ID: 955614082

View in Genome Browser
Species Human (GRCh38)
Location 3:60787322-60787344
Sequence TTGAGCAGTGCTCAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955614082_955614089 25 Left 955614082 3:60787322-60787344 CCATCCTTCTGAGCACTGCTCAA 0: 1
1: 0
2: 1
3: 29
4: 299
Right 955614089 3:60787370-60787392 CTGGACCCCTCATCCTGGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 243
955614082_955614086 20 Left 955614082 3:60787322-60787344 CCATCCTTCTGAGCACTGCTCAA 0: 1
1: 0
2: 1
3: 29
4: 299
Right 955614086 3:60787365-60787387 CTCTCCTGGACCCCTCATCCTGG 0: 1
1: 0
2: 3
3: 23
4: 261
955614082_955614084 6 Left 955614082 3:60787322-60787344 CCATCCTTCTGAGCACTGCTCAA 0: 1
1: 0
2: 1
3: 29
4: 299
Right 955614084 3:60787351-60787373 CATCCTCAGAGAAGCTCTCCTGG 0: 1
1: 1
2: 6
3: 46
4: 319
955614082_955614087 21 Left 955614082 3:60787322-60787344 CCATCCTTCTGAGCACTGCTCAA 0: 1
1: 0
2: 1
3: 29
4: 299
Right 955614087 3:60787366-60787388 TCTCCTGGACCCCTCATCCTGGG 0: 1
1: 1
2: 1
3: 16
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955614082 Original CRISPR TTGAGCAGTGCTCAGAAGGA TGG (reversed) Intronic
900476251 1:2877744-2877766 GTGAACAGAGCTCAGGAGGATGG + Intergenic
900814667 1:4834406-4834428 CTGAACAGCCCTCAGAAGGAAGG + Intergenic
901069993 1:6512293-6512315 TTGAACAGTGCTGAGCAGGAAGG - Intronic
901283324 1:8056813-8056835 TTGAGCAGAGATCTGAATGAGGG + Intergenic
901324229 1:8357424-8357446 TAGAGCAGGGCCCAGAGGGAGGG - Intronic
902623505 1:17663944-17663966 TTGAGAACTGCTGAGATGGAAGG - Intronic
902766008 1:18615779-18615801 GTCAGCAGTGTTCTGAAGGAGGG + Intergenic
904538080 1:31214616-31214638 GTGCTCAGTGCTCTGAAGGAAGG + Intronic
904594071 1:31632106-31632128 CTGAACAGGGCTCAGAAAGATGG - Intronic
904753610 1:32755752-32755774 TTGAGGATTTCTCAGAAGGTAGG + Intronic
905764176 1:40586423-40586445 TTGAGCAGTTGTCAGGAGCAGGG + Intergenic
906709656 1:47919802-47919824 ATGTCAAGTGCTCAGAAGGAGGG + Intronic
907788884 1:57641831-57641853 TTGAGCACTTCTTGGAAGGAAGG - Intronic
910241110 1:85087092-85087114 TTGAGCAGAGATCTGAATGAAGG - Intronic
911140968 1:94502162-94502184 TTTAGCTGTGCTCAGAAGAGCGG - Intronic
912545682 1:110449507-110449529 TTGAGCACTGTTAAAAAGGAAGG - Intergenic
912624546 1:111196502-111196524 TTGTGCAGTGCTCCTAGGGATGG - Intronic
912728353 1:112078974-112078996 TTGAGCAGAGAACTGAAGGAAGG + Intergenic
913066230 1:115258052-115258074 TTGAGCAGAACTCAGCAGGATGG - Intergenic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
915687205 1:157645506-157645528 TTGTGCAGTGCAGAGCAGGAAGG + Intergenic
916520637 1:165560820-165560842 ACCAGCAGTGCTGAGAAGGAGGG + Intronic
918034647 1:180855898-180855920 GAGAGCAGTGCACAGGAGGAAGG - Intronic
920791448 1:209096815-209096837 CTGAGCAGTACTCAGATGGACGG - Intergenic
922271793 1:224042241-224042263 TTGAGCAGGGCCTGGAAGGATGG - Intergenic
922588462 1:226753796-226753818 CTGAGCAGAGATCTGAAGGATGG + Intergenic
922887195 1:229029185-229029207 TGGAGCTCAGCTCAGAAGGAAGG + Intergenic
