ID: 955612671

View in Genome Browser
Species Human (GRCh38)
Location 3:60774547-60774569
Sequence CACCTTGACCTCCCAAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2701
Summary {0: 2, 1: 6, 2: 212, 3: 779, 4: 1702}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955612666_955612671 16 Left 955612666 3:60774508-60774530 CCAGGCTGGTCTCGAACTCCTGA 0: 51840
1: 157012
2: 220107
3: 177064
4: 94849
Right 955612671 3:60774547-60774569 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
955612665_955612671 25 Left 955612665 3:60774499-60774521 CCATGTTGACCAGGCTGGTCTCG 0: 2038
1: 54917
2: 176853
3: 217441
4: 133606
Right 955612671 3:60774547-60774569 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
955612668_955612671 -7 Left 955612668 3:60774531-60774553 CCTCAAGTGATCTGCCCACCTTG 0: 1992
1: 9581
2: 28209
3: 55752
4: 84397
Right 955612671 3:60774547-60774569 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702
955612667_955612671 -2 Left 955612667 3:60774526-60774548 CCTGACCTCAAGTGATCTGCCCA 0: 4862
1: 21986
2: 51846
3: 93563
4: 122168
Right 955612671 3:60774547-60774569 CACCTTGACCTCCCAAAGAGTGG 0: 2
1: 6
2: 212
3: 779
4: 1702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955612671 Original CRISPR CACCTTGACCTCCCAAAGAG TGG Intronic
Too many off-targets to display for this crispr