ID: 955608808

View in Genome Browser
Species Human (GRCh38)
Location 3:60735329-60735351
Sequence CTGGAGTCAGAACTGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 355}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955608808_955608812 -10 Left 955608808 3:60735329-60735351 CCCTTCTCCAGTTCTGACTCCAG 0: 1
1: 0
2: 3
3: 37
4: 355
Right 955608812 3:60735342-60735364 CTGACTCCAGATGGTGTAGATGG 0: 1
1: 0
2: 0
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955608808 Original CRISPR CTGGAGTCAGAACTGGAGAA GGG (reversed) Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901680413 1:10909741-10909763 CAGGAAGCAGAACTGAAGAAGGG + Intergenic
901700843 1:11044168-11044190 CAGGGGTCAGACCTGGGGAAAGG - Intronic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
902436893 1:16403926-16403948 GCGTAGTCAGAACTGGAGGAGGG - Intronic
902991399 1:20189866-20189888 CTGGTGGCAGAGCTGGAGATAGG - Intronic
903552072 1:24164541-24164563 CTGGAGCCAAAAGTAGAGAAGGG - Intronic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
905469738 1:38182848-38182870 CAGAAGACAGAACTGGAGAGTGG - Intergenic
905941079 1:41864001-41864023 CTGGAATCAGACGTGGAGAGAGG + Intronic
905949244 1:41933886-41933908 CTGGATTCAGAAGTGAAGCAGGG - Intronic
907109619 1:51914909-51914931 GGGGAGTCAGGTCTGGAGAATGG + Exonic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907384615 1:54117978-54118000 ATGGAGTCAGATTTGCAGAATGG - Intergenic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
907772878 1:57483728-57483750 GTGGAGTCAGAACTGGAAGCAGG - Intronic
909056475 1:70826684-70826706 CAGTAGTCAGGGCTGGAGAAGGG - Intergenic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
911154504 1:94625086-94625108 CTGGAGTGTGCATTGGAGAAAGG + Intergenic
911209071 1:95120621-95120643 CTTGAGCCAGCACTGGAGGAAGG + Intronic
911651939 1:100398834-100398856 CTGGGTTCAGACCTGGAGAGAGG + Intronic
914884502 1:151574154-151574176 CTGGAGCCATGACGGGAGAAAGG - Intronic
915064002 1:153209889-153209911 CTGGAGTAAGAACTGGAGGAAGG - Intergenic
915441151 1:155946250-155946272 GTGGGGTCAGATCAGGAGAAGGG - Intergenic
916326978 1:163573268-163573290 CTGGATTTAGAACTGGTAAATGG + Intergenic
916620008 1:166486991-166487013 CTGACCTCAGAACTGGAGAGAGG + Intergenic
916833940 1:168522664-168522686 CTGGATTCAAAACTAGGGAAAGG + Intergenic
918363691 1:183784492-183784514 CAGGAGTCAGACCTGGAACATGG + Intronic
918579417 1:186108569-186108591 CTTGGCTCAGAAATGGAGAACGG + Exonic
918682714 1:187374856-187374878 CTGGAGAAAGAACTGGAAAGTGG - Intergenic
919697248 1:200590117-200590139 CTGGAAGCAGAACTGGTAAAAGG - Exonic
919757036 1:201072723-201072745 CTGGAGACTGGACTGGAGCAGGG - Intronic
920919174 1:210284131-210284153 CTGGAGTCAGAACTGCTGTCAGG - Intergenic
922008902 1:221561160-221561182 ATGGAGTTAAAACTGGTGAATGG + Intergenic
923251408 1:232182262-232182284 CTGGAGTAGGAACTGGAAATGGG + Intergenic
923884279 1:238137904-238137926 CTGGTGTCAGAAGTGAAGTATGG - Intergenic
924023346 1:239808223-239808245 CTGAAGTCAGATGTGCAGAAAGG + Intronic
1063226375 10:4018713-4018735 TTGGTGTCAGAACTGGGAAAAGG + Intergenic
1063535922 10:6883417-6883439 CTGGACACAGAACTTGGGAATGG + Intergenic
1065144353 10:22753298-22753320 CTGGATTCAGAACAGGAGGAAGG + Intergenic
1065772711 10:29092525-29092547 CTGGAATCAGATTTGGATAATGG + Intergenic
1067696916 10:48542473-48542495 CAGGAGGCAGGACTGCAGAAGGG - Intronic
