ID: 955620098

View in Genome Browser
Species Human (GRCh38)
Location 3:60854145-60854167
Sequence CAGTGTTACCATATGCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955620098_955620101 20 Left 955620098 3:60854145-60854167 CCCACAAGCATATGGTAACACTG 0: 1
1: 0
2: 0
3: 13
4: 240
Right 955620101 3:60854188-60854210 TCCAACACCAGGACATTTCATGG 0: 1
1: 0
2: 0
3: 10
4: 239
955620098_955620100 9 Left 955620098 3:60854145-60854167 CCCACAAGCATATGGTAACACTG 0: 1
1: 0
2: 0
3: 13
4: 240
Right 955620100 3:60854177-60854199 GCTCAAAGTGTTCCAACACCAGG 0: 1
1: 0
2: 2
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955620098 Original CRISPR CAGTGTTACCATATGCTTGT GGG (reversed) Intronic
901535444 1:9879806-9879828 CAGTGTTCCCCTCTGCTTCTTGG - Intronic
904879273 1:33682678-33682700 CGGTTTTGCCAAATGCTTGTAGG + Intronic
907208172 1:52793684-52793706 CTGTGTTACCTCATACTTGTGGG + Intronic
908354970 1:63319951-63319973 CAGTGTTACCATCTGATGCTGGG - Intergenic
909202825 1:72713542-72713564 CTTTTTTTCCATATGCTTGTTGG + Intergenic
911805765 1:102206090-102206112 GAATTTTTCCATATGCTTGTTGG + Intergenic
915483015 1:156200039-156200061 CAGTGATACCATCTGCTCGCAGG - Exonic
917228388 1:172808772-172808794 CATTTTTTTCATATGCTTGTTGG + Intergenic
917786546 1:178464731-178464753 CTGTGTTTCCATAAACTTGTTGG + Intronic
919560023 1:199105992-199106014 GTGTCTTATCATATGCTTGTTGG + Intergenic
919590860 1:199500224-199500246 CAGTCTTTTCATATGCTTATTGG - Intergenic
919627025 1:199921255-199921277 CTTTTTTTCCATATGCTTGTTGG + Intergenic
920562472 1:206948480-206948502 CAGTGTTCCCATATAATTGGGGG + Intergenic
920603044 1:207348329-207348351 CATTTTTTTCATATGCTTGTTGG + Intronic
923139662 1:231150742-231150764 CAGTGTCAGCATCTGCTTCTGGG + Intergenic
923446227 1:234073775-234073797 CATTTTTCCCATTTGCTTGTGGG + Intronic
1063952208 10:11233942-11233964 CAATGTTCACATATGCCTGTGGG - Intronic
1064525706 10:16254303-16254325 GAGTGTTCTCATATGCTTGTTGG - Intergenic
1066162405 10:32747589-32747611 CATTTTTTTCATATGCTTGTTGG - Intronic
1067231567 10:44415403-44415425 CATTTTTTTCATATGCTTGTTGG + Intergenic
1068640510 10:59399885-59399907 CATTTTTTTCATATGCTTGTTGG + Intergenic
1069228969 10:65982227-65982249 CATTTTTTTCATATGCTTGTTGG - Intronic
1071061268 10:81572487-81572509 CATTTTTTTCATATGCTTGTTGG - Intergenic
1071434021 10:85629971-85629993 CATTTTTTTCATATGCTTGTTGG + Intronic
1072245858 10:93543212-93543234 CAGTGTTACCATCTGCAGGCAGG - Intergenic
1072550415 10:96473052-96473074 CAGTGTTCCCATCTGATTGGGGG - Intronic
1076325507 10:129617691-129617713 CATTTTTTTCATATGCTTGTTGG + Intronic
1082746972 11:56974397-56974419 CATTGTTTTCATATGTTTGTTGG - Intergenic
1083527211 11:63380067-63380089 CATTTTTTTCATATGCTTGTTGG - Intronic
1085914179 11:80864893-80864915 CATTTTTTTCATATGCTTGTTGG - Intergenic
1086075947 11:82852389-82852411 CAGTGTATACATATGCTTTTGGG - Intronic
1086664141 11:89458683-89458705 TATTGTTTTCATATGCTTGTTGG - Intronic
1089303704 11:117513998-117514020 CAGTGATATCACATGCTTGAGGG + Intronic
