ID: 955604329

View in Genome Browser
Species Human (GRCh38)
Location 3:60684255-60684277
Sequence TAGGTCTCCCAAAATAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955604322_955604329 27 Left 955604322 3:60684205-60684227 CCTTGCCACTTTCAGCTTCTGGT 0: 2
1: 16
2: 187
3: 549
4: 1241
Right 955604329 3:60684255-60684277 TAGGTCTCCCAAAATAATCCAGG 0: 1
1: 0
2: 0
3: 9
4: 148
955604324_955604329 22 Left 955604324 3:60684210-60684232 CCACTTTCAGCTTCTGGTGGTTG 0: 3
1: 32
2: 168
3: 494
4: 1107
Right 955604329 3:60684255-60684277 TAGGTCTCCCAAAATAATCCAGG 0: 1
1: 0
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955604329 Original CRISPR TAGGTCTCCCAAAATAATCC AGG Intronic
904970120 1:34413057-34413079 TAGCTCTCCCCAAATCCTCCCGG + Intergenic
905223470 1:36464613-36464635 TGGACCTCCCAAAATAACCCTGG - Intergenic
907751430 1:57267104-57267126 AAGGCCTACCAGAATAATCCAGG - Intronic
909239800 1:73197838-73197860 TAGGACTCACAACATAATACGGG + Intergenic
909899747 1:81118039-81118061 TAACTTTCCCAAAATGATCCTGG + Intergenic
909973805 1:82022128-82022150 TGGGTCTACCCAAATAATCCAGG - Intergenic
912170327 1:107091999-107092021 TGGGACTGCCCAAATAATCCAGG - Intergenic
912999335 1:114564012-114564034 TGGATCTACCCAAATAATCCAGG + Intergenic
915743344 1:158137026-158137048 TGGGCCTACCCAAATAATCCAGG - Intergenic
916192742 1:162194901-162194923 CAGGTCCTCCAAAATAATGCTGG - Intronic
919050744 1:192508419-192508441 TCGGTCTCCCAAAAAAGTGCTGG - Intergenic
922815504 1:228446285-228446307 CAGGTCTCCAAAACGAATCCCGG + Intergenic
923872797 1:238014760-238014782 CATGTCTCCCAAAATAGTGCAGG + Intergenic
923903170 1:238352256-238352278 TGGGTATCTCAAACTAATCCTGG - Intergenic
924215233 1:241814219-241814241 TATGTCTTTCAAAATAATTCAGG - Intergenic
924674763 1:246164633-246164655 TGGCTCACCCAAAATGATCCTGG - Intronic
1063640144 10:7821082-7821104 TAGGTATTCCAAAGTCATCCAGG + Intronic
1067673049 10:48343400-48343422 TAGGGCCCACAAGATAATCCAGG + Intronic
1070123098 10:73597615-73597637 TCAGTCTCCCAGAATATTCCAGG - Intronic
1071636046 10:87255145-87255167 TCGGCCTCCCAAAGTAAGCCCGG + Intergenic
1074796268 10:116948121-116948143 TAGTTCTGCAAAAATAATTCTGG - Intronic
1075207901 10:120462602-120462624 TAGGTCTGTAAAAATGATCCTGG - Intronic
1077801892 11:5547490-5547512 TAGGTTTCACAATTTAATCCTGG + Intronic
1078763146 11:14268223-14268245 TAGCTCTCCAGAAATAGTCCAGG + Intergenic
1079649290 11:22906746-22906768 TGGGTCCACCCAAATAATCCAGG - Intergenic
1079814865 11:25042843-25042865 TAGGGCTAACATAATAATCCAGG + Intronic
1080110021 11:28556358-28556380 CAGGTCTACCCAGATAATCCAGG + Intergenic
1081254240 11:40872263-40872285 TTGGGCTCTCAAAATAGTCCTGG + Intronic
1085273194 11:75282392-75282414 TAGGCCCACCAAAATCATCCAGG - Intronic
1085967730 11:81548916-81548938 TAGTTCTCTCCAAATAATCCAGG - Intergenic
1087982570 11:104634300-104634322 TAGGTCTTCCTGGATAATCCAGG - Intergenic
1095158018 12:38882163-38882185 TTGGCCTTCCAAGATAATCCAGG - Intronic
