1017796245 6:157847347-157847369 GCATTTTGGGAGGTGGAGGTGGG - Intronic
1018006735 6:159629313-159629335 TTATTTTTTGAGATGGAGGTTGG - Intergenic
1018147732 6:160908615-160908637 GCATTTTGAGAGGTCGAGGTGGG + Intergenic
1019615621 7:1958564-1958586 CTTTTTTCAGAGATGCAGTTAGG - Intronic
1020045083 7:5034565-5034587 CTAGTTTGAGAGGTGGAGACAGG + Intronic
1020178303 7:5900108-5900130 GTATTTTCAGAGGCTGAGGCGGG - Intronic
1020304624 7:6824891-6824913 GTATTTTCAGAGGCTGAGGCGGG + Intronic
1021119958 7:16788072-16788094 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
1021585250 7:22201013-22201035 CTATTTACAGCTGTGTAGGTAGG + Intronic
1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG + Intergenic
1023156123 7:37254166-37254188 CTATTTTCGGGGATGGAGGAAGG - Intronic
1023518273 7:41025516-41025538 CTATTTTTAGTAGTGGTGGTGGG - Intergenic
1023711158 7:42994368-42994390 CTATATTAAGAGATGGAGGGAGG - Intergenic
1024600670 7:50977857-50977879 GTACTTTGAGAGGTGGAGGCAGG + Intergenic
1025101679 7:56140734-56140756 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
1025258592 7:57401543-57401565 GTACTTTGGGAGGTGGAGGTGGG + Intergenic
1025608280 7:63054866-63054888 GAATTTTGGGAGGTGGAGGTGGG - Intergenic
1026054068 7:66969796-66969818 CCATTTAGAGAGGTGGAGGTGGG - Intergenic
1026331315 7:69354916-69354938 GTACTTTGAGAGGTTGAGGTGGG - Intergenic
1026342365 7:69445482-69445504 CAGTTCTGAGAGGTGGAGGTGGG - Intergenic
1026381672 7:69806140-69806162 CCACTTTGGGAGGTGGAGGTAGG - Intronic
1027134863 7:75617015-75617037 CTATTTTGGGAGGCTGAGGTGGG - Intronic
1028139342 7:87255551-87255573 CTATTTTGAGAGCCTGAGGTGGG - Intergenic
1028214873 7:88119491-88119513 CTTTTTTCAGGGGTGGGGGATGG + Intronic
1028413670 7:90557939-90557961 CTATTCTCAGAAGGGAAGGTGGG - Intronic
1028440319 7:90852141-90852163 GCATTTTGAAAGGTGGAGGTGGG - Intronic
1028467736 7:91171891-91171913 GTACTTTGAGAGGTCGAGGTGGG - Intronic
1029240158 7:99154769-99154791 GCACTTTCAGAGGTTGAGGTGGG - Intergenic
1029539845 7:101176167-101176189 GTATGTCAAGAGGTGGAGGTGGG - Intronic
1029601821 7:101569127-101569149 CTATTTTCAAAGGTGTGGGTGGG + Intergenic
1030663276 7:112246135-112246157 CTATTTTGGGAGGCTGAGGTGGG + Intronic
1030994354 7:116340275-116340297 CTATGTGCAGAAGTGGAAGTGGG - Intronic
1031046031 7:116888721-116888743 CTGTTTTGAGAGGCTGAGGTTGG + Intronic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1032039275 7:128545163-128545185 CTATTTTGGGAGGCCGAGGTGGG + Intergenic
1032105161 7:129022136-129022158 GCATTTTAGGAGGTGGAGGTGGG + Intronic
1032518079 7:132521794-132521816 TTGATTTCAGAGGTAGAGGTCGG - Intronic
1033775175 7:144601427-144601449 CTTTTTTAGGTGGTGGAGGTAGG - Intronic
1034090623 7:148361052-148361074 GCATTTTGAGAGGTTGAGGTGGG - Intronic
1034147724 7:148886986-148887008 GTACTTTCAGAAGTCGAGGTGGG + Intergenic
1034360019 7:150486997-150487019 TTTTTTTCAGAGATGGAGGCAGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034988485 7:155532669-155532691 CTATTTTAGGAGGAGGTGGTAGG - Intronic
