ID: 955619227

View in Genome Browser
Species Human (GRCh38)
Location 3:60843918-60843940
Sequence TGCCTTACCCCTAGAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955619227_955619229 11 Left 955619227 3:60843918-60843940 CCTGACACTCTAGGGGTAAGGCA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 955619229 3:60843952-60843974 ATGTATTTCTGGTAATCAAGAGG 0: 1
1: 0
2: 2
3: 11
4: 197
955619227_955619230 12 Left 955619227 3:60843918-60843940 CCTGACACTCTAGGGGTAAGGCA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 955619230 3:60843953-60843975 TGTATTTCTGGTAATCAAGAGGG 0: 1
1: 0
2: 1
3: 30
4: 251
955619227_955619228 0 Left 955619227 3:60843918-60843940 CCTGACACTCTAGGGGTAAGGCA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 955619228 3:60843941-60843963 AGCACGCATGTATGTATTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955619227 Original CRISPR TGCCTTACCCCTAGAGTGTC AGG (reversed) Intronic
900980997 1:6046102-6046124 TGCCAGATCCTTAGAGTGTCTGG + Exonic
901109128 1:6781452-6781474 TGCCTCACCTCTTGAGTATCTGG - Intergenic
901735922 1:11312120-11312142 TGCGTTACCCCTAGAGCAGCTGG - Intergenic
903576258 1:24341473-24341495 TGCCGTTCCCCTAGGGAGTCAGG - Intronic
905022259 1:34825903-34825925 TGCTTTATCCCTGGAGTGGCAGG - Intronic
907575679 1:55523684-55523706 TTCCTTATCCCCATAGTGTCAGG - Intergenic
914195711 1:145446961-145446983 TCCCTCACCCCTAGTGTGGCTGG - Intergenic
918863233 1:189860307-189860329 TGCTTGAGTCCTAGAGTGTCTGG + Intergenic
920004103 1:202820245-202820267 TTCATTACTCCTAGAGTGACTGG + Exonic
1070467082 10:76734249-76734271 TGCTTCACCCCTTCAGTGTCAGG + Intergenic
1073814644 10:107193344-107193366 TGCCTTACCCATAAAATGCCCGG + Intergenic
1076854736 10:133110336-133110358 TGCCTTCCCGCCAGAGTGTGAGG - Intronic
1077141941 11:1028593-1028615 TGCCTCATCCCTACAGGGTCTGG - Intronic
1079224374 11:18592597-18592619 TGTCTTAGCCCCAGAGTGTTGGG - Intergenic
1081255135 11:40883351-40883373 TGACTTACTCCTAAAGTGACTGG + Intronic
1081415636 11:42811800-42811822 TGACTTACCCCTCGAGTGATGGG - Intergenic
1083387598 11:62323299-62323321 TGCTTTCACCCTAGAGTGGCAGG - Intergenic
1085620567 11:78035051-78035073 GGCCCTACCCCTGGAGTTTCCGG + Intronic
1085623559 11:78055249-78055271 GGCCTCACCCCCAGAGTATCTGG - Intronic
1087019000 11:93583739-93583761 TGCCCTGGACCTAGAGTGTCTGG - Intergenic
1091593943 12:1862525-1862547 TGCCTTAGCCCTTGAGTAGCTGG + Intronic
1095542730 12:43329877-43329899 TTCCTTACCCCTCCAGTGCCTGG - Intergenic
1096933420 12:55241848-55241870 TGCCTGCCCCCTAGAGTCTCAGG - Intergenic
1099883500 12:88498758-88498780 TGCCTCACCCCCAGAGTAGCTGG - Intronic