923031449 1:230252158-230252180 TAGAGCAGTGCTAAGGAGAAAGG - Intronic
923273049 1:232374528-232374550 ATGGGCAGTGCTCATCAGGAAGG - Intergenic
923610669 1:235490032-235490054 CTGAGCAGGCCACAGAAGGAAGG - Intronic
924553472 1:245099270-245099292 TTGAGCAGTTCTCTCAAGGGGGG + Intronic
924594334 1:245432030-245432052 TTGAGCAAAGATCTGAAGGAAGG - Intronic
924944485 1:248837476-248837498 CTGAGCAGAGCTCAGAAGAGTGG + Intergenic
1063064842 10:2597777-2597799 TTGAGCTGGGCTTTGAAGGATGG - Intergenic
1063585823 10:7351381-7351403 TAGAGCAGTGCTAAGAATGAAGG - Intronic
1063929112 10:11011374-11011396 TTGAGCTGGGCCCTGAAGGATGG + Intronic
1065761116 10:28984180-28984202 TTGGGCTGGGCTCAGAAGGATGG + Intergenic
1065846925 10:29752338-29752360 TTGAGATGAGCTTAGAAGGACGG + Intergenic
1068683409 10:59844029-59844051 TTGGGCAGAGATCTGAAGGAAGG - Intronic
1069324192 10:67210890-67210912 TTTTGCAGTGCTCACAAGTATGG + Intronic
1070035639 10:72720548-72720570 TTGAGCTGTGCCTTGAAGGATGG - Intronic
1070307620 10:75248965-75248987 TGGGGCGGTGCTCAGAAGGGAGG - Intergenic
1070399270 10:76038869-76038891 TTGGCCAGGGCTCAGCAGGATGG + Intronic
1070745215 10:78929651-78929673 TTGTGCAGAGCTCAAAAGGATGG + Intergenic
1070771332 10:79084160-79084182 TTGAGCTGGGCTCTTAAGGATGG - Intronic
1071091196 10:81920438-81920460 GTGATCAATGCTTAGAAGGAAGG - Intronic
1071779939 10:88833120-88833142 TGAGGCAGTGCTGAGAAGGAAGG + Intronic
1072104299 10:92259270-92259292 TTGAGCAGGGCTCTAAAGAAAGG - Intronic
1072285094 10:93906472-93906494 TTGAGCAGAGCTCAGGAGGTAGG - Intronic
1075083135 10:119397095-119397117 AGGAGAAGTGCCCAGAAGGAAGG + Intronic
1077234328 11:1472615-1472637 TGGGGCAGTGCTGAAAAGGATGG + Intronic
1077815014 11:5678512-5678534 TTGGGGAGTTCTCACAAGGAGGG + Intronic
1078540133 11:12206610-12206632 CTGAGCAGTGCTGAGTATGATGG - Intronic
1079052016 11:17169347-17169369 TAGAGCTGTGCTGAAAAGGAAGG + Exonic
1081378238 11:42385486-42385508 TTTGAGAGTGCTCAGAAGGAAGG + Intergenic
1082163228 11:48907478-48907500 TGGAACAATGCTCAGAATGAAGG + Intergenic
1082169581 11:48987158-48987180 TGGAACAATGCTCAGAATGAAGG - Intergenic
1082234630 11:49808911-49808933 TGGAACAATGCTCAGAATGAAGG + Intergenic
1082238172 11:49845252-49845274 TGGAACAATGCTCAGAATGAAGG - Intergenic
1082608333 11:55269616-55269638 TGGAACAATGCTCAGAATGAAGG + Intronic
1082611466 11:55303763-55303785 TTGAACAATGCTCAGAATGAAGG - Intergenic
1082658451 11:55879927-55879949 TGGAACAATGCTCAGAATGAAGG + Intergenic
1083409773 11:62484070-62484092 TAGAGCAGTGTTCAAAAGAAGGG + Intronic
1083751549 11:64763671-64763693 TTGAGGAGCCCTCAGAAGCAAGG - Intergenic
1084403650 11:68959071-68959093 TTGAGCAGTGACCTGAAGAAAGG + Intergenic
1086043973 11:82510993-82511015 TGGGGCACAGCTCAGAAGGACGG + Intergenic
1086696252 11:89849483-89849505 TGGAACAATGCTCAGAATGAAGG + Intergenic
1086702275 11:89912906-89912928 TGGAACAATGCTCAGAATGAAGG - Intronic
1086703892 11:89931544-89931566 TGGAACAATGCTCAGAATGAAGG + Intergenic
1086709904 11:89995006-89995028 TGGAACAATGCTCAGAATGAAGG - Intergenic