1035109681 7:156470774-156470796 CTATCTCCAGTGTTGGAGGTGGG + Intergenic
1035309271 7:157954724-157954746 CCCTTTTCAGGGGTGGAAGTGGG + Intronic
1035544251 8:467228-467250 CAAGTGTCAGAGGTGGAGGCTGG + Intronic
1037269491 8:17110821-17110843 CTACTTTGGGAGGTTGAGGTGGG - Intronic
1038560928 8:28579184-28579206 CTATTTTGAGAGGCTGAGGTGGG + Intergenic
1038761859 8:30391714-30391736 CTATGTTTGGCGGTGGAGGTGGG + Intronic
1039462945 8:37761489-37761511 CTATTCTGTGAGGCGGAGGTGGG + Intergenic
1039525971 8:38216790-38216812 GTACTTTGGGAGGTGGAGGTGGG - Intergenic
1039682860 8:39761269-39761291 TTATTTTCAGAAGTAGAGTTTGG - Exonic
1039902780 8:41765491-41765513 GCATTTTGGGAGGTGGAGGTGGG - Intronic
1041074057 8:54152696-54152718 CTACTTTGGGAGGTTGAGGTGGG + Intergenic
1041365431 8:57098154-57098176 CTATTTTCACAGAAGGAGTTAGG + Intergenic
1041798257 8:61769989-61770011 ATATTTTGGGAGGTCGAGGTGGG + Intergenic
1043149676 8:76699219-76699241 ACATTTTTAGAGGTGGGGGTTGG - Intronic
1043841945 8:85116618-85116640 CTATTTTAGGAGGCTGAGGTGGG - Intronic
1043928908 8:86068836-86068858 CTATCTTCGGAGGTGGGGGGTGG - Intronic
1043996135 8:86818887-86818909 ACATTTTCAGAGGCTGAGGTGGG + Intergenic
1045234551 8:100339208-100339230 TAAATTTGAGAGGTGGAGGTAGG + Intronic
1045725519 8:105168760-105168782 ATATTTTAAGTGGTGGAGGCAGG + Intronic
1045810409 8:106214682-106214704 CTATTTACAGTTCTGGAGGTTGG - Intergenic
1047859079 8:128944967-128944989 CTATATTCAGAGGCCGAGGCAGG - Intergenic
1047979393 8:130164606-130164628 CTGTTTTTAGAGTTGGAAGTAGG - Intronic
1048038629 8:130703417-130703439 TGATTTTCAGTGTTGGAGGTGGG + Intergenic
1048186580 8:132247538-132247560 GCACTTTCAGAGGTCGAGGTGGG + Intronic
1048601847 8:135926854-135926876 CTATTTCCAGAGGTGAGGGCAGG - Intergenic
1049133320 8:140869376-140869398 CAACTTTCAGAGGTGGAAATGGG - Intronic
1049642206 8:143720829-143720851 CTACGTGCAGAGGTGGGGGTGGG + Exonic
1049708631 8:144053947-144053969 ACAGTTTTAGAGGTGGAGGTGGG - Intronic
1049756183 8:144312198-144312220 CACTTTTCAGGGGTGGAGGTGGG - Exonic
1049945556 9:591903-591925 GCATTTTCAGAGGCTGAGGTGGG - Intronic
1050244883 9:3678375-3678397 ATATTTTCAGAGATGGGGGGAGG + Intergenic
1051580888 9:18672808-18672830 GTATTTTGAGAGGATGAGGTGGG + Intronic
1052287869 9:26807180-26807202 GTATTTTGGCAGGTGGAGGTAGG - Intergenic
1052301949 9:26962002-26962024 CTGTTTCAAGAGGTGGAGTTGGG + Exonic
1052483488 9:29063644-29063666 ACACTTTCAGAGGTGGAGGCAGG - Intergenic
1053396188 9:37776651-37776673 CCACTTTCAGAGGCCGAGGTGGG + Intronic
1053442918 9:38130685-38130707 CCATACTCAGAGGTGGAGGTTGG + Intergenic
1053728050 9:41024440-41024462 CTATTATCAGAAGTAGTGGTAGG + Intergenic
1054700459 9:68407662-68407684 CTATTATCAGAAGTAGTGGTAGG - Intronic
1054702956 9:68432445-68432467 CCACTTTCAGAGGCTGAGGTGGG - Intronic
1055766768 9:79672019-79672041 TTTTTTGCAGAGGTGGTGGTGGG + Intronic