1109946955 13:69447230-69447252 TGCCTTACCACCAGAGTAGCTGG + Intergenic
1110742464 13:79013838-79013860 TGCATTTCCCCTAGATTTTCTGG + Intergenic
1123965828 15:25456385-25456407 TGCCTGAACCCTAGAGTGGGAGG - Intergenic
1124087804 15:26568175-26568197 GGCATTGCCCCTAGAGTGACTGG + Intronic
1126126813 15:45301702-45301724 TGCCTCAGCCCTAGAGTAGCTGG + Intergenic
1138040213 16:53655724-53655746 GGCCCTACCCCTAGAGGTTCTGG - Intronic
1139873249 16:70124557-70124579 GGCCTCACCCCTAGAGATTCTGG - Intronic
1141244776 16:82295589-82295611 TTCTTTACCCCTTGAGTGTTTGG + Intergenic
1146158829 17:30548096-30548118 TGCCTGACCCCAAGGCTGTCTGG + Intergenic
1146257328 17:31399072-31399094 TGCCTCAGCCCTGGAGTGTAGGG + Intronic
1147031039 17:37637046-37637068 TGCTTTAGCCCAAGAGTGTGAGG - Intronic
1147651884 17:42067537-42067559 TGCATTGCCCCTTGAGTGTGGGG - Intergenic
1148963308 17:51411645-51411667 TGCCTTGCCTCTAGTGTTTCTGG - Intergenic
1151691081 17:75685851-75685873 TGTCTTATCCCCAGAGTGTCAGG - Intronic
1153245535 18:3069691-3069713 TTCCTAACCACTAGACTGTCAGG - Intronic
1155757719 18:29522606-29522628 TGCCTCAGCCCTGGAGTATCTGG + Intergenic
1156316839 18:35977290-35977312 TTACTTACCCCTATAGTATCTGG + Intronic
1158627956 18:59088125-59088147 TCTCTGACCCCTAGACTGTCAGG + Intergenic
937431990 2:121846537-121846559 AGCCTTGCCCCTAGAGTCTTTGG - Intergenic
940224149 2:151384176-151384198 TGCCTTCCTCCTAAAGGGTCTGG - Intergenic
941554055 2:166953452-166953474 TGCCTTCCACCATGAGTGTCTGG + Intronic
943126811 2:183804140-183804162 AGGCTGACCCCTAAAGTGTCAGG - Intergenic
944877000 2:203972446-203972468 TGCCCTACCCCTGGTGTGACTGG + Intergenic
948570369 2:238913781-238913803 TGCCTTACCCAGAGGCTGTCTGG - Intergenic
1168990071 20:2087462-2087484 GGCCTCACCCCCAGAGTGTCTGG + Intergenic
1170859713 20:20091206-20091228 TGCCTTGTCCCTAGAGTGAGAGG + Intronic
1174124382 20:48292232-48292254 TGCCTAAACCCTAGAGTGTTTGG + Intergenic
1178789730 21:35688857-35688879 TGCCTTATCCCTAGAGTCTGGGG + Intronic
1184826947 22:46958757-46958779 TGCCTTACCCGTAGACTTACTGG + Intronic
950689339 3:14643227-14643249 TGCCTTCCCTCTGGAGTGTGAGG + Intergenic
951208604 3:19949449-19949471 TGCCTCACCCCCAAAGTGTTGGG + Intronic
955619227 3:60843918-60843940 TGCCTTACCCCTAGAGTGTCAGG - Intronic
962088170 3:132213797-132213819 AGCCTCACCCCCAGAGTTTCTGG - Intronic
967048860 3:185763369-185763391 TGCTTTAACCTTGGAGTGTCAGG - Intronic
972035822 4:34519326-34519348 TCCCTTACCTCTGCAGTGTCTGG - Intergenic
979545460 4:121934841-121934863 TGCCATACCTCTATAGAGTCAGG - Intronic
985748662 5:1661982-1662004 TCCCCTACCCCTGGAGTGCCTGG - Intergenic
