ID: 955618633

View in Genome Browser
Species Human (GRCh38)
Location 3:60836759-60836781
Sequence CAAAGCAATCACTTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955618628_955618633 8 Left 955618628 3:60836728-60836750 CCAGTAAAGGGGAAATGGTCAGA 0: 1
1: 0
2: 0
3: 20
4: 154
Right 955618633 3:60836759-60836781 CAAAGCAATCACTTTGATTTTGG 0: 1
1: 0
2: 0
3: 32
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955618633 Original CRISPR CAAAGCAATCACTTTGATTT TGG Intronic
905144141 1:35873717-35873739 CAAAAACATCACTTTGATCTAGG - Intronic
906669543 1:47644606-47644628 CAAAACTATCACTTTGATACTGG + Intergenic
907160796 1:52367287-52367309 TAAAGTAACCACTTCGATTTTGG + Intergenic
910549559 1:88460533-88460555 CAAAACAATCCCGTTTATTTAGG + Intergenic
911266863 1:95753504-95753526 CGCAGCAACCACTCTGATTTCGG + Intergenic
911551595 1:99288255-99288277 CAAAGACATGACTTTGATTTAGG - Intronic
911946515 1:104116037-104116059 CAAATCAATCACTTTGGTGGTGG + Intergenic
912339631 1:108899741-108899763 CAAATCAATCACTGTGTCTTCGG - Intronic
913656999 1:120970718-120970740 CACAGGAATCACTTGAATTTAGG - Intergenic
915713525 1:157923491-157923513 AGATGCAATCAGTTTGATTTAGG - Intergenic
915850735 1:159319480-159319502 CAAAGCATTAACTTTGGCTTAGG + Intergenic
918802383 1:188987575-188987597 CAAAGCAACCACTTGAATTTTGG + Intergenic
919128099 1:193421237-193421259 AACAACAACCACTTTGATTTTGG + Intergenic
919424963 1:197418651-197418673 CAAAAAGATCACTTTGGTTTTGG + Intronic
919645423 1:200089938-200089960 CAAATCAATGGCTTTGAGTTTGG - Intronic
921436116 1:215124687-215124709 CAAATCAGTCACTGGGATTTGGG + Exonic
924590043 1:245395119-245395141 AAAAGTAAGCAGTTTGATTTTGG + Intronic
1063259593 10:4371353-4371375 CAAAACAATTACCATGATTTGGG - Intergenic
1064909869 10:20388566-20388588 CAAAGAAATTAATTTCATTTGGG + Intergenic
1067170317 10:43900530-43900552 CAGAGCAAGCAATTTGACTTGGG + Intergenic
1067510923 10:46894426-46894448 CAAAGCCAACCCATTGATTTGGG + Intergenic
1067911381 10:50350331-50350353 CAAAGCATTCAGTTTGATAAGGG + Intronic
1068860538 10:61843414-61843436 CAATGAACTCACTTTAATTTAGG + Intergenic
1071443371 10:85724057-85724079 CATAGCAATCACTTTAATGTAGG + Intronic
1073752904 10:106550140-106550162 CAAAGCCTTCACTTTGGCTTTGG - Intergenic
1073903139 10:108245986-108246008 CAAAGGAATCACAATGATTCAGG - Intergenic
1074919370 10:117991917-117991939 ACAAACGATCACTTTGATTTGGG + Intergenic
1075872441 10:125780685-125780707 CAAGGAAATCAATTGGATTTAGG + Intergenic
1077773117 11:5242832-5242854 AAAAACACTCAGTTTGATTTTGG + Intergenic
1078811939 11:14776694-14776716 CAAAGCATTCACAATCATTTAGG - Intronic
1078880664 11:15445687-15445709 GAGAGCAAACACATTGATTTTGG - Intergenic
1078972830 11:16434474-16434496 CAAAGCAGTGACTTTGAGTCAGG - Intronic
1079286803 11:19141254-19141276 CAAAGATATCACTGTGATTAGGG + Intronic
1080883920 11:36348221-36348243 CCAAGCTATCACCTTGGTTTTGG - Intronic
1086259498 11:84922239-84922261 AAAGGCAATCACTTTCCTTTTGG + Intronic
1086289160 11:85286500-85286522 CAAAACTAGCACTCTGATTTTGG + Intronic