1055875336 9:80935273-80935295 CTATTTTCATATGTTGAGTTTGG - Intergenic
1056505103 9:87250967-87250989 GCACTTTGAGAGGTGGAGGTGGG + Intergenic
1057026576 9:91738631-91738653 CTATGTTCAAAGGTGATGGTAGG + Intronic
1057243812 9:93437090-93437112 CTATTTCCAGCGGTGTAGGCTGG + Intergenic
1057811760 9:98262793-98262815 GTACTTTAAGAGGCGGAGGTGGG + Intergenic
1058604614 9:106707202-106707224 CCAGTGTCAGAGGTGGAGGTGGG + Intergenic
1060160740 9:121360990-121361012 GAATTTTGAGAGGTGAAGGTAGG - Intronic
1060173427 9:121479973-121479995 CTATTTTGGGAGCAGGAGGTGGG - Intergenic
1060427707 9:123520208-123520230 GCATTTTCAGAGGCTGAGGTGGG + Intronic
1061328396 9:129877825-129877847 CACTTTTGAGAGGTCGAGGTGGG + Intronic
1061744358 9:132728651-132728673 CTCCTTGGAGAGGTGGAGGTTGG + Intronic
1062183441 9:135203325-135203347 CTAATTTGGGAGGAGGAGGTGGG - Intergenic
1062470611 9:136701988-136702010 CTATTTGCAAAGGTGTAAGTGGG - Intergenic
1185552446 X:993887-993909 CCACTTTGAGAGGTTGAGGTGGG - Intergenic
1186042704 X:5498954-5498976 GCACTTTCAGAGGTTGAGGTGGG - Intergenic
1187937603 X:24351138-24351160 CAATTTTCAGAGGAGAAGGTGGG - Intergenic
1187949716 X:24459921-24459943 GCATTTTGGGAGGTGGAGGTGGG + Intergenic
1189111460 X:38294461-38294483 GTATTTTGAGAGGCTGAGGTAGG - Intronic
1189741634 X:44123365-44123387 GCACTTTGAGAGGTGGAGGTGGG - Intergenic
1190195366 X:48313457-48313479 CCACTTTGAGAGGTAGAGGTGGG - Intergenic
1190414932 X:50171696-50171718 GTACTTTCAGAGGCTGAGGTGGG - Intergenic
1191844104 X:65533783-65533805 CTAGGTTCTGAGGTGGAGGGTGG - Intronic
1192522741 X:71815994-71816016 CTCTTTCCAGAGCTGGAGTTTGG - Intergenic
1192755778 X:74046148-74046170 CTATTTTCAGAGCTGGTAGGTGG + Intergenic
1193619676 X:83736904-83736926 TAATTTTCAGTGTTGGAGGTGGG + Intergenic
1194262061 X:91708165-91708187 CTATTTTCAAAGGGGAAGGGAGG + Intergenic
1194298724 X:92159256-92159278 GTATTTTCAGATGTGGATGTAGG + Intronic
1194606970 X:95992707-95992729 ATACTTTGAGAGGTGGAGATGGG + Intergenic
1194709054 X:97212008-97212030 CTGTTATCAGACATGGAGGTAGG - Intronic
1195235275 X:102890585-102890607 CTGTGTGCAGAGGTGGGGGTGGG + Intergenic
1196804194 X:119570327-119570349 GCATTTTGGGAGGTGGAGGTGGG - Intergenic
1196830210 X:119770113-119770135 GCACTTTCAGAGGTGGAGGCGGG - Intergenic
1196845458 X:119893474-119893496 GCACTTTGAGAGGTGGAGGTGGG + Intergenic
1197520512 X:127491104-127491126 TAATTCTCAGTGGTGGAGGTGGG - Intergenic
1200580708 Y:4946952-4946974 CTATTTTCAAAGGGGAAGGGAGG + Intergenic
1200616336 Y:5384234-5384256 GTATTTTCAGATGTGGATGTAGG + Intronic
1200886638 Y:8278332-8278354 GCATTTTCGGAAGTGGAGGTAGG - Intergenic
1200986741 Y:9308939-9308961 GCATTTTCAGAGGATGAGGTGGG + Intergenic
1201575509 Y:15457408-15457430 GTACTTAGAGAGGTGGAGGTGGG + Intergenic
1201752851 Y:17452673-17452695 CTATTTTGGGAGGCTGAGGTTGG + Intergenic
1201885097 Y:18873522-18873544 CTTTTTCCAGTGGTGGAGGGAGG - Intergenic
1201901537 Y:19049140-19049162 GTACTTCCAGAGATGGAGGTGGG + Intergenic