ID: 955605571

View in Genome Browser
Species Human (GRCh38)
Location 3:60698939-60698961
Sequence GCTTATGTATTAAGATGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955605571 Original CRISPR GCTTATGTATTAAGATGAAT GGG (reversed) Intronic
901359198 1:8681389-8681411 TCTTACCTTTTAAGATGAATAGG - Intronic
906115075 1:43351072-43351094 GAATATGGATTAAGATGTATTGG - Intronic
906990770 1:50735094-50735116 ACCTATTTATTAAGATGATTAGG - Intronic
907086335 1:51678358-51678380 GCTTATTTATTAAAATGCAGTGG + Intronic
907623388 1:56005121-56005143 GATTAAGTATTAACATGAAAAGG - Intergenic
908415383 1:63908533-63908555 GTTTATGTATTTATATGTATAGG + Intronic
912984602 1:114414808-114414830 GCTTTTGTATTATGCTTAATAGG - Intronic
913407171 1:118507533-118507555 GCTTCTGTATCATGATGGATGGG + Intergenic
913614447 1:120543662-120543684 ACTTATGTATGAACAAGAATTGG + Intergenic
914575823 1:148967239-148967261 ACTTATGTATGAACAAGAATTGG - Intronic
915021236 1:152780295-152780317 GCTTATTTAGTAAGCTGAACTGG + Intronic
916044191 1:160986519-160986541 GCATTTGTATTAATATGAACAGG + Intergenic
916292211 1:163179235-163179257 ACACATGTAGTAAGATGAATCGG - Intronic
918405057 1:184204002-184204024 TTTTATGTATCAACATGAATAGG - Intergenic
921272101 1:213481121-213481143 TCTCATGTAATAGGATGAATGGG + Intergenic
922126610 1:222732460-222732482 GATTATATCTTAAAATGAATTGG + Intronic
922150762 1:223001993-223002015 GCTTATGTATATACATGCATAGG - Intronic
924141140 1:241024772-241024794 GCTTATGTATTAATATTAACTGG + Intronic
1063724983 10:8627127-8627149 ACTCTTGTATTAAGATGAAAAGG + Intergenic
1068279374 10:54849087-54849109 GCATATGTATTAATAAGAAAGGG - Intronic
1068472259 10:57480153-57480175 GTTTATGAATTAATATTAATAGG + Intergenic
1068492358 10:57739469-57739491 GCCTGTGTCTTAAGATGAAAGGG - Intergenic
1071409190 10:85370992-85371014 GCAAATGTAATAAGATGAAATGG - Intergenic
1071449092 10:85777453-85777475 GCTTATGATTTAAGTAGAATGGG + Intronic
1077968268 11:7159439-7159461 GCATATGTAATAAGTGGAATAGG + Intergenic
1078302920 11:10152161-10152183 AGTTATGTTTTAAGATAAATTGG - Intronic
1078429665 11:11279194-11279216 GCTTATGGCAGAAGATGAATTGG - Intronic
1078772840 11:14366603-14366625 GCTTATGTATTAATATATATCGG - Intergenic
1079421984 11:20302094-20302116 GCATATGGATGAAGATGTATAGG + Intergenic
1080190440 11:29539091-29539113 GGTTATGTATTAAAATCTATGGG - Intergenic
1085866512 11:80301102-80301124 GTTTATGTAATAAGCTGCATAGG + Intergenic
1087237098 11:95732240-95732262 AGTTATGTATAAGGATGAATTGG - Intergenic
1087999985 11:104866462-104866484 ATTTATGTATTAAAATGAAATGG - Intergenic
1088070425 11:105777529-105777551 GGTCATGTGTTAAAATGAATGGG - Intronic
1089623423 11:119735985-119736007 CCTTATGTAGAAAGATGAAAGGG + Intergenic
1090484754 11:127102983-127103005 CCTTATGTATTAACTTGACTAGG - Intergenic
1094367441 12:29698945-29698967 GCTGCTTTATTAGGATGAATGGG + Intronic
1095175037 12:39081825-39081847 ACTTATTTGTTAAGAAGAATGGG + Intergenic