1068417434 10:56742259-56742281 TTGGACTTAGCACTGGAGAAGGG + Intergenic
1071435249 10:85642985-85643007 ACGGTATCAGAACTGGAGAAGGG - Intronic
1071518831 10:86316495-86316517 CTGGGTCCAGCACTGGAGAAAGG - Intronic
1071570015 10:86691631-86691653 CTGGAGTTAGCACTGGGGAAGGG + Intronic
1071752517 10:88496499-88496521 CTTGAACCAGAATTGGAGAAAGG + Intronic
1075255957 10:120926358-120926380 CTGGAGGCAGCTCTGGAAAAAGG + Intergenic
1075541149 10:123315599-123315621 CTGGTCTAAGCACTGGAGAAAGG + Intergenic
1075655697 10:124159691-124159713 TTGGCATCAGAACGGGAGAAAGG + Intergenic
1076206711 10:128609833-128609855 CTGCTGTCTCAACTGGAGAAGGG + Intergenic
1076268389 10:129129262-129129284 CTGGAGCAATCACTGGAGAAGGG - Intergenic
1076518806 10:131066478-131066500 ATGGAGTCAGCACTGCAGATGGG - Intergenic
1077194755 11:1273794-1273816 GTGGAGTCAACACTGCAGAAAGG + Intergenic
1077920370 11:6637531-6637553 CTGGAGTTAAGACTGGAGATGGG - Intronic
1078390859 11:10934259-10934281 CTGGAGTCCGGACTGAGGAACGG + Intergenic
1078609981 11:12811606-12811628 CAGGAGTCAGGGCTGGAGAGGGG + Intronic
1079219094 11:18543510-18543532 CTGGAGTTTGAACTGGAGTTTGG - Intronic
1079368971 11:19833747-19833769 CTGGAGGCTTAACTGGGGAAGGG + Intronic
1080457591 11:32430529-32430551 CTGGGCTCAGGAATGGAGAAGGG - Intronic
1080831478 11:35897196-35897218 CAGGAGTCAGATCTTGGGAAAGG + Intergenic
1081897385 11:46598345-46598367 CTGGATACTGAACAGGAGAAAGG - Intergenic
1081905061 11:46663854-46663876 CTGGAGTCAGGAGTGAAGCAGGG - Intronic
1082793700 11:57365104-57365126 CAGGAGGGAGCACTGGAGAATGG - Intronic
1083484345 11:62974006-62974028 CTGTGGTCAAAACTGGAGATAGG + Intronic
1083991483 11:66248672-66248694 TGGGAGTCTGAAATGGAGAAAGG - Intergenic
1084793758 11:71490928-71490950 CTGGATGCAGAACTGGACGAAGG - Exonic
1084926526 11:72517413-72517435 GTGGGGTCAGATCTGGAAAAAGG + Intergenic
1085238224 11:75031608-75031630 CTGGAGTCTGAGCTGGAGAGAGG - Intergenic
1085297487 11:75439262-75439284 TTTTAGACAGAACTGGAGAAGGG + Intronic
1085299055 11:75447940-75447962 CTGGGGTCAGCACTGGAGTCTGG + Intronic
1085472803 11:76768978-76769000 CTGAACTCAGAACTGCAGACAGG + Intergenic
1085503374 11:77041543-77041565 GGGGAGTCCGAAGTGGAGAAAGG + Exonic
1085676479 11:78524520-78524542 TTAAAGTCAGAATTGGAGAAAGG - Intronic
1085727345 11:78965635-78965657 CTGGGGTGAGAACGGCAGAACGG + Intronic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087606073 11:100379887-100379909 CTGGAGTCAGGACTGGTAGAGGG + Intergenic
1087659959 11:100975887-100975909 CTGTCCTCAGTACTGGAGAAAGG - Intronic
1087846938 11:102984081-102984103 CTGGAGACAAAACTTGAGAGTGG + Intergenic
1088711683 11:112514149-112514171 CTGGAGGCAGCACGGGGGAAGGG - Intergenic
1089809550 11:121120589-121120611 ATGGAGACAGTGCTGGAGAAGGG - Intronic
1089850300 11:121490151-121490173 AAGGAGCTAGAACTGGAGAAAGG - Intronic
1089947156 11:122487873-122487895 GGGTAGTCAGAACTTGAGAAGGG - Intergenic
1090347964 11:126086187-126086209 CTAGAAGCAGACCTGGAGAAAGG + Intergenic
1091400024 12:175909-175931 GTGGAAGCAGAACTGGAGACGGG + Exonic
1091571234 12:1688450-1688472 CTGGAGCCACAACTGGATTATGG + Intergenic
1091678646 12:2510379-2510401 CTTTAGTCAGATCTGGAGCATGG - Intronic
1093714040 12:22361206-22361228 CTGGACTGGGCACTGGAGAAGGG - Intronic
1094426383 12:30321072-30321094 TTGGAGTCAGATAGGGAGAATGG - Intergenic
1096282055 12:50264507-50264529 CTGGAGGCAGGACAGTAGAATGG + Intronic