1086942736 11:92815246-92815268 CAAAGCCACCACTCTCATTTTGG - Intronic
1087657568 11:100943119-100943141 CAAAACAATCACATTGTATTAGG + Intronic
1088327991 11:108621343-108621365 CAATGAAATAAGTTTGATTTTGG + Intergenic
1088519601 11:110680873-110680895 CAAAGTAATGAGTTTCATTTTGG + Intronic
1089126766 11:116181650-116181672 CTAAGCCATCAGGTTGATTTGGG + Intergenic
1089924921 11:122247494-122247516 CAAAGCTATCTATCTGATTTTGG - Intergenic
1091985031 12:4903911-4903933 TAATTCAATCACTTTGATCTTGG - Intergenic
1093285634 12:17257446-17257468 CAACTCAACCAATTTGATTTGGG - Intergenic
1093551311 12:20415327-20415349 CAAAACAATTACCTTGTTTTGGG - Intronic
1094011510 12:25814977-25814999 TAAAGCAATGACTTGAATTTTGG + Intergenic
1095323120 12:40854023-40854045 AAAATCAATCATTTTGATCTAGG - Intronic
1095509164 12:42930417-42930439 CAGAGCAGTAACTTTGTTTTAGG - Intergenic
1095905251 12:47370546-47370568 GGAAGCAGTCACTTTGCTTTAGG - Intergenic
1096012922 12:48236995-48237017 TAAATCAATCACTATGATTCAGG + Intergenic
1098379820 12:69855342-69855364 CTGGGCAATGACTTTGATTTGGG + Exonic
1099885184 12:88520592-88520614 CAAAACAAGGAATTTGATTTTGG - Intronic
1100786530 12:98084547-98084569 CAGGTCAACCACTTTGATTTTGG - Intergenic
1102922498 12:116802667-116802689 CCCAGCCAACACTTTGATTTGGG + Intronic
1103188777 12:118982696-118982718 CAAAGCAATCAGATTCTTTTTGG - Intronic
1104136162 12:125940920-125940942 GAAAGAATTCACTTTTATTTGGG + Intergenic
1104505003 12:129323685-129323707 CCAACCAAGCACTTTGATTTAGG + Intronic
1106834469 13:33619000-33619022 TGAAGCAATCACTTTCTTTTAGG - Intergenic
1107669083 13:42724809-42724831 CAAAGCAATGTCTTTGATGCTGG + Intergenic
1107797325 13:44065866-44065888 CAAAAAAATCATTTTGCTTTTGG + Intergenic
1108920265 13:55664516-55664538 CAAAGTAACTGCTTTGATTTTGG - Intergenic
1109424946 13:62156128-62156150 CAAAGAAATCCCCTTGACTTAGG - Intergenic
1109441065 13:62375326-62375348 CAAAGTAAGCACTTGGATTAAGG - Intergenic
1111036482 13:82681479-82681501 CATAGAAATAACATTGATTTGGG - Intergenic
1111647931 13:91055527-91055549 CAAATCAAACACTTAGGTTTGGG + Intergenic
1111906698 13:94263610-94263632 CATAGCAGTCATTTTGACTTAGG + Intronic
1112734548 13:102401548-102401570 CAAAGAAACCACATTGATTTGGG + Exonic
1115138665 14:30142496-30142518 CAAACACATCACCTTGATTTTGG + Intronic
1115273281 14:31578114-31578136 CCAAGGAATCATTTTGACTTGGG + Intronic
1119601755 14:75981355-75981377 CAAGGCAAGGATTTTGATTTTGG - Intronic
1122320912 14:100855281-100855303 GAAAGCAAACCCTTTCATTTTGG + Intergenic
1122680790 14:103460792-103460814 CAAAGCTATGACTTTGTTTTGGG + Intronic
1126950070 15:53871084-53871106 CACAGCAATCAAATTTATTTGGG - Intergenic
1127782334 15:62328213-62328235 CAGAAGAATCACTTTGATCTGGG - Intergenic
1127795227 15:62432345-62432367 AGAAGCCAGCACTTTGATTTTGG - Intronic
1129142045 15:73608109-73608131 CAAAACAATGACTTTTATCTTGG + Intronic
1130704726 15:86222312-86222334 CAAAATAATGATTTTGATTTTGG - Intronic
1131410132 15:92200670-92200692 CAAAGGAATGACTTAAATTTGGG + Intergenic