1087703171 11:101460259-101460281 TTTTGGTGTGCTCAGAAGGAGGG - Intronic
1090396786 11:126424421-126424443 TTGATCAGAGCTTCGAAGGAAGG + Exonic
1090672475 11:128958450-128958472 TTGAGCAGTGCTTGGAAAGTAGG - Intergenic
1090954726 11:131504060-131504082 ATGAGCAGTCCTCAGAAGTGTGG - Intronic
1091182405 11:133618739-133618761 CTGAGCAGGCCTCAGAATGATGG - Intergenic
1091327416 11:134701515-134701537 TTGATCAGTGCTCTGAAGGCTGG - Intergenic
1092727863 12:11501715-11501737 TTGGGGGGTGCTCAGAAGAAAGG - Intergenic
1092837081 12:12500737-12500759 TTGAGCAGTTCACAGAAAGCTGG - Intronic
1093984847 12:25519208-25519230 TTTAGCAGTGCTTAGGTGGAGGG - Intronic
1096070679 12:48773913-48773935 TCGAGCAGTGCTCAGGCGGTGGG - Intronic
1096579088 12:52572975-52572997 TCCAGCAGTGTTCAGAGGGAAGG - Intronic
1097307442 12:58085172-58085194 TTGAACAGAGCACAGAGGGAGGG - Intergenic
1097540264 12:60934236-60934258 TTGAGCATTTCTTATAAGGATGG + Intergenic
1099135384 12:78891727-78891749 TTGAACTGTGCTCAGGAGGAAGG + Intronic
1099260982 12:80382486-80382508 CTGAGCAGTGATCAGAGGAAGGG - Intergenic
1100921075 12:99487450-99487472 TTGAGCATTGCTTAAAATGAAGG + Intronic
1101334436 12:103783950-103783972 TAGAGCAGTGCTCTGAAGCATGG + Intronic
1101709246 12:107249457-107249479 TTGAGCAGTGGCCTGAGGGAAGG - Intergenic
1102789590 12:115633696-115633718 TTGAACAGTGCTTAGAAACAGGG - Intergenic
1102956888 12:117064766-117064788 TTGAGCAGAGACCTGAAGGAGGG + Intronic
1103181039 12:118911843-118911865 TTGAGCAGAGCTCATTAGAATGG + Intergenic
1104143484 12:126010157-126010179 TTGGGCTGTGCTCAGAAGAAGGG - Intergenic
1104550017 12:129748082-129748104 ATGAGCATTGCTCAGATGCATGG + Intronic
1106024388 13:25943019-25943041 TTGGGCATTGCACAGAAGGGAGG + Intronic
1106481129 13:30137642-30137664 TAGAGAAGTGCTGAGATGGAGGG + Intergenic
1106816105 13:33408901-33408923 TTGAGCAGAGATGTGAAGGAAGG - Intergenic
1107035161 13:35894534-35894556 TTGAGCAGTGCCTAGAGGCAGGG + Intronic
1108437736 13:50417165-50417187 TTGAGCAGGGCTGAGCAGGCAGG - Intronic
1109368882 13:61395795-61395817 TTTAGCAGTGCAGATAAGGAAGG + Intergenic
1109516261 13:63446326-63446348 TAGAGCTGTGCCCAGAAGGGAGG + Intergenic
1112382806 13:98908958-98908980 TTGAGCACTTCTCAGAGTGATGG + Intronic
1112482732 13:99792167-99792189 TTGAGCAGTTCTCGGAAGAAAGG + Intronic
1113125611 13:106975558-106975580 TTGAGCAGTGCTCTGTAGCATGG - Intergenic
1115052835 14:29085511-29085533 TTCTGCAGTGCTCTGAAGTAAGG + Intergenic
1115313303 14:32001713-32001735 TTGAGGGGTGGTCAGAGGGAGGG - Intergenic
1115806157 14:37054344-37054366 TTGGGCAGGGCTCAGCTGGATGG - Intronic
1116758453 14:48979129-48979151 TTGAGCAGCAATCTGAAGGAGGG - Intergenic
1117708273 14:58496479-58496501 TTGGGCAGTGTTTAGAATGATGG - Intronic
1117964912 14:61197115-61197137 TTAAGCTGAGCTCTGAAGGATGG - Intronic
1119224231 14:72932401-72932423 AGGAGCAGTTCCCAGAAGGAAGG + Intronic
1119258866 14:73224842-73224864 TTGAGCAGGGTTGAGAAGCAAGG + Intergenic
1121562982 14:94887924-94887946 TTGAGCCGGGCTGAGAAGGGTGG - Intergenic