1097173994 12:57132387-57132409 CTGGAGTCAGGAGGGTAGAAAGG - Intronic
1097263732 12:57734265-57734287 CTGGGGTCAGCACTGGCCAAAGG - Intronic
1098066620 12:66625136-66625158 CTGGGGACAGATTTGGAGAAAGG + Intronic
1098616062 12:72524228-72524250 CTGAAGTCAGAATAGCAGAAAGG + Intronic
1099021868 12:77416286-77416308 CCTGAGTCAAAACTGCAGAATGG - Intergenic
1099453435 12:82835912-82835934 CTGGCCACAGCACTGGAGAAGGG - Intronic
1099963509 12:89419572-89419594 ATGGAGTCAGCTCTGGAGATAGG + Intergenic
1101490934 12:105208634-105208656 CTGGAGTCATCCCTGGACAAAGG + Intronic
1102418252 12:112783243-112783265 TTGGAGTCAGTGCTGGAGTAGGG + Intronic
1105507327 13:21021560-21021582 CTGGAGTAAGAACTTGGCAAAGG - Intronic
1105530258 13:21212579-21212601 CTCGAGTGAGAACAGGAGGAAGG + Intergenic
1106000757 13:25720723-25720745 AGGAAGTAAGAACTGGAGAATGG - Intronic
1109782311 13:67127813-67127835 AGGGAGTCAGTACTGGAGATGGG + Intronic
1110260442 13:73478635-73478657 GTGGCTTCAGAAGTGGAGAAAGG - Intergenic
1110495315 13:76161344-76161366 CTGGAGTCAGTCATGGAGTAAGG - Intergenic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113049431 13:106193009-106193031 CAGGAGTTAGAAATGGAGAAAGG + Intergenic
1113698916 13:112368493-112368515 CAGAAGACAGAACTGGAGATGGG + Intergenic
1113822607 13:113225722-113225744 CTGGAGTCAGAGCTGCAGGATGG + Intronic
1113879253 13:113614519-113614541 CTTGAGTCAGACCTTGAGGAAGG + Intronic
1114722283 14:24895382-24895404 TTGAAGTCAGAACTGAAGAATGG - Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116352715 14:43885666-43885688 CCAGGGTCAGGACTGGAGAAAGG + Intergenic
1116680379 14:47961341-47961363 CTGGAGTCAGAACTTATGGAGGG - Intergenic
1117173398 14:53123761-53123783 CTGGATTAAAAACCGGAGAATGG + Intronic
1118106436 14:62665481-62665503 CAGCAGTCTGAACTGGAGACAGG - Intergenic
1119266454 14:73265527-73265549 CTGGAGGCAGAATAGGAGGAAGG - Intronic
1122059025 14:99124424-99124446 TTAGAGGCAGAAGTGGAGAAGGG - Intergenic
1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG + Intergenic
1122217066 14:100211706-100211728 CTGGACACAGAAGTGGAGACTGG - Intergenic
1122869128 14:104626964-104626986 TTGGAGAAATAACTGGAGAAGGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1124877284 15:33606964-33606986 CTGCAGTCAGATCTGCACAAGGG + Intronic
1125921395 15:43527789-43527811 AGTGACTCAGAACTGGAGAAGGG + Exonic
1126300347 15:47187854-47187876 CTGGAGTCAGGACTTAAGACAGG + Intronic
1126426885 15:48537386-48537408 CTGGGGTCAGAAAGGGGGAATGG + Intronic
1126538569 15:49796243-49796265 CTGGAACAAAAACTGGAGAAAGG - Intergenic
1126761943 15:51977494-51977516 CTGGAGTAGGAACTGTAGGAGGG - Intronic
1127727891 15:61768279-61768301 CTGGTGTCAGAGCTGGGGCAGGG - Intergenic
1128110287 15:65071818-65071840 CTGGGGGCAGGGCTGGAGAAGGG - Intronic
1129599944 15:76992934-76992956 CTCGAGGTAGAACTGGAGAAAGG + Intergenic
1129664828 15:77573715-77573737 CAGGAGCCAGAAGTGGAGGATGG + Intergenic
1130299963 15:82672984-82673006 CTGGAGGCTGTACTGGGGAAAGG - Intronic
1130563751 15:84978461-84978483 CTGGGGGCAGGACTGGAGGAAGG + Intergenic
1131622583 15:94083109-94083131 CTGGAGCCAGGATTGGAGCATGG - Intergenic
1133162956 16:3924040-3924062 CTGGAGTTAGGATTGGGGAATGG + Intergenic
1133740120 16:8644978-8645000 CTGGAGTCTGAACTGTCCAACGG - Intronic