1132306540 15:100819021-100819043 CACAGAAATCTCTTTGGTTTTGG + Intergenic
1133461232 16:5988356-5988378 TAAAGTAATCACTTTGAATTAGG - Intergenic
1133470198 16:6067771-6067793 TAAAGCAATCATTTTGCTCTAGG - Intronic
1133793029 16:9024037-9024059 CAAAGCAAAGATTTTAATTTAGG - Intergenic
1133994724 16:10739819-10739841 CAAGGCAATCAAGTTTATTTTGG - Intergenic
1134375928 16:13673173-13673195 CAAAGATAGCACTTTGATCTTGG + Intergenic
1135473495 16:22753065-22753087 AAATCCAACCACTTTGATTTGGG - Intergenic
1137390581 16:48078052-48078074 CAAAGAAATCACTTTTCTTTTGG - Intergenic
1139199025 16:64953844-64953866 CAAAGAAAACTCTTTGATATGGG + Intronic
1139314312 16:66055589-66055611 CCAGGAAATCACTCTGATTTTGG - Intergenic
1140381973 16:74497416-74497438 AAAAGCAAGCACTGTTATTTGGG - Intronic
1140573866 16:76140414-76140436 TAAAGCAATCACATTGACATGGG + Intergenic
1141305445 16:82858796-82858818 GAAGGCAATGATTTTGATTTTGG - Intronic
1141316501 16:82967483-82967505 CAGAGTAATCACTTAGCTTTAGG - Intronic
1143360875 17:6369794-6369816 CAATGAAATCAGTATGATTTTGG + Intergenic
1143703660 17:8681461-8681483 CAAAGCAAATATGTTGATTTTGG - Intergenic
1144251829 17:13424974-13424996 CAAGGCAGTCACTTTTTTTTTGG - Intergenic
1144435320 17:15234657-15234679 CATAGCATTGACTCTGATTTGGG + Intronic
1145287999 17:21520910-21520932 CAAAGCCATCACTGTGATTGCGG + Intergenic
1146201241 17:30860631-30860653 CAAAGCAATCTATTTCTTTTGGG - Intronic
1147172221 17:38628639-38628661 TAAACCAATCACTTTGCTTGAGG - Intergenic
1149714293 17:58772515-58772537 CAAAGTAGTCCCTTGGATTTTGG + Intronic
1151367410 17:73626443-73626465 CAAGTCCTTCACTTTGATTTTGG + Intronic
1156272149 18:35545492-35545514 CAAATCAATTTCCTTGATTTGGG - Intergenic
1156279235 18:35617722-35617744 CTAAGCAATCACTGTTAATTAGG - Intronic
1157527294 18:48393472-48393494 CATAGAATTCACTTTGTTTTAGG - Intronic
1158057140 18:53294712-53294734 CAAATCATCTACTTTGATTTGGG - Intronic
1159246183 18:65808190-65808212 CAAAGCAGAAACTTTTATTTAGG - Intronic
1159975464 18:74706272-74706294 CAAAGCTTTCACTTTTGTTTTGG + Intronic
1160130063 18:76217778-76217800 CATAGCACTCAGTTTGATTGCGG - Intergenic
1163072335 19:14854731-14854753 CAAAGCAATCTCTCTGCTCTGGG + Intergenic
1164279876 19:23759860-23759882 AAAAGCAGCCACTTTGATTGAGG + Intergenic
1165179801 19:33957785-33957807 GAAAGCAATCAAATTGACTTAGG + Intergenic
1166428500 19:42701125-42701147 CAAAAAAATAACTTTGTTTTAGG - Intronic
1166710292 19:44932598-44932620 CAAAAAAATCACTTGAATTTGGG - Intergenic
1168037680 19:53733072-53733094 CAAAGCAAGCACTTATGTTTAGG + Intergenic
926640468 2:15230346-15230368 CAAAGCCATAACTTTTATTTTGG - Intronic
926817064 2:16809021-16809043 CAAGGAAAGCACTTTGATTTAGG + Intergenic
927143004 2:20142397-20142419 CAAATCACACACTTTGTTTTGGG + Intergenic
927823471 2:26289781-26289803 CCAATCAATCACTGTGATCTTGG - Intronic
928290601 2:30034057-30034079 CAAAGAAATGACTTTGATATAGG - Intergenic
928891283 2:36205897-36205919 AAATCCAATCACTTTAATTTAGG + Intergenic