1122549918 14:102544331-102544353 TTGAGCAGAGCCCTAAAGGATGG - Intergenic
1122964852 14:105118190-105118212 TTGGGCTGGGCTCAGCAGGATGG - Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1127516798 15:59702640-59702662 TAGATCATTACTCAGAAGGAAGG + Intergenic
1127623469 15:60757219-60757241 ATCAACAGTGCTGAGAAGGACGG - Intronic
1128111807 15:65081184-65081206 TTCAGCACTGGTCAGGAGGAAGG - Intergenic
1128744406 15:70103427-70103449 TTGAGCTCAGCTCAAAAGGATGG + Intergenic
1132141110 15:99396709-99396731 TTGAGGAGCGCTCACTAGGATGG - Intergenic
1133622431 16:7539278-7539300 TTAAGCTGTGTTCTGAAGGATGG + Intronic
1134273901 16:12758774-12758796 TGGAGCAGTGTTCAGGAAGAAGG + Intronic
1134514330 16:14874456-14874478 TTGAGCAAAGGTCTGAAGGAAGG - Intronic
1134702005 16:16273104-16273126 TTGAGCAAAGGTCTGAAGGAAGG - Intronic
1134969826 16:18521546-18521568 TTGAGCAAAGGTCTGAAGGAAGG + Intronic
1137315594 16:47317846-47317868 TGGAGCAGTGTTCAAAAGGAAGG - Intronic
1138016053 16:53429739-53429761 TTGGGCAGGGCTCAGTGGGAAGG + Intergenic
1138231085 16:55336793-55336815 TTGGGTAGGGCTCAGTAGGAGGG + Intergenic
1138269455 16:55684776-55684798 AAGAGCAGTTCTCAGCAGGAGGG - Intronic
1138351063 16:56346531-56346553 TCTATCAGTGCTCAGAGGGAAGG - Exonic
1138391845 16:56675989-56676011 TTGAGCTGTGCGCAGCAGGCGGG - Intronic
1138442398 16:57042853-57042875 TTGTGCAATGCTGGGAAGGAAGG + Intronic
1139685052 16:68596966-68596988 CTTAGCAGTGCTGGGAAGGAAGG - Intergenic
1139806513 16:69569047-69569069 TTGAGCTATGCTTAGAAGAAAGG + Intronic
1143993803 17:10989550-10989572 CTCAGCTGTGCTAAGAAGGATGG - Intergenic
1144300101 17:13915442-13915464 GTGAGCAGATCTCAGAAAGAGGG - Intergenic
1144626057 17:16845012-16845034 TGGAGCAGGGGTCAGCAGGAAGG - Intergenic
1144880376 17:18427708-18427730 TGGAGCAGGGGTCAGCAGGAAGG + Intergenic
1145151859 17:20516679-20516701 TGGAGCAGGGGTCAGCAGGAAGG - Intergenic
1145718651 17:27047925-27047947 ATGAGGAGTCCTCAGCAGGATGG - Intergenic
1146163227 17:30570950-30570972 TGGAGCAGGGGTCAGCAGGAGGG - Intergenic
1146271969 17:31490462-31490484 GTGAGCAGTTCCCAGAAGGCAGG + Intronic
1146521044 17:33525809-33525831 TTGAGCTGGGCTCCAAAGGATGG - Intronic
1146697093 17:34917721-34917743 TTGAGAAAGTCTCAGAAGGAAGG + Intergenic
1147220461 17:38925799-38925821 TGGAGAACAGCTCAGAAGGAAGG + Intergenic
1147933829 17:43999869-43999891 TGGAGCAATGCTCAGGAGGAAGG + Intronic
1148486325 17:47993313-47993335 TTCAGCAGTGATCAGATGTAGGG - Intergenic
1148678013 17:49456247-49456269 TTGAGCAGAGCTTTGCAGGAAGG + Intronic
1149600783 17:57891769-57891791 TTGAGTAGGGACCAGAAGGAAGG - Intronic
1149798524 17:59544262-59544284 TTAAGCAGAGATCAGAATGAGGG + Intergenic
1150016410 17:61561820-61561842 TTTAGCATTACTCAGATGGATGG - Intergenic
1150305987 17:64085716-64085738 TACAGCTGTGCTCAGAAGGCTGG - Intronic
1151153571 17:72108675-72108697 TTCAGCAGTTCTCAGCAGGCAGG + Intergenic
1151959756 17:77399448-77399470 TTGGACAGTGCTCAGGAGGCAGG + Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152351703 17:79787182-79787204 TAGCACAGTGCTCAGCAGGAAGG - Exonic