1090114810 11:123957365-123957387 CACTTTTTTCATATGCTTGTTGG + Intergenic
1093691050 12:22109382-22109404 GCATGTTTCCATATGCTTGTTGG - Intronic
1094248849 12:28335838-28335860 CTGTGTTACCATATGTTTGGTGG + Intronic
1094763984 12:33570553-33570575 CATTTTTTCCATATGCTTCTTGG - Intergenic
1098793409 12:74857201-74857223 CATTTTTTCCATATACTTGTTGG + Intergenic
1098858136 12:75677378-75677400 AAGTGTTCCCACATGCTTCTAGG + Intergenic
1099761518 12:86926555-86926577 CAGTATTTCCATATGCATTTTGG + Intergenic
1100483873 12:95005780-95005802 CCATGTTTTCATATGCTTGTTGG + Intergenic
1100943915 12:99757324-99757346 CATTTTTTTCATATGCTTGTTGG - Intronic
1101847907 12:108377985-108378007 CATTTTTTTCATATGCTTGTTGG - Intergenic
1102952697 12:117040974-117040996 CAGTGTTCCCAAGTGCTTTTGGG - Intronic
1103168235 12:118789385-118789407 CAGTGGAACCATATACTTGCCGG + Intergenic
1104577217 12:129978706-129978728 CATTTTTTTCATATGCTTGTTGG + Intergenic
1105308845 13:19188563-19188585 CAGTGTCAACATCTGCTTCTGGG - Intergenic
1105528748 13:21199584-21199606 CAGTGTCAACATCTGCTTCTGGG + Intergenic
1105675374 13:22665763-22665785 CAGTTGGTCCATATGCTTGTAGG + Intergenic
1106604695 13:31217208-31217230 CATTTTTTTCATATGCTTGTTGG + Intronic
1106977709 13:35241272-35241294 TAATGTTACCATATGTATGTGGG - Intronic
1107158706 13:37199684-37199706 CATTTTTTTCATATGCTTGTTGG + Intergenic
1107569819 13:41644874-41644896 CAGTTTTACCATAGGCTAATTGG - Intronic
1109942655 13:69391915-69391937 CAGTATTACCTCATGCTTTTTGG - Intergenic
1110755486 13:79168947-79168969 CAGTTTTTTCATATGCTTGTGGG - Intergenic
1111032338 13:82619743-82619765 CATTTTTTTCATATGCTTGTTGG - Intergenic
1111808774 13:93071454-93071476 CATTTTTTTCATATGCTTGTTGG - Intergenic
1113397161 13:109958748-109958770 CATTTTTTTCATATGCTTGTTGG + Intergenic
1116089622 14:40288359-40288381 CATTTTTTTCATATGCTTGTTGG + Intergenic
1116673273 14:47871566-47871588 GAATGATACCATATGCTTTTTGG - Intergenic
1117105938 14:52397055-52397077 CTTTTTTGCCATATGCTTGTTGG + Intergenic
1117111219 14:52457121-52457143 CAGTGATAACATATCCTTTTAGG + Exonic
1117443813 14:55784137-55784159 GAGTTTTTTCATATGCTTGTTGG - Intergenic
1117451869 14:55859234-55859256 CATTTTTTTCATATGCTTGTTGG + Intergenic
1117488895 14:56226345-56226367 CAGTGCTGCCATCTGCTTCTTGG + Intronic
1118061950 14:62149162-62149184 CATTATTTTCATATGCTTGTTGG - Intergenic
1118115125 14:62767053-62767075 GAATTTTTCCATATGCTTGTTGG - Intronic
1118679185 14:68221918-68221940 CATTTTTTCCATATGCTTATTGG - Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1118842521 14:69523949-69523971 CAGTGTTTCCCTCTGCCTGTGGG + Intronic
1121871166 14:97408785-97408807 CACTGGTACCAAATGCTTGTAGG + Intergenic
1125984117 15:44032581-44032603 CTTTTTTTCCATATGCTTGTTGG - Intronic
1128414879 15:67436074-67436096 CAGTGGTGCCATATGCTGGGAGG - Intronic
1130200814 15:81825250-81825272 CATTTTTTTCATATGCTTGTTGG - Intergenic
1131121373 15:89825068-89825090 CATCGTTACCATCTGCTGGTGGG - Intergenic
1131597999 15:93818552-93818574 GAGTTTTTTCATATGCTTGTTGG - Intergenic
1132209859 15:100012154-100012176 CATTGTTTTCATATGTTTGTTGG + Intronic