931027277 2:58125212-58125234 CTAAGAAATCACTGTGATTGTGG + Intronic
933537506 2:83594894-83594916 CAAAACAAACACTTTGACTGTGG - Intergenic
933615344 2:84477635-84477657 GAAAGAAATAACTTAGATTTAGG - Intergenic
934030495 2:88041396-88041418 AAAAGCAGTGAATTTGATTTTGG + Intronic
936745961 2:115576920-115576942 GAAAGCATTCACTATTATTTTGG + Intronic
939089895 2:137767892-137767914 CAAAGGAATCACTCTGATGTGGG - Intergenic
939127702 2:138197173-138197195 CAAATCATTTACTTTGATATAGG - Intergenic
939225768 2:139362272-139362294 CAAAACAAACACCTTAATTTGGG + Intergenic
939766908 2:146262136-146262158 TAAAGCAGTCACTTGGATTCTGG - Intergenic
940065437 2:149622551-149622573 CACACCAAACACTTTCATTTTGG - Intergenic
940621077 2:156114676-156114698 TAAATCAATCAGTCTGATTTTGG - Intergenic
940670712 2:156663972-156663994 CAAAGCTTTCACTTTCCTTTTGG + Intergenic
942151608 2:173081592-173081614 CAAAGAGATCTCTTTGCTTTGGG + Intronic
942291898 2:174481508-174481530 CAAAGTAATGACTTTGCATTGGG - Exonic
943171300 2:184404431-184404453 CACAGCAAACACTTTCTTTTAGG + Intergenic
943180299 2:184531301-184531323 CTCAGCAACCGCTTTGATTTCGG - Intergenic
943964734 2:194319258-194319280 AAAATCAACAACTTTGATTTTGG + Intergenic
944430937 2:199633044-199633066 TAAAGAAATAACTTTGGTTTGGG + Intergenic
944521293 2:200570706-200570728 CAGAGCTATCACTATTATTTGGG + Intronic
945600976 2:211864336-211864358 GAAAGCAGTCACTTTCATGTGGG - Intronic
945866928 2:215186612-215186634 CAAAACTATCATATTGATTTTGG - Intergenic
946303544 2:218841641-218841663 CAAAGCCTTCACTTTGGCTTTGG - Intergenic
946943698 2:224797397-224797419 CAAAGCTCTCACTGTTATTTTGG - Intronic
947003036 2:225479248-225479270 CAAATCCATCCCTTTGAATTTGG + Intronic
947541022 2:230978288-230978310 CAGAGCAAACACTCTGATTGTGG + Intergenic
949052998 2:241907472-241907494 CAAAGCAAACACTGAGGTTTAGG - Intergenic
1170118800 20:12890620-12890642 CAATGCAATCTCTTTGCATTTGG - Intergenic
1170419371 20:16177442-16177464 CTAAACAATCAGTTTGATCTTGG + Intergenic
1171952089 20:31429037-31429059 CACTGCCAACACTTTGATTTTGG - Intergenic
1175249352 20:57599577-57599599 CATAGCATTCACATTGTTTTAGG - Intergenic
1175584178 20:60124643-60124665 CAAAACAAGCAGTTTGATTCAGG - Intergenic
1176927281 21:14765635-14765657 CAAAACAATGAATTGGATTTTGG - Intergenic
1177237932 21:18418029-18418051 AAAAGCAATCACTTGGATCCTGG + Intronic
1177582118 21:23037653-23037675 CAAAGCAATCACTAAACTTTGGG - Intergenic
1178382183 21:32119937-32119959 AAAAGCAAGCACATGGATTTGGG + Intergenic
1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG + Intronic
1182691088 22:32163544-32163566 CAAACCAATCACTTAGCCTTTGG - Intergenic
1183755788 22:39763040-39763062 CAAGTCAATCACTTTGCTCTAGG + Intronic
1184167257 22:42737169-42737191 CAAAGCAACCACTTCAAATTTGG - Intergenic
949289064 3:2442631-2442653 AAAAGGAAACACTGTGATTTAGG + Intronic
949744311 3:7270783-7270805 CAAAGTAACCACTTCGATTTTGG + Intronic
950984739 3:17349677-17349699 CAAAACAATAATTTTCATTTGGG - Intronic
951076241 3:18396433-18396455 AAAAGCAAACACTGTGATTAAGG - Intronic