1152607927 17:81302420-81302442 GTAAGCAGTGCTCAGGAGGGGGG - Intergenic
1153315037 18:3712949-3712971 TTCAGATGTGTTCAGAAGGATGG + Intronic
1154016257 18:10620552-10620574 TTGTGCAGTGGTCAGAGGCAGGG - Intergenic
1154189258 18:12215098-12215120 TTGTGCAGTGGTCAGAGGCAGGG + Intergenic
1154411912 18:14146200-14146222 TTGAGCAGCTCTCTGAAGCATGG + Intergenic
1154470500 18:14695459-14695481 ATGAGGAGTCCTCAGCAGGATGG + Intergenic
1156875759 18:42008998-42009020 TTGAGCAGCACTCCGAATGAAGG + Intronic
1157111437 18:44824230-44824252 TTGAGATGAGCTCTGAAGGATGG - Intronic
1157819680 18:50757069-50757091 CTCAGAAGTGCCCAGAAGGATGG + Intergenic
1158474742 18:57770040-57770062 TTCAGCAGTTCTCAGCATGAGGG - Intronic
1159257025 18:65960271-65960293 TTGAGCATTCATCAGAATGATGG - Intergenic
1162400647 19:10444574-10444596 TTGAGCAGAGGCCTGAAGGAGGG + Intronic
1163807755 19:19410277-19410299 ATGAGCAGTACTCTAAAGGAGGG + Intronic
1165900387 19:39166924-39166946 CTGTGCAGTGCCCAGAGGGAAGG + Intronic
1167109248 19:47449254-47449276 TTGAGCAGAGACCTGAAGGAGGG + Intronic
1167151346 19:47712058-47712080 TTGAGCAGGGACCTGAAGGAGGG + Intergenic
925124823 2:1446368-1446390 TTGACCAGTGCTCAGCAGAGAGG - Intronic
925264856 2:2559917-2559939 TGCAGCAGTGCTCAGTTGGAGGG - Intergenic
925914849 2:8597646-8597668 TTGGCCAGTGCACAGCAGGATGG + Intergenic
927057454 2:19379190-19379212 CTGAGCAGAGCTCAGGAGCAGGG + Intergenic
930099927 2:47595624-47595646 TTGGGGAGTGCTCTGTAGGATGG - Intergenic
934102804 2:88668899-88668921 TTGAGCTGAGCCCTGAAGGAAGG - Intergenic
934716563 2:96548085-96548107 CTGTGCAGACCTCAGAAGGAAGG - Intronic
937217611 2:120322621-120322643 ATGAGAAGTGCTCAGGTGGAGGG - Intergenic
938642668 2:133297693-133297715 TTGAGGACTGATCAGAAGCATGG - Intronic
939889977 2:147724817-147724839 TTGAGCAGTTCTTATAAGGCTGG - Intergenic
941475817 2:165951008-165951030 GGGAGCAGTGATCACAAGGAGGG - Intronic
941546845 2:166861520-166861542 TTGGGGAATGCTAAGAAGGAGGG + Intergenic
941856333 2:170234782-170234804 TTGAACAGGGCTTAGAAGAAAGG - Intronic
941994182 2:171585980-171586002 TAGAGCAGAGAACAGAAGGAGGG - Intergenic
942299275 2:174546766-174546788 TGGAGGAGAGCTCAGAAGGGAGG + Intergenic
943981535 2:194558716-194558738 TAGTGCAGTATTCAGAAGGAAGG + Intergenic
944706973 2:202299867-202299889 TTGAGCAGTGTTCTGAAAGTTGG + Intronic
946059692 2:216931283-216931305 TTGAGTAGGGCTCAGCTGGATGG + Intergenic
947793854 2:232882365-232882387 TTGAGCGGTGCTCAGGATGGTGG - Intronic
948768785 2:240236773-240236795 TTGAGCTCTGCTCAGCAGGCAGG - Intergenic
1169758119 20:9064902-9064924 TTGAGTAGTGCTAAGAACCATGG - Intergenic
1170446337 20:16431751-16431773 TTGAGCAGAGACCTGAAGGAAGG - Intronic
1170799407 20:19578638-19578660 TTGAGAAGTGCTCCTCAGGATGG - Intronic
1171360398 20:24582858-24582880 TTGACCTGTGCCCAGCAGGAGGG + Intronic
1172211016 20:33198609-33198631 TTGAGCAGAGACCTGAAGGAAGG - Intergenic
1172460755 20:35116573-35116595 TTGAGCAGAGACCTGAAGGAAGG - Intronic
1173691348 20:44963552-44963574 TTGAGCATGGCTCAGCAGGAAGG - Intergenic