1095590236 12:43894939-43894961 GCATATGTACTAAGTTCAATGGG + Intronic
1098879598 12:75903584-75903606 GCTTCTCTATTAAGGTGATTTGG - Intergenic
1099558075 12:84136008-84136030 GTATATGTATTAAAATGTATAGG + Intergenic
1103523556 12:121552296-121552318 GCTTAGGCATTAGAATGAATTGG - Intronic
1108943683 13:55992737-55992759 CATTATGTATTATGATGAACAGG + Intergenic
1109143034 13:58740224-58740246 GCATAAGTATTAATATGACTTGG - Intergenic
1109437925 13:62330774-62330796 GCTTAAGGATAAAGATGAGTGGG - Intergenic
1110503752 13:76260331-76260353 ACTTATGAATTTAGATGGATAGG - Intergenic
1111493785 13:89021265-89021287 GCTTAGCTATTATGCTGAATAGG - Intergenic
1114667330 14:24387030-24387052 TCTTAAGTAGTAAAATGAATGGG + Intergenic
1118519314 14:66564061-66564083 CCAGATGTATGAAGATGAATGGG - Intronic
1120739572 14:88092834-88092856 GCTTATGTAGGAGGATAAATGGG - Intergenic
1125222837 15:37359237-37359259 GTTTATTTGTTAAGATTAATGGG + Intergenic
1130797323 15:87223812-87223834 CCTTATGTGTTAAAGTGAATGGG - Intergenic
1139570524 16:67808878-67808900 GCTTCTTTCTTAAAATGAATGGG - Intronic
1145180428 17:20745205-20745227 ACTTATGTAATTAGAGGAATAGG - Intergenic
1146245191 17:31275352-31275374 GCCTATGTGATAAGATGAAGTGG - Intronic
1149384734 17:56130995-56131017 GCATATGTCTTAAATTGAATGGG + Intronic
1149582270 17:57758884-57758906 GCTTATCTATTAATACTAATTGG - Intergenic
1149824013 17:59809805-59809827 GCTCATTTAATAAGTTGAATTGG - Intronic
1149874079 17:60213051-60213073 GCCTTTGTATTAAAATGAATAGG - Intronic
1150087859 17:62290321-62290343 GCCTTTGTATTAAAATGAATAGG - Intergenic
1151525561 17:74664238-74664260 GCTTCTGTATTAACATGTAAAGG + Intergenic
1154509789 18:15085511-15085533 TCTTATTTATTAAAATGTATGGG - Intergenic
1156681594 18:39595857-39595879 GCATGTGTTTTAGGATGAATTGG + Intergenic
1156752404 18:40474898-40474920 ACTTATGCACTAAGATGAACAGG + Intergenic
1157925296 18:51758069-51758091 GCTTCATTTTTAAGATGAATTGG + Intergenic
1159154234 18:64561988-64562010 GCTTAAGGATCAAGATAAATAGG + Intergenic
1159748872 18:72275315-72275337 CCTTATGTATTGAGATGATCAGG - Intergenic
1161360521 19:3846655-3846677 GCTTATGTAGTAAGGAAAATGGG - Intronic
1163991204 19:21000661-21000683 GGTTATGTAATCAGATTAATTGG + Intergenic
1166539781 19:43597412-43597434 GCTTATGCATTCAGAGGGATAGG + Intronic
927275088 2:21255746-21255768 GCAAAGGTATAAAGATGAATGGG - Intergenic
929718662 2:44342079-44342101 GCTTATCAATTAAGATGCAAAGG + Intronic
935896390 2:107742421-107742443 GTTTAAGTACTAAGATGAAAAGG - Intergenic
936740650 2:115503017-115503039 TCTTATGCATTAATATGAAAAGG + Intronic
937135227 2:119545904-119545926 GGTTATGTAAGAAGATTAATGGG + Intronic
937711119 2:124980928-124980950 ACTGATGTATTAAGTTGCATGGG + Intergenic
939202186 2:139051304-139051326 GCTTAGGTTTTAAAATGCATGGG + Intergenic
939750316 2:146036513-146036535 AATTATGTATAAAGCTGAATTGG - Intergenic
940538115 2:154972378-154972400 GGCTATGTTTTAGGATGAATAGG + Intergenic
945740364 2:213652686-213652708 TCTTTTGTATTATTATGAATTGG + Intronic