1134322237 16:13174515-13174537 CTGGAGACAGAACTGGGGGCAGG + Intronic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134562309 16:15221093-15221115 CAGGGGTCATAACTGGAGAGAGG - Intergenic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134922849 16:18132720-18132742 CAGGGGTCATAACTGGAGAGAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135621771 16:23962141-23962163 GTGGAGTCAGATCTGGAGGCAGG - Intronic
1135763008 16:25152721-25152743 GTGGGGACAGAACTGGAGGATGG - Intronic
1137390282 16:48075527-48075549 CTGGACTGACAACTGGAGGATGG - Intergenic
1137653020 16:50136544-50136566 CTGGAGAAATAACTGCAGAATGG + Intergenic
1137935035 16:52626708-52626730 CAGAAGCCAGAACTGGTGAAGGG + Intergenic
1138157480 16:54719548-54719570 TTGGTGGTAGAACTGGAGAAAGG + Intergenic
1138309351 16:56009929-56009951 CTGAAGTTGGAGCTGGAGAAGGG + Intergenic
1139259773 16:65580268-65580290 GTGGAGTTAGAAGTAGAGAAAGG + Intergenic
1139550874 16:67672381-67672403 CTGAAGTCAGAAGTGGTGACCGG + Intergenic
1139669013 16:68479133-68479155 CTGCAGGCAGAACTGAAGGAAGG - Intergenic
1140862233 16:79028054-79028076 CGGGAGGCAGAGCAGGAGAATGG - Intronic
1142249596 16:88985317-88985339 CTGGAGTCAGGACTGAACACGGG - Intergenic
1142629632 17:1216430-1216452 CTCACGTCAGAAGTGGAGAAAGG + Intronic
1143592003 17:7890806-7890828 ATGGAGACTGGACTGGAGAATGG + Intronic
1144612515 17:16734954-16734976 CTCAATTCTGAACTGGAGAATGG + Intronic
1144900214 17:18580324-18580346 CTCAATTCTGAACTGGAGAATGG - Intergenic
1145132232 17:20365350-20365372 CTCAATTCTGAACTGGAGAATGG + Intergenic
1146484376 17:33231350-33231372 CTGGAGTCTGGTCTGGGGAAGGG + Intronic
1146923667 17:36729925-36729947 CTCCAGGCAGAACTGGACAAAGG + Intergenic
1147317846 17:39629312-39629334 CAGGAGTCAAAGCTGGAGACTGG + Intronic
1148272740 17:46276465-46276487 CTGGAATCAGAACTGGATGTTGG - Intronic
1149136483 17:53371446-53371468 CTAGAGCCAGAACAGTAGAATGG + Intergenic
1149536400 17:57436898-57436920 CTGGAGTCAACCCAGGAGAAGGG - Intronic
1150763272 17:67981465-67981487 CTGGAATCAGAACTGGATGTTGG + Intronic
1150805593 17:68316304-68316326 ATGGAAACAGAACAGGAGAATGG - Intronic
1150880124 17:69015062-69015084 CTGGAGGCAGAATGGAAGAATGG - Intronic
1151040313 17:70851922-70851944 CTGTAGTCAGAAAAGGGGAAAGG + Intergenic
1151607371 17:75147068-75147090 GTGGGGAGAGAACTGGAGAAGGG - Intronic
1152457552 17:80425021-80425043 CAGGAGTCGGATCTGGAAAATGG - Exonic
1152545589 17:80998656-80998678 CAGAAATCAGAACTGGGGAAAGG + Intronic
1153536050 18:6102491-6102513 CAGGAGTCAGAATGTGAGAAAGG - Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1153764758 18:8365053-8365075 TTGGGGGCAGAACTGGAGACGGG - Intronic
1153950269 18:10052551-10052573 CCTGAGTCAGAACAGCAGAAGGG + Intergenic
1155118823 18:22797845-22797867 CAAGAGTCAGATCTGAAGAATGG + Intergenic
1155508459 18:26552716-26552738 CTGAAGGCAGATCTGGGGAATGG + Intronic
1156267203 18:35499549-35499571 CTGGGGTCAGGAATGGATAAGGG - Intergenic
1157408063 18:47440423-47440445 CTGGAGGTAGAACCTGAGAAGGG + Intergenic
1159611821 18:70534043-70534065 CTGGGATGACAACTGGAGAAAGG - Intergenic
1159909623 18:74133336-74133358 CTGGAATCAGATTTGGAGCATGG - Intronic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160820140 19:1054080-1054102 CAGGAGACAGCGCTGGAGAACGG + Exonic
1160837438 19:1131507-1131529 CTGGAGTCAGTTCTGGAGTCAGG - Intronic
1161014195 19:1975442-1975464 GGAGAGTCAGAACTGGAGACGGG + Intronic
1161111422 19:2472908-2472930 CTGGAGCCAGGGCTGGAAAAAGG + Intergenic
1161140754 19:2646342-2646364 ATGGGGTCAGCATTGGAGAACGG + Intronic