1173822493 20:46028652-46028674 TTGAGCAGTGGTATGAAAGAGGG + Intronic
1174177015 20:48651607-48651629 CTGAGCAGAGATCAGAGGGAGGG + Intronic
1175089421 20:56489609-56489631 TGGGGAAGTGCTCAGAAGAATGG - Intronic
1176803984 21:13462408-13462430 ATGAGGAGTCCTCAGCAGGATGG - Intergenic
1179075044 21:38113123-38113145 TTAACCAGTTCTCAGAACGATGG - Intronic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1179842584 21:44087045-44087067 TTGAGGGGCGCTCAGCAGGATGG - Intronic
1180642597 22:17311125-17311147 TTGAGCTGGGATTAGAAGGAGGG + Intergenic
1181726254 22:24813072-24813094 TTGAGCAGAGACCTGAAGGAAGG + Intronic
1181954596 22:26579298-26579320 TCCAGCAGTGCTCAGAGGAAGGG + Intronic
1182748943 22:32626576-32626598 TTGGGCAGAGCTGAGAAAGATGG + Intronic
1183466318 22:37982141-37982163 TTGAGGAGTGGTCAGGAGGTTGG - Intronic
1184429367 22:44432275-44432297 TTGAGTCGTGCTCTGAAAGATGG - Intergenic
1185154154 22:49183277-49183299 TGGAGCAGTGCTGAGAAAAATGG - Intergenic
949517849 3:4823321-4823343 TTGAGCAGCATTAAGAAGGAAGG + Intronic
950987408 3:17389687-17389709 TTGAGCAGGGCTCAGTAGGATGG - Intronic
952851389 3:37732605-37732627 CAGAGCAGTGCTCAGACGGTAGG - Intronic
953187253 3:40649656-40649678 TTGAGCTGTGCTCAGACGAGTGG - Intergenic
954329454 3:49881780-49881802 TTGAGCTGTGCTCAAGAGGGAGG - Intergenic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
955863777 3:63360295-63360317 GTGAGCAGTGGTCAGAATCAGGG - Intronic
956111947 3:65878772-65878794 TTGAGCTGTGATCAGGAGCAGGG - Intronic
959864118 3:111246523-111246545 TAGAGCAGAGCTTAGAAGGATGG + Intronic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
962343861 3:134605865-134605887 TTAAGCAGTGCTCAGAGAGTGGG - Intronic
964559513 3:157978045-157978067 TTCAGAAGTGCTCATAAGCAAGG - Intergenic
965671482 3:171152430-171152452 TTGACCAGTCCTCAAAAGTAAGG + Intronic
966317983 3:178670208-178670230 TTGAGGATTGCTATGAAGGAGGG - Intronic
966505261 3:180693562-180693584 TTGTGCTGTGCTCACATGGATGG - Intronic
967459119 3:189724781-189724803 TGGAACAGTGCTCAGCACGAAGG - Intronic
969602808 4:8187045-8187067 TTGAGCAGGGCTTTGAAGGATGG - Intronic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
972452249 4:39213570-39213592 TGGAGCTGGGGTCAGAAGGAAGG + Intronic
973277337 4:48323812-48323834 TTGAATATTGCTTAGAAGGAAGG + Intergenic
973811158 4:54571549-54571571 TTGAGCAGTGCTCAGTAAAATGG - Intergenic
975169335 4:71215167-71215189 TTGAGGAGAGGACAGAAGGATGG - Intronic
975426744 4:74238254-74238276 TAGAGCAGTTCTGAGAAGGAAGG + Intronic
979559276 4:122083834-122083856 TTGAACACTGCTAAGAGGGAGGG + Intergenic
981223362 4:142262846-142262868 ATCAGCAGTGCTCAGAGGAAAGG - Intronic
983216849 4:165010092-165010114 TTGAGCAGAGCACAAAAAGAAGG + Intergenic
984380265 4:178984081-178984103 TTCAGCTGTGCTCAGGAGGCAGG + Intergenic
985188786 4:187348332-187348354 TTGTCCAGTGCTCAACAGGAGGG - Intergenic
986076847 5:4346797-4346819 TTAAGCAGAGCTCCCAAGGAGGG + Intergenic
989761830 5:45024596-45024618 TTGAGCTGAACTCTGAAGGATGG + Intergenic