1095593403 12:43931860-43931882 TGGGTCTCCCAGAATAAATCAGG - Intronic
1096397884 12:51280315-51280337 TTGGCCTCCCAAAAGAATCCAGG + Intergenic
1101259552 12:103014226-103014248 TAGATGTACCAAAATAGTCCAGG + Intergenic
1101407672 12:104443029-104443051 CAGGTCTACCCAGATAATCCAGG - Intergenic
1102647118 12:114410916-114410938 TAGGTCTCCCAAAATGTTTGGGG + Intergenic
1104637156 12:130445052-130445074 CAGGGCTCCCAACATACTCCTGG - Intronic
1109058620 13:57583188-57583210 GAGGTCTGCCAAAATTATACTGG + Intergenic
1110065644 13:71101960-71101982 GATGTCTCTTAAAATAATCCAGG + Intergenic
1111323176 13:86657256-86657278 TGGGCCTACCATAATAATCCAGG - Intergenic
1111854091 13:93614320-93614342 TATGTATCCCAAAAGAATTCAGG + Intronic
1114847711 14:26343852-26343874 TGGGTCTACCAAGATGATCCAGG - Intergenic
1117420097 14:55535885-55535907 TATGTTTACCAAAATAATTCGGG - Intergenic
1118613730 14:67561296-67561318 TAGGTCTCCCAAAGTGCTGCTGG - Intronic
1118768881 14:68928729-68928751 TAGCTCCCCCAAAATGATCCCGG + Intronic
1119230792 14:72978142-72978164 TGGGTCTCGCAAAATATGCCTGG - Exonic
1119627433 14:76191441-76191463 AAGGTTCCCCAAAATAATACAGG + Intronic
1124803213 15:32855416-32855438 TAGGGCTCCCAAGACAATTCTGG - Intronic
1125995613 15:44157140-44157162 TAGCTCTCATAAAATAATACAGG - Intronic
1126787135 15:52186520-52186542 TCGGTCTCCCAAAGAAATCTAGG - Intronic
1128684616 15:69674540-69674562 AAGGATTCCCAAAATAAACCTGG - Intergenic
1133794274 16:9033585-9033607 TTGGTCTCCCAAGCTAATCTTGG + Intergenic
1135331420 16:21563138-21563160 TGGGGCTCACAATATAATCCTGG + Intergenic
1136465178 16:30437908-30437930 TCGGCCTCCCAAAGTAATCCTGG - Intergenic
1139418762 16:66835233-66835255 TTGGCCTCCCAAAATACTGCAGG - Intronic
1140904424 16:79398252-79398274 TAGGTCCAGCAAGATAATCCAGG + Intergenic
1144122779 17:12172440-12172462 TTGGCCTCCCAAAATATTCTGGG + Intergenic
1150883604 17:69059338-69059360 TGGGTCTACCCAGATAATCCAGG - Intronic
1152832843 17:82509323-82509345 TCAGTCTCCCAAAGTAATGCTGG - Intergenic
1153328794 18:3850561-3850583 TAGGGCCCCCAAAATCAACCTGG + Intronic
1155583896 18:27343026-27343048 TTGGCCTACCCAAATAATCCAGG + Intergenic
1158906622 18:62019277-62019299 TAGCCCTCCCAAAATACTACAGG - Intergenic
1161853156 19:6749192-6749214 TCAGCCTCCCAAAATAATGCTGG + Intronic
1162019245 19:7861198-7861220 GAGGACTCCCAAAATAGTGCAGG - Intronic
1162155095 19:8672233-8672255 TAGTTCATGCAAAATAATCCAGG + Intergenic
1163839986 19:19601592-19601614 TAGGCCCCCCCAGATAATCCGGG - Intronic
1164599631 19:29552228-29552250 TAGGTTTCCCAAATGAATCGGGG - Intronic
1164765717 19:30765878-30765900 TAGGTCTCCAAATATAATTGTGG + Intergenic
1165780595 19:38431584-38431606 CAGCTCTCCCGAAATAATGCTGG - Intergenic
1167464117 19:49641137-49641159 TCGGTCTCCCAGACTAGTCCTGG - Intergenic
927606229 2:24489884-24489906 TAGGTCTCCGATAAGAATCAGGG + Intergenic
933309822 2:80646692-80646714 AAGGTAACCCAAAATATTCCTGG + Intronic