1164590751 19:29505477-29505499 CAGGGGTCAGAGGTGGAGAATGG - Intergenic
1165495707 19:36151134-36151156 CTGGAGTCCGAACTAGAGCTGGG - Intronic
1165698738 19:37921112-37921134 CCAGAGTCAGAACTGGAAAGGGG - Intronic
1166254699 19:41594973-41594995 GTGGAGTGAGAACTGGACAAAGG + Intronic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1166822594 19:45589689-45589711 TTGGAGTCTGATCTGGAGGAGGG - Intronic
1166844487 19:45718302-45718324 CTGGAGTGTGAGCTGGAGCAGGG + Intronic
1168266590 19:55226957-55226979 CTGGAGTCAGAACCGGGGGAAGG + Exonic
1168583295 19:57573184-57573206 CTAGAGTCTGCACTGGAAAAAGG - Exonic
924983418 2:245027-245049 AGGGAGTCAGAACGGGAGCATGG - Intronic
925475227 2:4206029-4206051 CCTGAGTCAGAACTGAAGCAGGG + Intergenic
925678842 2:6395608-6395630 CTTGAGTAAAAACTGGACAAGGG - Intergenic
925918340 2:8623133-8623155 CGGGAGGCAGAACTGCAGAGAGG - Intergenic
927214790 2:20662168-20662190 TTTGACTCAGAGCTGGAGAAAGG - Intergenic
929524489 2:42687868-42687890 CTGGAGTCAGAGATGAAGAAGGG - Intronic
929858629 2:45656016-45656038 CTGTAGTCAGGGTTGGAGAATGG + Intronic
930539874 2:52691622-52691644 AAGGAATCAGAGCTGGAGAAAGG + Intergenic
931314201 2:61111713-61111735 CTGAGAGCAGAACTGGAGAAAGG - Intronic
931839352 2:66132167-66132189 CAGGAGGCAGACCTGGAGCATGG + Intergenic
932468581 2:71939522-71939544 CTGGAGTCAGATCTAGAGGAAGG + Intergenic
933414871 2:81974578-81974600 ATGGAGTCAGGACTAGAAAAAGG - Intergenic
933599734 2:84317282-84317304 CTGGAGAAAGGACTGGTGAAGGG + Intergenic
935588054 2:104819795-104819817 CTGGTGTCTGCCCTGGAGAAGGG + Intergenic
936244833 2:110817452-110817474 CTGGAGGCTGCACTGGAGAAGGG + Intronic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
936526833 2:113247068-113247090 TGGGAGTGAGAACTGGGGAAGGG - Intronic
937904381 2:127045822-127045844 TTGGAGCCAGGACTGGAGAGAGG - Intergenic
939023801 2:136988272-136988294 CTGGCCTCAGAAGTGGAGCAGGG + Intronic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
941015957 2:160356555-160356577 GTGGAGCCAGAACTTAAGAATGG - Intronic
941059431 2:160828365-160828387 CTAAAGTCAGAAGTGGACAAGGG - Intergenic
944761231 2:202816653-202816675 TGGGATTCAGAAATGGAGAAAGG - Intronic
944912875 2:204327463-204327485 CTGGCTGCAGACCTGGAGAAAGG + Intergenic
946219174 2:218211631-218211653 CTGGAGGACTAACTGGAGAATGG + Intergenic
947315345 2:228851625-228851647 CTGGAGACAGGACTGGAGGGGGG + Intronic
948173087 2:235922049-235922071 CTGGAATCACAACTGGATGAAGG - Intronic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948752202 2:240139297-240139319 CAGAAGTCAGAGGTGGAGAAAGG + Exonic
948841046 2:240649089-240649111 CTGGATTCAGGACTGAAGGAGGG + Intergenic
1169081115 20:2798275-2798297 CTGCAGTCAGGCCTGGAGGACGG - Exonic
1169424092 20:5483119-5483141 ATGGAGTGAGAACTGGAATAAGG - Intergenic
1170036074 20:11991461-11991483 GTGAAGTGAGACCTGGAGAAGGG + Intergenic
1170373223 20:15672530-15672552 CTGGAGTGAGAATGGGAGCAAGG - Intronic
1170450891 20:16482591-16482613 CTGGTGTTAGAACTGAAGAATGG - Intronic
1171191907 20:23164797-23164819 CTGGACACAGAAGTGGAAAATGG - Intergenic
1171354419 20:24533343-24533365 CTGTGGTCAGAACTGGAGAAGGG - Intronic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1172140449 20:32719224-32719246 CTGGAGTCTGGATGGGAGAATGG + Intronic
1172327504 20:34047940-34047962 CTGGGGTCTGAACTTGAGGAAGG - Intronic
1173353078 20:42262621-42262643 CTGGAGGCAGAAGTGGGGATGGG + Intronic