990258703 5:53998430-53998452 TTGAGCGGAGCTAAGAAGGAAGG - Intronic
990531796 5:56681691-56681713 TCAAGCAGTGCTGGGAAGGATGG - Intergenic
991028190 5:62052874-62052896 CTGAACAGGTCTCAGAAGGAAGG - Intergenic
993004477 5:82415744-82415766 GTGACCTGTCCTCAGAAGGAGGG - Intergenic
994715293 5:103314607-103314629 ATGATAAGTGCTAAGAAGGAAGG + Intergenic
994761111 5:103855558-103855580 TTTAGCAGTGCTCAGCAGCCTGG - Intergenic
995119651 5:108522190-108522212 TTGAGCAGTCCAGAGAAGTAGGG - Intergenic
995709292 5:115018459-115018481 TTGACCAGTGCTGAGTGGGAAGG - Intergenic
996395024 5:123004943-123004965 TTGAGAGGTGATGAGAAGGAAGG - Intronic
996871397 5:128197445-128197467 CTGAGCAGTGAGCAGAAGGGAGG - Intergenic
997472121 5:134122905-134122927 TAGAGGAGTGGTCAGAGGGAAGG + Intronic
998128221 5:139638142-139638164 TTGCGAAGTGCTCAGAAAGACGG - Intergenic
999206881 5:149855172-149855194 GTGAAAAGTGCTCTGAAGGAGGG - Intergenic
1000764801 5:165273838-165273860 TTGGGCAGGGCTCAGTGGGATGG + Intergenic
1001543676 5:172556966-172556988 TTGAGCAGAGCCCTGAATGAAGG + Intergenic
1001566916 5:172705685-172705707 TTCAGCACTGCTCATGAGGAGGG - Intergenic
1001588291 5:172848331-172848353 GTGATGAGTGCTGAGAAGGAAGG + Intronic
1002846594 6:951267-951289 TTCAGCAGAGCTCAGAGGCAGGG - Intergenic
1002869342 6:1152001-1152023 GTGAGCAGTGCTCAGAGAGGAGG + Intergenic
1003584712 6:7376838-7376860 TTGAGCTGAGCTCTAAAGGATGG - Intronic
1003754496 6:9101311-9101333 TTGAGCAGTATTTAGAAGGGAGG - Intergenic
1004514158 6:16307745-16307767 TTTAGTTGTCCTCAGAAGGAGGG - Intronic
1008189701 6:48439464-48439486 TTGAGGACTGTTGAGAAGGATGG + Intergenic
1008434378 6:51457722-51457744 CTCAGCAGTACTCAGAAGGAAGG + Intergenic
1008989749 6:57588537-57588559 TTGCCCAGTGCTCAAGAGGAGGG - Intronic
1009178333 6:60487081-60487103 TTGCCCAGTGCTCAAGAGGAGGG - Intergenic
1012325933 6:97917511-97917533 TGGAGCAGTGCACAGCAGCAAGG + Intergenic
1015693657 6:135955962-135955984 TGCAGCACAGCTCAGAAGGAGGG + Intronic
1016144469 6:140651070-140651092 TTGAGTTGTCCTCAGTAGGAGGG - Intergenic
1016884314 6:148944965-148944987 TAGAGCAATGCTCAGAAAGATGG - Intronic
1019933723 7:4240799-4240821 TTGAGCTGTGATCTGCAGGAAGG + Intronic
1020664934 7:11028768-11028790 GTGACCTGTGCTCAAAAGGAAGG + Exonic
1021927844 7:25550492-25550514 CTGAGCAGTGTTCTGATGGATGG - Intergenic
1031991547 7:128202209-128202231 TTGAGCTGAGCTGGGAAGGATGG - Intergenic
1032398484 7:131607686-131607708 TTGACATGAGCTCAGAAGGACGG - Intergenic
1032553269 7:132805507-132805529 TTGGGTAGTGCTAAGAAGGGAGG + Intronic
1032653469 7:133903541-133903563 TTGAGCAGTGAAAAGATGGATGG + Intronic
1033156947 7:138965172-138965194 TTGAGCAGAGACCGGAAGGAAGG + Intronic
1033655401 7:143370283-143370305 TTGAGGAGTGCAGAGAAGTAAGG - Intergenic
1034457456 7:151178771-151178793 ATGAGCACTGCTCAGATGCAGGG - Intronic
1035059665 7:156059639-156059661 CTGAGCAGGGCACTGAAGGATGG - Intergenic
1035146255 7:156820777-156820799 TTGAGTACAGCCCAGAAGGAGGG + Intronic
1039950174 8:42164864-42164886 TTGATAAGTGTTCAGAATGATGG + Intronic