933351519 2:81158361-81158383 CAGGTTTTCCAAAGTAATCCTGG - Intergenic
935509915 2:103958927-103958949 GGGCTGTCCCAAAATAATCCTGG - Intergenic
936506100 2:113108525-113108547 TGGGTCCACCTAAATAATCCAGG + Intronic
940227324 2:151413283-151413305 TTGGCCTCCCAAAGTAAGCCTGG + Intronic
940971293 2:159899722-159899744 TAGGTCTCCAAAAAATATCTAGG - Intronic
942030548 2:171954837-171954859 TAGGTCCACCCAAATATTCCAGG - Intronic
942628577 2:177930755-177930777 CAGGGCTCCCAAAACAACCCTGG - Intronic
945750463 2:213776200-213776222 TGGGTCCACCAACATAATCCAGG - Intronic
1169071131 20:2731281-2731303 TAGTTCTCTCAAAACAGTCCAGG + Intronic
1169281866 20:4274890-4274912 TCGGTCTCCCAAAACAATGATGG - Intergenic
1169342232 20:4805232-4805254 TAGGGCCCCCCAGATAATCCAGG - Intronic
1173524305 20:43720311-43720333 TAAGACTCCCAAACTACTCCTGG - Intergenic
1174647630 20:52099696-52099718 TTTGTCTTCAAAAATAATCCAGG + Intronic
1175046440 20:56110545-56110567 AAGGATTCCTAAAATAATCCAGG - Intergenic
1175063444 20:56264651-56264673 AAGATCTCTCAAAATAATCATGG + Intergenic
1176220696 20:63968142-63968164 AAGGTCTCCCCAGATAACCCAGG + Intronic
1179496448 21:41774869-41774891 TCTGTCTCTCAAAATAATTCAGG - Intergenic
949713752 3:6903352-6903374 TAGGAATCACAAAACAATCCAGG - Intronic
951791200 3:26486612-26486634 TAGGTCTCCAACTATATTCCTGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955603774 3:60676693-60676715 TTGGTCTCCCAAGATTTTCCAGG - Intronic
955604329 3:60684255-60684277 TAGGTCTCCCAAAATAATCCAGG + Intronic
964465374 3:156985885-156985907 TAGGCCTGCCCACATAATCCAGG - Intronic
965487112 3:169292088-169292110 TCGGCCTCCCAAAAAAATGCTGG - Intronic
967255733 3:187589998-187590020 TAGGGCTCCCAAGATTGTCCTGG - Intergenic
969119336 4:4896200-4896222 TAGGTCAACCCAGATAATCCAGG - Intergenic
969169342 4:5347493-5347515 AAGCTCTACTAAAATAATCCAGG - Intronic
972150333 4:36081680-36081702 TAGGACTCCTGGAATAATCCAGG + Intronic
972568075 4:40286685-40286707 AAGGGCTCCCAGAATAACCCTGG + Intergenic
972589324 4:40469592-40469614 TCGGCCTCCCAAAATTAGCCAGG - Intronic
975302845 4:72811584-72811606 TGGGTCTACCCAGATAATCCTGG - Intergenic
975978847 4:80132072-80132094 TAAGCCTGCCAAGATAATCCAGG - Intergenic
976471321 4:85432161-85432183 TCCCTCTCCTAAAATAATCCTGG - Intergenic
977659798 4:99570686-99570708 TGGGCCTGCCTAAATAATCCAGG - Intronic
978452285 4:108847502-108847524 TAGATCCCTAAAAATAATCCAGG - Intronic
981141836 4:141278093-141278115 TAGGCCTACCCAGATAATCCAGG - Intergenic
983650569 4:170032553-170032575 TTGGCCTCCCAAAGTACTCCTGG + Intronic
983951513 4:173647975-173647997 TTTGTCTCTCATAATAATCCAGG + Intergenic
984897243 4:184552576-184552598 TAGGACTGCCTAAATAATGCAGG + Intergenic
988483328 5:31647665-31647687 TAGGGCTACCCAAATAATTCAGG + Intronic
995412416 5:111873685-111873707 TGGGCCTACCCAAATAATCCAGG + Intronic
997259086 5:132451793-132451815 TAGGTCTCCCAAGCAAATACAGG + Intronic
997460018 5:134045632-134045654 TGGGTCTGCCTGAATAATCCAGG + Intergenic