1173355920 20:42290289-42290311 CTGGAGTGGGAAGTGGAGCATGG - Intronic
1173942272 20:46921487-46921509 CTGCACTTAGAACTGGAGAGTGG - Intronic
1173957296 20:47043514-47043536 CTGAAGACAGCACTGCAGAAAGG - Intronic
1175647578 20:60687901-60687923 GTGGATTCAGAACTGGCCAAGGG - Intergenic
1176423551 21:6534003-6534025 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1176588244 21:8611306-8611328 CAGGAATCAGAAAGGGAGAAAGG + Intergenic
1178665556 21:34543335-34543357 CTGGAGTCGGAGATGGAGACAGG + Intronic
1179318766 21:40270215-40270237 CTGGAGGCAGAAGCAGAGAATGG - Intronic
1179699045 21:43142319-43142341 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1179975513 21:44863466-44863488 CTGGGTTCAGAACTGGAGTCAGG + Intronic
1179987558 21:44930081-44930103 CAGGACTCAGAACTGGAAGAGGG - Intronic
1180271076 22:10588302-10588324 CAGGAATCAGAAAGGGAGAAAGG + Intergenic
1181425852 22:22838193-22838215 CTGGATACAGACCTGGAGATAGG + Intronic
1181545245 22:23598717-23598739 ATGGGGTCAGAGCTGGGGAATGG + Intergenic
1181726396 22:24813964-24813986 TTGGGGTCAGAACTGGAACAAGG - Intronic
1181777820 22:25172228-25172250 CCTGAGTCAGAACTGGGGAATGG - Intronic
1181815066 22:25431164-25431186 ATGGGGTCAGAGCTGGGGAATGG - Intergenic
1181855327 22:25777460-25777482 CTGGAGGCAGATCTGGAGGCAGG + Intronic
1182797208 22:32999739-32999761 CTGGAGGCAGAACTAGAGGGAGG + Intronic
1183437167 22:37802829-37802851 CTGAAGCCAGAATTGGGGAAAGG - Intergenic
949139089 3:610431-610453 CAGGAATCAGAAATGGAGAAAGG - Intergenic
950037632 3:9898629-9898651 CTGGAGTCAGAGGGGGAAAAGGG - Intergenic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
950719853 3:14875175-14875197 CTGAAGTCACATCTGGAGACGGG - Intronic
951883230 3:27499668-27499690 CTGGAGTCTGCACTGGTTAAGGG - Intergenic
951924095 3:27888108-27888130 CTGGAGGCTGAACCGGAGAATGG - Intergenic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
954343107 3:49971512-49971534 CTGGTCTGAGAGCTGGAGAATGG - Intronic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
956283970 3:67589360-67589382 CTGGAGATATAACTGGAGTAAGG - Intronic
960249813 3:115439398-115439420 CTGGAAGCAGAACTAGAGAGAGG - Intergenic
961958740 3:130831858-130831880 ATGGAGCCAGAGCTGCAGAAAGG + Intergenic
962860809 3:139399235-139399257 ATGGAGGCAGAACTTGAGACAGG - Intergenic
963492453 3:146018361-146018383 CTGCTTCCAGAACTGGAGAAGGG - Intergenic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
966129520 3:176621662-176621684 CAGGAGCCAGAGCTGTAGAATGG + Intergenic
966610393 3:181862336-181862358 CTGGAGTGAAAAATGTAGAAAGG - Intergenic
966873699 3:184309085-184309107 CTGGAGTCTAAACTAGAGTAAGG + Intronic
967133041 3:186490190-186490212 CAGGCAACAGAACTGGAGAATGG + Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968594381 4:1474661-1474683 CCAGAGTAAGAACTGGGGAAAGG + Intergenic
969538089 4:7768950-7768972 CTGGTGTCACAGCTGGAGATGGG + Exonic
969623763 4:8292240-8292262 TTAGAGGCAGATCTGGAGAAGGG + Intronic
972339345 4:38137546-38137568 CAGTAATCAGGACTGGAGAAGGG - Exonic
972352707 4:38251745-38251767 CTGGAGTAAGAGCTGGTGACAGG + Intergenic
975619398 4:76280870-76280892 CAGGAGGCAGAAATGAAGAAAGG - Intronic
976572990 4:86635009-86635031 TCAGAGACAGAACTGGAGAATGG - Intronic
977137081 4:93318788-93318810 CTGGTGTCAGAGCTGGTGAGGGG + Intronic
979323463 4:119351335-119351357 GTGGAGTCAGTACTGGAGGCAGG + Intergenic
979719926 4:123886979-123887001 CTGGAGTCTTAGCTGGAGAGTGG + Intergenic