1040537965 8:48326009-48326031 TTGAACAGTGCTTATATGGAGGG - Intergenic
1041483966 8:58353618-58353640 CTGAGCAGAGCTTTGAAGGAAGG + Intergenic
1042537307 8:69871464-69871486 ATGAGCTCTGCTCACAAGGATGG - Intergenic
1043573659 8:81632061-81632083 TTGCCCAATGCACAGAAGGAAGG + Intergenic
1044471606 8:92575623-92575645 TTGAGCTGTGTTCTGAAGGATGG - Intergenic
1047050646 8:121107973-121107995 TTGTACAGAGATCAGAAGGAAGG - Intergenic
1047163721 8:122412112-122412134 CTGAGCACTGCTTAGAATGAAGG + Intergenic
1047346988 8:124038233-124038255 TTGAGCAGAGCCCTAAAGGATGG - Intronic
1047956689 8:129981887-129981909 TTGAGGAGTGCTCTGAGAGAGGG - Intronic
1048588347 8:135797056-135797078 ATGAGGAGTGCTCAGAGGAAAGG - Intergenic
1048624161 8:136166577-136166599 TTTGGCAGTGATCAGAAGGGTGG - Intergenic
1049801864 8:144521601-144521623 TTGAGGTGTGCCCAGAAGCAAGG - Exonic
1051155823 9:14144772-14144794 TTAAGCTGGGCTCTGAAGGATGG + Intronic
1051281852 9:15449242-15449264 TTGAGCAATGTTCAGATGGTTGG - Intronic
1051447742 9:17158984-17159006 TAAAGCAGTGCTAAGATGGAAGG - Intronic
1051648863 9:19299937-19299959 TTGAGTTGAGCTCAGAAGAATGG - Intronic
1057988068 9:99737853-99737875 CTGAGCAGAGATCGGAAGGAGGG - Intergenic
1058527793 9:105877819-105877841 TTGAGCAGTATTCGAAAGGAAGG + Intergenic
1058934845 9:109760278-109760300 TTAGGCAGTGGTCAAAAGGAAGG + Intronic
1059792006 9:117650254-117650276 TTGAGCTGAGCTTTGAAGGATGG + Intergenic
1060552305 9:124491422-124491444 TTGAGGAGAGCTCGGAAGGGTGG - Intronic
1062406529 9:136399515-136399537 GTGAGCAATGATCAGCAGGAAGG + Intergenic
1186530121 X:10286887-10286909 TTGGGCAGGGCTCAGATGGATGG + Intergenic
1186887784 X:13931896-13931918 TTGAGGAGTGTTGAGAAGGGTGG - Intronic
1187411206 X:19051883-19051905 TTGGGCAGAGCTCAGCAGGAGGG - Intronic
1187759110 X:22560105-22560127 TTTAGAAGGGCTCAGAAGTAGGG + Intergenic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189622136 X:42853131-42853153 TCAAGCAGAGCTCAGAAGGTGGG - Intergenic
1192292556 X:69813162-69813184 TGGAGCAGTGCTCATGAGAAAGG - Intronic
1192590083 X:72352262-72352284 TTGAGCTGTGCCTGGAAGGATGG - Intronic
1195613833 X:106897162-106897184 TTGAGCTGGGCTTTGAAGGATGG - Intronic
1196604121 X:117636262-117636284 TTGGGCTGTGCTTTGAAGGAAGG - Intergenic
1198479828 X:137031177-137031199 TGGAGGAGTGCTCTGCAGGATGG + Exonic
1199012531 X:142774738-142774760 TCAAGCAGTGCACAGGAGGAAGG + Intergenic
1199595571 X:149503863-149503885 TTGCCTGGTGCTCAGAAGGAAGG - Intronic
1199598307 X:149525348-149525370 TTGCCTGGTGCTCAGAAGGAAGG + Intronic
1199605701 X:149577697-149577719 GTGAGCACTCCTCAGAACGACGG + Intergenic
1199633420 X:149791671-149791693 GTGAGCACTCCTCAGAACGACGG - Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic
1200244734 X:154516855-154516877 TTGAGCAGCTCTGAGGAGGAGGG - Intergenic
1200764422 Y:7068445-7068467 TGGAGCAGTGGTCAGTGGGACGG - Intronic
1201384922 Y:13429659-13429681 TGGAGCAGTAATCAGAATGAGGG - Intronic
1201927125 Y:19299418-19299440 TTGAGCTCAGCTCAGAAGTATGG - Intergenic