989778032 5:45232635-45232657 TGCCTTACCCCCATTGTATCTGG - Intergenic
991628228 5:68627016-68627038 GGCCTTACCCCTAGAGATTCTGG - Intergenic
994457317 5:100027898-100027920 TGCCTTACACCAAGATTTTCAGG - Intergenic
995978984 5:118078625-118078647 TGCCTGCCTCCTAGAGTCTCAGG - Intergenic
996322349 5:122232972-122232994 TGCCCTACCCCTATAGCGTGTGG + Intergenic
996708473 5:126520784-126520806 TGCCTTTCCCCTAGAGGGGAAGG - Intergenic
998880245 5:146638137-146638159 TTCTTTACTCCTAGTGTGTCTGG + Intronic
1001261376 5:170232789-170232811 TTCCTTACCCCCAGTGTGCCAGG - Exonic
1006086615 6:31600131-31600153 TGCCTTTCCTCTTGAGTGCCTGG - Intergenic
1011958561 6:93056321-93056343 TCCCTTACCTCTAGACTTTCTGG - Intergenic
1015019401 6:128453961-128453983 TTTCTTATCCATAGAGTGTCTGG - Intronic
1016182523 6:141164601-141164623 TTCCTTTCCCCTAGAATGCCAGG - Intergenic
1019659484 7:2216031-2216053 GGCCTTATCCCTAGGGTGTGTGG - Intronic
1021895324 7:25229415-25229437 TGCCTTATCACTAGACTGCCTGG + Intergenic
1022274273 7:28840253-28840275 TGCCTCATTCCTAGAGTTTCTGG - Intergenic
1024760781 7:52594101-52594123 GGCCATCACCCTAGAGTGTCTGG + Intergenic
1025024918 7:55508513-55508535 TGCCTTAGCCCAAAAGTGTTGGG + Intronic
1026397359 7:69969187-69969209 TGCCTTAACTCTTGAGTTTCAGG - Intronic
1026979078 7:74516164-74516186 TGCCTTTCCCCTCCTGTGTCTGG + Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG + Intronic
1029521642 7:101066565-101066587 TGCCCCACCCCCAGGGTGTCTGG - Intergenic
1032232411 7:130086493-130086515 TGCCATCTCCCTAGAGTTTCTGG + Intronic
1034429709 7:151035131-151035153 TGCCTTGTCCCCAGAGTGCCTGG + Intronic
1037352604 8:17977514-17977536 TGGCTTTTTCCTAGAGTGTCAGG + Intronic
1038181187 8:25229365-25229387 TGCCTCACCTCCAGAGTATCTGG - Intronic
1038847442 8:31243347-31243369 TCCCTTAAGCCTAGTGTGTCCGG + Intergenic
1053162269 9:35821430-35821452 TGTCTTACCCATAGTCTGTCAGG + Intronic
1056999324 9:91493012-91493034 TGCTTTTCTCCTAGAGTCTCAGG + Intergenic
1062327391 9:136018677-136018699 TGCCTGACCCCTGTAGTGGCCGG - Intronic
1062698955 9:137889389-137889411 TCCCTCACCCCTAGTGTGGCTGG + Intronic
1187030043 X:15477235-15477257 TGGCTTACCACTTGAGTCTCTGG + Intronic
1188386112 X:29561035-29561057 TGCGAGACCCCTAGAATGTCAGG - Intronic
1190643438 X:52502913-52502935 AGCCATTACCCTAGAGTGTCCGG + Intergenic
1190955450 X:55188527-55188549 AGCCATTACCCTAGAGTGTCTGG - Intronic
1194962043 X:100247075-100247097 TGCCTTACCCCAGGAGCTTCAGG - Intergenic
1195263880 X:103161152-103161174 GGCCTCAGACCTAGAGTGTCTGG - Intergenic
1197345119 X:125320745-125320767 TGCCTGAACCCCAGAGTGGCAGG + Intergenic
1201699696 Y:16867133-16867155 TGCCTTACACCCTGAGTGTAAGG + Intergenic