980774966 4:137425827-137425849 CAGGTGAAAGAACTGGAGAAGGG - Intergenic
981588780 4:146333530-146333552 AAGGAGTCAGAACAGAAGAAGGG + Intronic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
983161924 4:164427333-164427355 CTGGAATGGGAACTGGAGCAGGG - Intergenic
983241294 4:165236013-165236035 GTGGAGTCAGTACTGGAGGCAGG + Intronic
984744683 4:183202817-183202839 CTGGAGTCAAGGCTGGGGAAAGG + Intronic
988400448 5:30754130-30754152 CTGCAGACAGAAGTGGATAAGGG + Intergenic
988595366 5:32585781-32585803 GTGGAGTCAGAAACGGAGAAGGG - Intronic
989383139 5:40828896-40828918 TTGGAGACAGAAGTGGAGAGAGG - Exonic
990411304 5:55543783-55543805 CTGGAGTTAGAAGTGGGGAATGG + Intergenic
991021345 5:61983027-61983049 CTGGAGTCTCAACTGCAGTATGG - Intergenic
992935205 5:81696171-81696193 GTGGAGTCAGGAGTGGGGAAGGG - Intronic
995141695 5:108742546-108742568 ATGGAGTCAACATTGGAGAAAGG - Intergenic
995347015 5:111133051-111133073 CTGAACTTAGAACTGGAGAAGGG + Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996012257 5:118493985-118494007 CTGTAGGCAGAGCTGGACAATGG - Intergenic
996269148 5:121581012-121581034 TTGGAGTCAAAAGTGGAGGAAGG - Intergenic
996325597 5:122269238-122269260 ATGGATACAGAACTGCAGAATGG + Intergenic
997641158 5:135449740-135449762 CTGGAGCCCTACCTGGAGAAAGG - Exonic
998534373 5:142915770-142915792 CTGGGGTCAAAAAAGGAGAAAGG - Intronic
999595673 5:153201621-153201643 CTGAAGTTAGATCTGGAGATGGG + Intergenic
999882840 5:155886429-155886451 GTCCAGTCAGAACTGGAGAATGG + Intronic
1000202039 5:159020535-159020557 CTGGACACAGAACTGCAGGAAGG - Intronic
1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG + Intergenic
1001907279 5:175483667-175483689 CTGGCTTCAGGACTGCAGAAAGG - Intronic
1002294318 5:178221723-178221745 GTGGAGAAAGAACTGGAGGAAGG - Intronic
1002519052 5:179780512-179780534 CTGGAGGCAGGGCTGCAGAACGG + Intronic
1003067269 6:2914302-2914324 CTGAAGTCAGAACTCCAAAACGG - Intergenic
1003454653 6:6270650-6270672 GTGGAGACAGAACTGGGGACAGG + Intronic
1005429837 6:25743960-25743982 TTTGAGTCAGATCTGGAAAAGGG + Intergenic
1005453598 6:25997990-25998012 TTTGAGTCACCACTGGAGAAAGG + Intergenic
1007427066 6:41754057-41754079 CAGGAATGAGAAATGGAGAAAGG - Intronic
1008592748 6:53010348-53010370 CTGGAGTCAGAAGGGAGGAATGG - Intronic
1009873225 6:69473989-69474011 CTGGTGTCAGAAGTGAAGTATGG - Intergenic
1010652690 6:78473567-78473589 CTGGAGTCAGAAATGTACAGAGG + Intergenic
1011000759 6:82585519-82585541 CTGGAGGAAGAAGTAGAGAAAGG - Intergenic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1012976713 6:105787730-105787752 ATGAAGTGAGAACTGGGGAAGGG - Intergenic
1016804262 6:148197089-148197111 AAGGAGTCAGAACAGTAGAATGG + Intergenic
1017201599 6:151760422-151760444 CTGAAGTCTGAATTGGACAATGG - Intronic
1019735411 7:2647800-2647822 CTGGTGTCAGTTCTTGAGAAAGG - Intronic
1019962208 7:4470269-4470291 CTAGAGTCAGCAGTGGAGAGGGG - Intergenic
1020118432 7:5489274-5489296 CTGGAGAATGAACTGGAGATAGG - Intronic
1021550550 7:21866883-21866905 CTGAAATCAGTACTGGAGACAGG + Intronic
1021909462 7:25369789-25369811 CTGGAATCAGAAGGGAAGAAGGG + Intergenic
1026536641 7:71243993-71244015 TTGGATTGAGAACTGGGGAAAGG + Intronic
1028260558 7:88658994-88659016 CTGGAGGCAGAAGTGGTGGAAGG + Intergenic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1031117241 7:117681728-117681750 CTGAGGTCAGAACTTCAGAAAGG + Intronic