1132416811 15:101626368-101626390 CAGTGTTACTATTTACTTTTTGG - Intronic
1134385818 16:13771390-13771412 CAGTGTTCCCCTTGGCTTGTTGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138605735 16:58086983-58087005 CAGTGTTGCCACCTGCATGTGGG - Intergenic
1138807689 16:60109810-60109832 CAGTGCTAACATACGCTTGGTGG + Intergenic
1138926705 16:61600476-61600498 CAGTTGTACCATATCCTTGTCGG + Intergenic
1139265601 16:65635663-65635685 TAGTGGTACCAAATGCATGTTGG + Intergenic
1140521545 16:75586145-75586167 CAGTGCTAGCATCTGCTTCTGGG - Intergenic
1140636652 16:76922763-76922785 CATTTTTTCCATATGCTTATTGG + Intergenic
1145304954 17:21668935-21668957 CAGGGTTAGCATCTGCTTGCTGG - Intergenic
1148999203 17:51739737-51739759 CAGAGTCATCATATGCTTGCTGG + Intronic
1149069135 17:52518990-52519012 AAGTGTAACCATATGCTTTCTGG - Intergenic
1150064726 17:62099477-62099499 AAATGTCACCATGTGCTTGTAGG - Intergenic
1151271584 17:73000438-73000460 CCTTGTTCCCATATCCTTGTCGG - Intronic
1153433570 18:5044995-5045017 CAGACTTACCATATCTTTGTGGG + Intergenic
1155260247 18:24035114-24035136 CAGTGTAACCTTAAACTTGTTGG + Intronic
1156067917 18:33167524-33167546 CATTTTTTTCATATGCTTGTTGG + Intronic
1167860387 19:52278329-52278351 CTTTTTTTCCATATGCTTGTTGG + Intronic
925312308 2:2893801-2893823 CAGTGAGACCATGTTCTTGTAGG - Intergenic
926889868 2:17629761-17629783 CAGTGTAACCTTATTCTTCTTGG - Intronic
927235018 2:20865124-20865146 CATTTTTTCCATATACTTGTTGG - Intergenic
927329665 2:21847471-21847493 CATTTTTTTCATATGCTTGTTGG - Intergenic
928581746 2:32714848-32714870 CATTTTTTTCATATGCTTGTTGG + Intronic
928664722 2:33539116-33539138 CAGGGGTACCACAGGCTTGTTGG - Exonic
929357539 2:41044040-41044062 CCTTTTTTCCATATGCTTGTCGG - Intergenic
929718234 2:44335933-44335955 CATTTTTTTCATATGCTTGTTGG - Intronic
929902716 2:46019649-46019671 CAGTTTTACCATAGGCTAATTGG - Intronic
931576799 2:63725809-63725831 CATTTTTTTCATATGCTTGTTGG + Intronic
933080847 2:77983413-77983435 CATTTTTTTCATATGCTTGTTGG - Intergenic
935491492 2:103726008-103726030 CATTTTTTTCATATGCTTGTTGG + Intergenic
936592127 2:113814113-113814135 CTGTGTTACCATATGGTGGGAGG + Intergenic
937950309 2:127381535-127381557 CAGTGTTAATAAATGTTTGTTGG - Intronic
939988755 2:148857761-148857783 CAGCTTTTTCATATGCTTGTTGG - Intergenic
943500876 2:188688045-188688067 CACTATTTTCATATGCTTGTTGG + Intergenic
943853024 2:192753034-192753056 CTGTGTTACCATATTCTAGTTGG + Intergenic
1169469430 20:5871435-5871457 GATTTTTACCACATGCTTGTTGG - Intergenic
1170490951 20:16873832-16873854 CACTGTTACCAGCTCCTTGTGGG - Intergenic
1170897930 20:20433081-20433103 AAGTGTTACTAGATGTTTGTTGG - Intronic
1171114707 20:22515382-22515404 CGGTGTTTCCACATGCATGTGGG - Intergenic
1171522471 20:25786406-25786428 CAGGGTTAGCATCTGCTTGCTGG - Intronic
1171530221 20:25848368-25848390 CAGGGTTAGCATCTGCTTGCTGG - Intronic
1171554356 20:26069477-26069499 CAGGGTTAGCATCTGCTTGCTGG + Intergenic
1173772328 20:45672114-45672136 CATTTTTATCATATGCTTTTTGG - Intergenic
1175462461 20:59162026-59162048 CATTTTTAAAATATGCTTGTTGG + Intergenic