951477118 3:23118572-23118594 CAAATCTATCACTTTAATTTTGG - Intergenic
952642748 3:35617212-35617234 GAAAGCAATCACTTTCATGTGGG + Intergenic
953753217 3:45625153-45625175 AAGAGAAATCACTATGATTTAGG - Intronic
953872697 3:46641207-46641229 CGAAGCAACCATTTTGATTTTGG - Intergenic
955234130 3:57124621-57124643 CGCAGCCAACACTTTGATTTTGG + Intronic
955600247 3:60637227-60637249 TGAAGCAGTCATTTTGATTTTGG + Intronic
955618633 3:60836759-60836781 CAAAGCAATCACTTTGATTTTGG + Intronic
957115807 3:76024304-76024326 CAAGGCAAAAACTTTAATTTAGG + Intronic
957162891 3:76633383-76633405 CAAAAGAGTCACTTTTATTTTGG + Intronic
957259873 3:77887185-77887207 CCAAGCAAATACTTTGAATTGGG - Intergenic
959155449 3:102661238-102661260 CCAATCAATAACATTGATTTAGG + Intergenic
959443924 3:106413480-106413502 CAAAGCACTGAAATTGATTTTGG + Intergenic
960284646 3:115814158-115814180 CAAATCAATGCCTTTGATTCAGG - Intronic
960658790 3:120035324-120035346 CAGAGCCAACACCTTGATTTTGG + Intronic
961062593 3:123844163-123844185 CAAAGCAAGGACCTTGGTTTGGG + Intronic
962660133 3:137593757-137593779 AAAATCAATGACTTTCATTTTGG - Intergenic
963147943 3:142014131-142014153 CAAACCAAACACTTTTATTTTGG - Intronic
963209569 3:142674080-142674102 AGAAGCAATCACTTTTAGTTAGG - Intronic
963538199 3:146554780-146554802 CAAACCAAACAGTTAGATTTGGG + Intergenic
964453346 3:156834425-156834447 GAAAGTAATCACGTTGAGTTTGG - Intronic
964609370 3:158594854-158594876 CAAAACAATCATTTTAGTTTTGG + Intronic
965117936 3:164515429-164515451 CCCAGCACTCACTCTGATTTCGG - Intergenic
965504021 3:169491989-169492011 CAAAGAAAACACTTTTATCTGGG + Intronic
966069036 3:175852046-175852068 CATAGCAAGCACTTTGCTTCTGG + Intergenic
966211328 3:177456565-177456587 CAAAGGAATCTCATAGATTTGGG + Intergenic
969092938 4:4709634-4709656 CAAAGCAGGGACTTTGATCTGGG + Intergenic
969834295 4:9827311-9827333 CAAAGCAAGCAGATTGATTGAGG - Intronic
970430921 4:15988277-15988299 CCAAGAAATCCCTTTGAATTAGG + Intronic
970443344 4:16103923-16103945 CACTGCTAACACTTTGATTTTGG - Intergenic
970848716 4:20575555-20575577 CAAAGCATGCACTTTGAGGTGGG + Intronic
971273413 4:25172565-25172587 CAAAGTGACCACTTTGAATTTGG + Intronic
972027226 4:34397963-34397985 GAAAGAAATCACTTAGCTTTTGG + Intergenic
973768435 4:54185208-54185230 CAGTGCAATCAGTTTGAGTTTGG - Intronic
973861439 4:55069067-55069089 CAAAGACTTCACTTTGACTTTGG - Intergenic
974084164 4:57241898-57241920 GAAAGCAATCTCTGTGCTTTTGG + Intergenic
974501522 4:62710959-62710981 CCAAGCCATCACTATCATTTAGG + Intergenic
974707442 4:65539171-65539193 CAAGGCAGTCAGTTTGTTTTCGG - Intronic
975424071 4:74206171-74206193 CAAAGTAACTCCTTTGATTTGGG + Intronic
975816644 4:78223889-78223911 CAAATCAACCTCTTTCATTTTGG - Intronic
975832329 4:78382639-78382661 AAAAGCAATCACGTTTATTGAGG + Intronic
975900412 4:79145237-79145259 TAAAACAATCACTTAGATTAGGG - Intergenic
976419871 4:84828927-84828949 CAAAGAAAACAATGTGATTTGGG - Intronic
977077168 4:92469475-92469497 CATAGCATTTACATTGATTTAGG - Intronic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