1000120475 5:158193171-158193193 AAGGTCTACCTAGATAATCCAGG + Intergenic
1000747906 5:165057928-165057950 TAGCTATCCTAAAATAATCATGG + Intergenic
1003811083 6:9781773-9781795 TGAGTCACCCAAAATAATGCAGG - Intronic
1008393278 6:50977901-50977923 TAGGACCCCCTGAATAATCCAGG + Intergenic
1011256899 6:85431819-85431841 AAGGTCTCCCAAAATTAGCTTGG - Intergenic
1011775416 6:90725222-90725244 TATGTCTCCAAAACTAACCCTGG - Intergenic
1015474533 6:133645384-133645406 CAGGCCTCTCAAAATATTCCTGG + Intergenic
1019299373 7:295767-295789 TAGGCCTCTCAGAAGAATCCAGG - Intergenic
1022337164 7:29432725-29432747 TAGCTAGTCCAAAATAATCCAGG - Intronic
1026357042 7:69567107-69567129 TAGAATTCTCAAAATAATCCCGG + Intergenic
1030003814 7:105095474-105095496 TAGGTCACACAAAATACTCAGGG + Intronic
1032208498 7:129890628-129890650 TTGGCCTCCCAAAATACTACAGG + Intronic
1036793676 8:11740405-11740427 CAGGGCTCCCATATTAATCCGGG + Intronic
1038783408 8:30588625-30588647 TAGGTCTGCTCAAATAATCCAGG - Intronic
1042708726 8:71691164-71691186 TGGGTTTACCTAAATAATCCAGG + Intergenic
1043170006 8:76954012-76954034 TGGGTCCACCAAGATAATCCAGG - Intergenic
1045566678 8:103323759-103323781 TAGATCCCCCAAAATAATACTGG + Intronic
1048534364 8:135278565-135278587 TATATATGCCAAAATAATCCAGG - Intergenic
1048745534 8:137610763-137610785 TGGGCCCACCAAAATAATCCAGG + Intergenic
1051599050 9:18853658-18853680 CATGTCTCCCAAAGTTATCCTGG + Intronic
1053574121 9:39340847-39340869 GAAGCCTCCCAAAAGAATCCTGG + Intergenic
1053625210 9:39863263-39863285 GAAGCCTCCCAAAAGAATCCTGG + Intergenic
1053838682 9:42169092-42169114 GAAGCCTCCCAAAAGAATCCTGG + Intergenic
1053879658 9:42579963-42579985 GAAGCCTCCCAAAAGAATCCTGG - Intergenic
1053893009 9:42714359-42714381 GAAGCCTCCCAAAAGAATCCTGG + Intergenic
1054095686 9:60899539-60899561 GAAGCCTCCCAAAAGAATCCTGG + Intergenic
1054117147 9:61175478-61175500 GAAGCCTCCCAAAAGAATCCTGG + Intergenic
1054218681 9:62387431-62387453 GAAGCCTCCCAAAAGAATCCTGG - Intergenic
1054232034 9:62521736-62521758 GAAGCCTCCCAAAAGAATCCTGG + Intergenic
1054590610 9:67007090-67007112 GAAGCCTCCCAAAAGAATCCTGG - Intergenic
1055148842 9:72970028-72970050 TAGTTCTTCCAAAATAACACCGG + Intronic
1061517637 9:131098647-131098669 TCGGTTTCCCAAAACAACCCTGG - Intronic
1062619436 9:137412935-137412957 TACCCCTCCCAAAATTATCCAGG - Intronic
1185821111 X:3205579-3205601 TAACTCTCCCAAATTAATCAGGG + Intergenic
1185827060 X:3261571-3261593 TAGGTTTGCCCAAATAATCCAGG - Intergenic
1187158045 X:16739384-16739406 TATTTCTGCCAAAATATTCCAGG + Intronic
1187355979 X:18572243-18572265 TAGGTCTCCCTAGTTAGTCCTGG + Intronic
1187497356 X:19806916-19806938 TAGTTCTCACAACACAATCCTGG + Intronic
1189498551 X:41531855-41531877 TAGGTCTTCCATAATAATTATGG - Intronic
1189729638 X:44005454-44005476 TGGGTCCACCAAAATAATCCAGG + Intergenic
1190153912 X:47972486-47972508 TAGGGCTCCCGAAACTATCCTGG - Intronic
1196009766 X:110874294-110874316 TGGCTCCCCCAAAATAATGCTGG + Intergenic