1033420181 7:141198669-141198691 GTGGAGACAGATCTGGAGATGGG - Intronic
1033889027 7:145985468-145985490 ATGGGGTGAGAACTGGAGATGGG + Intergenic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1035747268 8:1971331-1971353 CTGGCGTCAGCACTGGAACAGGG + Intergenic
1036543425 8:9741901-9741923 TTGGAGTTAGAAAAGGAGAAGGG - Intronic
1037998247 8:23368816-23368838 CGGGGGTGAGAACTGGAGACTGG + Intronic
1041390178 8:57340978-57341000 ATGCAGTCAGACGTGGAGAATGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1043188817 8:77190661-77190683 CAGAAGTAAGAAATGGAGAAAGG + Intergenic
1044476162 8:92628836-92628858 CTGAAGTCACAAGAGGAGAAAGG - Intergenic
1044714082 8:95084841-95084863 CTTGAGAAAGAACTGGGGAATGG + Intronic
1045355659 8:101386711-101386733 CTAGAGTCAGAAAAGGAGAATGG + Intergenic
1045567856 8:103339672-103339694 TGGGAGTCAAATCTGGAGAAGGG - Intergenic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046711015 8:117511697-117511719 CTTGAGTCTGGACTTGAGAAAGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047223569 8:122938300-122938322 ATGGATTCATAACTGGACAAAGG - Intronic
1047850528 8:128852278-128852300 CTGGAGTTAGAAGTGTAAAATGG - Intergenic
1048045028 8:130765103-130765125 CTGGGGTGAGATTTGGAGAAAGG + Intergenic
1049408490 8:142462075-142462097 CTGGGGGCAGGACTGGAGGAGGG + Intronic
1049634756 8:143681638-143681660 CAGGAGGCAAAACTGGCGAAAGG + Intergenic
1050365474 9:4869686-4869708 CTGGAGCCAGCCCTGGAAAATGG - Intronic
1053306001 9:36985384-36985406 CTGAAAACAGAACTGGAAAAGGG + Intronic
1054938582 9:70715424-70715446 GTGGAATCAGAAGTGGAGAAAGG + Intronic
1054940273 9:70733417-70733439 GTGGAATCAGAAGTGGAGAAAGG + Intronic
1055552906 9:77447496-77447518 CTGGGCTCAGATCTGGATAAAGG - Intronic
1056068191 9:82958620-82958642 CTGGGCTCAGCATTGGAGAATGG - Intergenic
1056135671 9:83627538-83627560 CGGGACTCAGTACTGGAGATGGG - Intronic
1057016928 9:91660006-91660028 CTGGAGTCGGATCAGGAGTATGG - Intronic
1058187999 9:101877866-101877888 TTGGAGGCAACACTGGAGAATGG - Intergenic
1059697723 9:116744680-116744702 CTGGAGTCAGCACAGGAGCATGG - Intronic
1060098643 9:120817187-120817209 GTGGAATCAGAAATGGAAAAAGG + Exonic
1060282585 9:122224347-122224369 CTGGAGTCAGGCCTAGAGCAGGG + Intronic
1060344932 9:122807787-122807809 CTGGAATCAGAACAGGGGAGGGG - Intronic
1060348676 9:122838572-122838594 CTGGAGTCAGAGCTGGCACAGGG + Intergenic
1060923751 9:127440974-127440996 CTGGAGCCAGCACTCGAGAGAGG + Intronic
1061681517 9:132244873-132244895 CTAGAGGCAGAACTTGAGACAGG + Intergenic
1062286879 9:135777302-135777324 CTGGAGTCAGGGCTGGAGTCAGG - Intronic
1203618258 Un_KI270749v1:89889-89911 CAGGAATCAGAAATGGAGAAAGG + Intergenic
1185645152 X:1610566-1610588 CTGGAGTCTTAGCTGGAGTAGGG - Intergenic
1186246782 X:7623266-7623288 ATGGAAACAGAACTGTAGAAAGG - Intergenic
1192210587 X:69125377-69125399 CTGGCCCCAGACCTGGAGAAAGG - Intergenic
1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG + Exonic
1193062240 X:77219582-77219604 ATGGAGTCAGAAATGGAGAATGG + Intergenic
1194968497 X:100317108-100317130 CTAGAGTCAGAAGTGAAGATGGG - Intronic
1196690982 X:118557926-118557948 CTGGAATCAGAATAGGATAATGG - Intronic
1196797808 X:119516142-119516164 ATGGAAGCAGGACTGGAGAAAGG + Intergenic
1197765153 X:130055412-130055434 CAAGAGTAAGAACAGGAGAAGGG + Intronic
1199577021 X:149322179-149322201 CTGGTGGCACAACTGCAGAAAGG - Intergenic
1201065895 Y:10093297-10093319 CTGGAGGAAGAACTGGAGCGTGG - Intergenic