979013512 4:115401087-115401109 CAAAGCAACCACTTCAATTTTGG + Intergenic
979058719 4:116027754-116027776 CAAAGCAAACTCTTAGATTTTGG - Intergenic
979282590 4:118884449-118884471 CAAGGAAATCTCCTTGATTTTGG + Intronic
980674673 4:136060985-136061007 CAAAGAAATTACTTTGCCTTTGG + Intergenic
981339957 4:143610474-143610496 TAAAGCAGTCACATTAATTTTGG + Intronic
982307142 4:153944478-153944500 CCATGCCAACACTTTGATTTTGG - Intergenic
983071091 4:163268718-163268740 ACAAGCAGTCACTTAGATTTTGG + Intergenic
983423370 4:167549605-167549627 CTATGCAACCACTTTGATCTGGG - Intergenic
984673879 4:182524700-182524722 AAAAGCAATGACTCTGAGTTTGG - Intronic
984804834 4:183742395-183742417 AAAGGCTATCACTTTAATTTTGG - Intergenic
985029481 4:185774457-185774479 CACAGCATTTACTTTGATTGTGG - Intronic
986133467 5:4952248-4952270 CAAGGTAAACACTTTGGTTTAGG + Intergenic
987155653 5:15087328-15087350 CAAAGCAGTCACTGAGATGTAGG - Intergenic
987244358 5:16033535-16033557 AACAGCACTCATTTTGATTTAGG - Intergenic
988286174 5:29219369-29219391 CGATGCAATCAATTTGATTAGGG + Intergenic
988624160 5:32853025-32853047 CAAAGCTATCCCTTTTAGTTGGG + Intergenic
989101175 5:37824587-37824609 CAAAGTCATCACTTTGAAATAGG - Intronic
989453311 5:41612416-41612438 GAAAATAATCACCTTGATTTAGG + Intergenic
990375223 5:55163352-55163374 AAAAGCAATAACTTTTTTTTTGG - Intronic
990485184 5:56251233-56251255 CTAAGCATTCACTGTTATTTTGG + Intergenic
990812104 5:59739023-59739045 CAAAAGAATCACTTTTCTTTTGG - Intronic
991603102 5:68373090-68373112 CAAAGTAACTGCTTTGATTTTGG + Intergenic
992271913 5:75073321-75073343 TAAAACAAGCACTTTTATTTAGG - Intronic
992637578 5:78739701-78739723 CTAAGCAATAATTTTAATTTAGG - Intronic
993056883 5:82991493-82991515 CAAAGCACTCAATTTCCTTTGGG - Intergenic
993329155 5:86575202-86575224 ACAAGAAATGACTTTGATTTTGG - Intergenic
994607821 5:101992769-101992791 CAAAACAATCAATTTTCTTTTGG - Intergenic
994646830 5:102480671-102480693 CACAGCAATCACTATTCTTTAGG - Intronic
996817291 5:127588244-127588266 AAAATCAATGACTTTGACTTTGG - Intergenic
996896017 5:128483542-128483564 CAAAGCAAACTGTTAGATTTGGG + Intronic
999602055 5:153277801-153277823 CAAACCAATTATTTTAATTTGGG + Intergenic
999927491 5:156395151-156395173 TCAAGCCATCACTTTCATTTTGG + Intronic
1000188975 5:158889912-158889934 CATAGCATTTACATTGATTTGGG + Intronic
1000205895 5:159058313-159058335 GAAAGCTCTCACTTTGCTTTAGG + Intronic
1004168471 6:13276966-13276988 AAAAGGAAACACGTTGATTTTGG - Intronic
1005696023 6:28353591-28353613 CAAGAAAATCACTTTGATTTGGG + Intronic
1007296546 6:40826514-40826536 CATTGCCAACACTTTGATTTTGG + Intergenic
1008162430 6:48094981-48095003 CAATGCAAGCACTGTCATTTTGG + Intergenic
1008659820 6:53655174-53655196 CAAAGCATTCAGTTTGTTTAGGG + Exonic
1011818031 6:91215146-91215168 CAATGAATTCACTTTTATTTAGG + Intergenic
1012501979 6:99898077-99898099 CAAATCAATCCCTGTGATTGTGG - Intergenic
1013248735 6:108313508-108313530 GAAAGCAATGTCTATGATTTGGG - Intronic
1014032900 6:116727453-116727475 CATAGCAATTACATTGTTTTAGG + Intronic