948084519 2:235236251-235236273 GGTTGTGTAATAAAATGAATAGG - Intergenic
948149111 2:235730836-235730858 GGTTATGTATTAGGTTGTATTGG + Intronic
1169697157 20:8402976-8402998 GTTTATGTATTTTGATGACTTGG + Intronic
1169798262 20:9488810-9488832 GAGTATGTATTAAGATGAAGAGG - Intergenic
1174572302 20:51510541-51510563 GCTTGTGCATTAAGATTCATTGG + Intronic
1177197163 21:17915347-17915369 GCTTATGTATTATTATCAAGTGG + Intronic
1178385379 21:32144718-32144740 GCTTATGTTTCATGAAGAATGGG - Intergenic
950842606 3:15981967-15981989 GCTAATGTATTAAAATGTATTGG - Intergenic
950931562 3:16793804-16793826 CTTTATATTTTAAGATGAATGGG + Intergenic
952036481 3:29208291-29208313 GCTAATGTTTGAAGATGAAGAGG - Intergenic
952649017 3:35700393-35700415 GGTTATGTATTAAAATGCAATGG + Intronic
952857514 3:37784400-37784422 GCTTATGAATTAAGGAGAAAGGG - Intronic
953480849 3:43250729-43250751 AGTTATATATTAAGATGAAATGG - Intergenic
954200283 3:49020015-49020037 GCTTCTCTATTAAAAGGAATGGG - Intronic
954986122 3:54793732-54793754 GCTGATGTAATAAAATGAGTTGG + Intronic
955464969 3:59227249-59227271 GTCTAAGTTTTAAGATGAATGGG + Intergenic
955605571 3:60698939-60698961 GCTTATGTATTAAGATGAATGGG - Intronic
958622751 3:96582964-96582986 CCTGATGTATTAAGATGAGCTGG + Intergenic
961759734 3:129157747-129157769 TCTTCTGTATTATGATGACTGGG - Intronic
964333701 3:155632520-155632542 TCTTCTGTATTGAGATGACTAGG + Intronic
964796637 3:160505312-160505334 GGTTATGTATTCTGATGAATAGG - Intronic
965179739 3:165387141-165387163 GCTTATGGATGAAAATGAATAGG - Intergenic
966421679 3:179740225-179740247 GCTAATGTATAAAAATGAAATGG - Exonic
966854114 3:184182440-184182462 GCTTATTTTTTAAGATGCTTTGG + Intronic
967659546 3:192089721-192089743 ACTTATGTATAAAGATAAATAGG + Intergenic
968865230 4:3205872-3205894 GATTATGAATCAAGATGAAAAGG + Intronic
972355034 4:38272484-38272506 GCTTATGTTTTAAAATGGAAGGG - Intergenic
974201804 4:58651858-58651880 GGTTATGTATTAAGATGAAGAGG + Intergenic
977244130 4:94610058-94610080 GCTTAGATATTAATATGAAATGG + Intronic
977284851 4:95090139-95090161 GGATATGTATTAAAATCAATAGG - Intronic
977797320 4:101182334-101182356 GCTTAAGTATTAAAATGCACTGG + Intronic
982244617 4:153338931-153338953 GCCTATGTATGAATATGAAGGGG + Exonic
985389213 4:189477763-189477785 GCTTAAGTATTGAGATGATAGGG + Intergenic
986558395 5:9035256-9035278 GCTTTTTCATAAAGATGAATAGG + Exonic
987730713 5:21768919-21768941 GATAATATATTATGATGAATGGG + Intronic
993961547 5:94303585-94303607 GTTTCTGTATAAAGAAGAATTGG + Intronic
996414523 5:123195825-123195847 GCTTATATACAAAAATGAATAGG + Intergenic
996763838 5:127015412-127015434 GATTATTTATTCAGTTGAATGGG + Intronic
999543450 5:152599945-152599967 GTTTATTTATTAAGTTGAAGAGG + Intergenic
1001805308 5:174580245-174580267 GGTTATATACTAAGATGAAATGG - Intergenic
1002146628 5:177188325-177188347 GTTTATTTATTAAGATCAGTTGG + Intronic
1003139741 6:3460426-3460448 GCTTCTTTATTAAGATCACTGGG - Intergenic