1014107679 6:117585166-117585188 TAAAAAAATTACTTTGATTTTGG - Intronic
1014223811 6:118825195-118825217 CAAAGGAATAACTTTGATCTTGG + Intronic
1016171755 6:141026399-141026421 CAAATCAATATCTTTGATTTAGG - Intergenic
1018308627 6:162485501-162485523 AAAACCAATCACATTTATTTTGG - Intronic
1019672418 7:2288513-2288535 GAAAGCACTCACTTTGAGTAGGG - Intronic
1020241871 7:6401537-6401559 CAAATAGATCACTTTGTTTTTGG - Intronic
1020398718 7:7749005-7749027 CAAAGCAATCACACTGATCTGGG - Intronic
1020628039 7:10607219-10607241 GAAAGCAAGTACCTTGATTTGGG - Intergenic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1020889690 7:13863126-13863148 CAAAGCAATGACCTTTACTTTGG + Intergenic
1021428555 7:20532664-20532686 CAATGCAATCACTTTTCTTGAGG - Intergenic
1021624799 7:22582716-22582738 CAAATCTATCTCCTTGATTTGGG + Intronic
1022755691 7:33286340-33286362 AAAAGCAAACACTTTCCTTTTGG - Intronic
1023422466 7:39996686-39996708 CAAAGCATTTAGTTTGATTCTGG - Intronic
1024992568 7:55247552-55247574 TAAAGAAATAACTTTGATTTTGG - Intronic
1026152027 7:67796017-67796039 CAAAGCATTCAATATGATTTTGG + Intergenic
1027814166 7:82947844-82947866 CAAAGTATTCACTTTGGATTTGG - Intronic
1030054729 7:105573955-105573977 CACAGCAATCTCTCTCATTTGGG + Intronic
1030628111 7:111865994-111866016 GAAAGCTTACACTTTGATTTTGG + Intronic
1030942830 7:115676465-115676487 CAATGCAATTATTTGGATTTGGG + Intergenic
1031033956 7:116766851-116766873 CAAAGCCACCAGTTTAATTTTGG + Intronic
1032337497 7:131039546-131039568 CAAAGTTATCACTATAATTTCGG - Intergenic
1032414534 7:131726078-131726100 CAAAGCATTTTCTCTGATTTAGG - Intergenic
1032625043 7:133582466-133582488 CAAAGCAGTCTCTTTTATCTTGG - Intronic
1033620052 7:143053754-143053776 AAAAACAATCAGTTTGTTTTTGG - Intergenic
1034584630 7:152078292-152078314 CAGAAGAATCACTTGGATTTGGG - Intronic
1034756936 7:153631298-153631320 CATGGCAATCACCTTGACTTGGG - Intergenic
1035009396 7:155700054-155700076 CAAAGAAATTACTTTTAATTTGG + Intronic
1036120983 8:6017494-6017516 CAGTGAAATCACTTTCATTTTGG + Intergenic
1036165825 8:6432307-6432329 CAAAGCATTCACATTGTATTAGG - Intronic
1036385120 8:8272283-8272305 CAAAGCAAACAGTCTCATTTTGG + Intergenic
1036693863 8:10961983-10962005 AAAAGCTATCCCTTTTATTTGGG + Intronic
1037839283 8:22232411-22232433 CAAAGCAAAGACTCTGATTGGGG + Intergenic
1038108590 8:24466978-24467000 TAAAGTACTCACTTTTATTTTGG - Exonic
1038145088 8:24888030-24888052 CAAAGCATTCACTTTGTGTCAGG + Intergenic
1039266585 8:35831132-35831154 GAAAGCAATCACATTGTATTTGG + Intergenic
1040026947 8:42790403-42790425 GAAAGCAATCACGATGAATTGGG + Intronic
1040622420 8:49104951-49104973 CAAAGCAAGCATTTTTATGTAGG + Intergenic
1040717803 8:50279735-50279757 CAAAGAGGTCACTTTGACTTTGG + Intronic
1041157975 8:55007302-55007324 CACAGCCCTCACCTTGATTTTGG - Intergenic
1043335863 8:79176027-79176049 TAAAGAAATCACTTTAATATAGG + Intergenic
1043384302 8:79732750-79732772 CAAAGAAATGACTTAAATTTGGG - Intergenic
1044731744 8:95234083-95234105 CCAAGCAATCCCTGTGTTTTTGG + Intergenic
1045964208 8:108004837-108004859 TAAAGCAATGTCTTTGTTTTTGG - Intronic
1047878565 8:129168136-129168158 CAAAGTAATCACTGTGTTCTGGG - Intergenic
1048204874 8:132407355-132407377 AAAATCAATCACTTTGTTTTGGG - Intronic
1048242079 8:132752571-132752593 AAAAGCAATCACATTGAGTTAGG + Intronic
1048838869 8:138547154-138547176 CAAAGGAAACACTGGGATTTAGG - Intergenic
1049360766 8:142211642-142211664 CAAAGCCAGCCCTTTGCTTTCGG + Intergenic
1050650922 9:7775923-7775945 TCAAGCAGTCACTTTCATTTTGG - Intergenic
1050848717 9:10257577-10257599 CATATAAATCATTTTGATTTAGG - Intronic
1050995156 9:12208162-12208184 CAAAGCTGACACTTTGATTTTGG - Intergenic
1051541049 9:18217818-18217840 AAAAGGCATCCCTTTGATTTGGG + Intergenic
1051647727 9:19286583-19286605 CAAAGGAATAATTTTAATTTTGG + Intronic
1051747191 9:20306357-20306379 CAAATCAATTGCTTTGCTTTGGG - Intergenic
1052224687 9:26071378-26071400 CCATGCTAACACTTTGATTTTGG - Intergenic
1052422106 9:28255923-28255945 CAAAGCAATAGCTTTTATTGTGG + Intronic
1052642522 9:31187734-31187756 TAAAGCAATAACTTCCATTTTGG + Intergenic
1052983140 9:34463722-34463744 CAAAGAAAAGACTTTCATTTTGG + Intronic
1053771002 9:41476194-41476216 CAAAACAAACACTTTGTTATTGG + Intergenic
1057437932 9:95059322-95059344 CAATGCAATCACTTGGTTCTTGG - Intronic
1058782870 9:108356185-108356207 CCTTGCAAACACTTTGATTTTGG - Intergenic
1059055742 9:110977449-110977471 CAAACCAAAGACTTTGTTTTAGG - Intronic
1060558087 9:124519932-124519954 AAAAGCACTCACTTTGAGTGAGG - Exonic
1185813439 X:3131666-3131688 CAAAGCAGACACCTTGTTTTTGG - Intergenic
1188827554 X:34854694-34854716 CAAACCATTCATTTTGATATTGG - Intergenic
1189846010 X:45139152-45139174 CAAGGCAATCACTTGAACTTGGG - Intergenic
1190560796 X:51683081-51683103 CAAAGCACTCACATTCATTTAGG + Intergenic
1190563495 X:51710240-51710262 CAAAGCACTCACATTCATTTAGG - Intergenic
1191997397 X:67110324-67110346 CATAGCAATCAGTTGGCTTTTGG - Intergenic
1192072432 X:67955273-67955295 CAAAGGAATAAATGTGATTTAGG - Intergenic
1193383500 X:80844144-80844166 CAAAGAAAACAGTTTCATTTTGG + Intergenic
1193680560 X:84514328-84514350 CCAAGAAATCATTTTCATTTTGG + Intergenic
1193708363 X:84850854-84850876 CAAACCAATCACATTGTTGTGGG + Intergenic
1194019547 X:88669741-88669763 CAAAGCATACACTTAGATTTGGG - Intergenic
1194241145 X:91450750-91450772 GAAAGCAATCACTTTAAGATAGG + Intergenic
1194603382 X:95951272-95951294 CAAAGCATTCACTTTTAGTGGGG + Intergenic
1196197403 X:112850674-112850696 CAAAAAAATAGCTTTGATTTTGG - Intergenic
1196396306 X:115265419-115265441 CATATCAATTACTTTTATTTAGG - Intergenic
1196983414 X:121240667-121240689 CAAAGCTATCATTTTGTATTTGG + Intergenic
1197127327 X:122962419-122962441 ACAAGCAATCACTATGATATGGG + Intergenic
1198084926 X:133273405-133273427 CAACACATTCACTTTGCTTTTGG + Intergenic
1199225449 X:145367670-145367692 AAAACCAATCACTGTGACTTGGG + Intergenic
1199418752 X:147618694-147618716 CAAAGTATTCACTCTGAATTTGG + Intergenic
1201399779 Y:13592854-13592876 TAAAGAAAGCACTTTGTTTTTGG - Intergenic