1012493193 6:99805877-99805899 GCATATAAATTAACATGAATTGG - Intergenic
1012660042 6:101876913-101876935 GCTTATGTATAGAGATGTAGGGG - Intronic
1013646174 6:112143588-112143610 GCTTGTTTATTAAGATGTATTGG - Intronic
1020725132 7:11803050-11803072 GCATATGTAATAAGATAATTTGG + Intronic
1026341239 7:69435911-69435933 GCCTATGTATTGAACTGAATTGG - Intergenic
1027538286 7:79434744-79434766 TCTTATGTATTAACTTGACTGGG + Intronic
1027791135 7:82639826-82639848 ACTTATGTTTTAGGATCAATTGG - Intergenic
1028956001 7:96691135-96691157 GTTTATGTATTAAGAGAAATAGG - Intronic
1029518612 7:101045200-101045222 ACTGATTTATTTAGATGAATAGG + Intronic
1029795742 7:102893037-102893059 GATTATGTATCAAAATGAATTGG - Intronic
1031599527 7:123689346-123689368 GCTTATACATTAAGATGGAAAGG - Intronic
1032680501 7:134177914-134177936 GATAATGTATTTAGAAGAATGGG + Intronic
1033618640 7:143041594-143041616 ACTTATGAATTAAGATGCATTGG + Intergenic
1035844667 8:2850141-2850163 GCTTATGTATTATGTGTAATTGG + Intergenic
1037942051 8:22959015-22959037 GTTTTTGTATGAAGATGATTGGG + Intronic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1041564370 8:59260527-59260549 ACTAATATATTATGATGAATAGG - Intergenic
1044736575 8:95285171-95285193 ACTGATGTATTGAGATGAACTGG + Intergenic
1047164080 8:122417269-122417291 GCTTGTGTTTTCAGTTGAATAGG + Intergenic
1047943567 8:129851281-129851303 GTTTATGTTTTAAGATTACTTGG + Intronic
1050712660 9:8483425-8483447 GTTTATGGAATAAGGTGAATAGG - Intronic
1051526022 9:18045543-18045565 GCTTATTAAATTAGATGAATGGG + Intergenic
1052235256 9:26205489-26205511 CCAGATGGATTAAGATGAATGGG - Intergenic
1055370806 9:75596893-75596915 GTTTATATTTTAGGATGAATAGG - Intergenic
1056316210 9:85392932-85392954 GCTGATGTTTTCAAATGAATGGG - Intergenic
1057038452 9:91830011-91830033 GGTTTTGTATTCAGATGCATAGG - Intronic
1058802237 9:108555741-108555763 GCTTATGTGTATAAATGAATAGG - Intergenic
1059450877 9:114370828-114370850 GCTTCTGTATGCAGATGAGTTGG - Intronic
1059706857 9:116832870-116832892 GCTAATGTCTTAAAATGATTTGG + Intronic
1059927534 9:119226207-119226229 GTTTATTTTTTAAGATGATTGGG - Intronic
1060141430 9:121213632-121213654 GCTGTTGTATTAATATTAATTGG + Intronic
1062553717 9:137104087-137104109 GCTTCAGTTTTAAGATGAAAAGG - Intronic
1187764505 X:22625372-22625394 TCTTATGTATTCAGATTTATAGG - Intergenic
1189099891 X:38177893-38177915 GATAATGTACTAAGATGAATGGG - Intronic
1189357058 X:40317999-40318021 GCTTCTATATTAAGAAAAATGGG + Intergenic
1190627331 X:52349322-52349344 GCTGATCTTTTAAGATGATTTGG + Intergenic
1191726901 X:64291391-64291413 GCTTACGTGTTTAGATGACTAGG - Intronic
1192494527 X:71606290-71606312 GCTTAAATATTAGGATGAAATGG + Intronic
1193291658 X:79780156-79780178 TATTATGTATTAAGTAGAATTGG - Intergenic
1196297096 X:114010710-114010732 ACTTGTTTATTAAGTTGAATAGG + Intergenic
1197227134 X:123965448-123965470 ACTTATGAATTAAAGTGAATGGG + Intronic
1197362335 X:125520512-125520534 GCTTATGTAATAAAATAAAAGGG + Intergenic