1176898362 21:14410452-14410474 CATTTTTTTCATATGCTTGTTGG + Intergenic
1182009853 22:26991625-26991647 CATTGTTTTCATGTGCTTGTTGG + Intergenic
951302290 3:21012637-21012659 GAATTTTTCCATATGCTTGTTGG + Intergenic
952327113 3:32331195-32331217 TCATATTACCATATGCTTGTTGG - Intronic
953382636 3:42485655-42485677 CATTTTTTCCATATGTTTGTTGG - Intergenic
953473623 3:43187215-43187237 CATTTTTTCCATATACTTGTTGG + Intergenic
955620098 3:60854145-60854167 CAGTGTTACCATATGCTTGTGGG - Intronic
957223565 3:77414482-77414504 AAGCGTGTCCATATGCTTGTGGG + Intronic
958430300 3:94032281-94032303 CATTTTTTTCATATGCTTGTTGG - Intronic
959035241 3:101354986-101355008 CTTTTTTACCATATGCTTCTTGG + Intronic
959195996 3:103182784-103182806 CAGTGTTCATATATGCCTGTTGG + Intergenic
959496555 3:107058676-107058698 CAGTGTTACCATTTGGTGGCTGG - Intergenic
959514720 3:107252062-107252084 CAGTGTTGCCATCTGCTATTTGG - Intergenic
960688566 3:120319128-120319150 CTTTTTTTCCATATGCTTGTTGG - Intergenic
960817893 3:121692014-121692036 CAGTGTTTCCATAAGCTGATTGG + Exonic
961071657 3:123935160-123935182 CATTTTTATCATATGCTTATAGG - Intronic
961192035 3:124970066-124970088 CAGTGTTTTCATATGTTTCTAGG - Exonic
962946665 3:140177260-140177282 CAGTTTTACCAAATGCCTGTTGG + Intronic
963326252 3:143866527-143866549 CACTGTTCCCATATACTTATCGG + Intergenic
964260759 3:154834351-154834373 GAGTGTTACCAAATACTTCTTGG + Intergenic
966086578 3:176075520-176075542 CATTTTTTTCATATGCTTGTTGG - Intergenic
966843387 3:184106897-184106919 CAGTCCTACCATATGGTTCTAGG + Intronic
973011339 4:45078517-45078539 CATTTTTTTCATATGCTTGTTGG + Intergenic
973044030 4:45512395-45512417 CCGTTTTTCCATATGTTTGTTGG + Intergenic
973064945 4:45778233-45778255 CAATTTTACCATTTGCTTTTGGG + Intergenic
973577655 4:52307026-52307048 CATTGTTTTCATATGTTTGTTGG + Intergenic
975534995 4:75440773-75440795 CATTGTTTTCATATGTTTGTTGG - Intergenic
975955786 4:79836507-79836529 CACTTTTTTCATATGCTTGTTGG + Intergenic
976060017 4:81116779-81116801 CATTTTTTTCATATGCTTGTTGG + Intronic
977195361 4:94052160-94052182 CCATCTTTCCATATGCTTGTTGG - Intergenic
977481680 4:97585756-97585778 CAGTGTTACATTAAGCTTTTTGG - Intronic
977484357 4:97623483-97623505 CATTTTTTTCATATGCTTGTTGG - Intronic
977513967 4:97996816-97996838 CATTTTTTTCATATGCTTGTTGG - Intronic
977997281 4:103509882-103509904 CATTTTTTTCATATGCTTGTTGG + Intergenic
978113801 4:104994528-104994550 GATTTTTTCCATATGCTTGTTGG + Intergenic
978827189 4:113039630-113039652 CAGTGTTAATATATTCTAGTGGG - Intronic
979426750 4:120576800-120576822 CATTGTTTTCATATGTTTGTTGG - Intergenic
980248557 4:130281470-130281492 CATTTTTTTCATATGCTTGTCGG + Intergenic
982123905 4:152168033-152168055 CAGGGTTACCATTTGCTTCTTGG + Intergenic
983853140 4:172607857-172607879 CATTTTTTTCATATGCTTGTTGG + Intronic
986165139 5:5266557-5266579 CATTGTTGCAATCTGCTTGTTGG + Intronic
986355287 5:6918208-6918230 GAATTTTTCCATATGCTTGTTGG - Intergenic
987006244 5:13712701-13712723 CATTTTTTTCATATGCTTGTTGG - Intronic
988844761 5:35116712-35116734 CAATGTTACCAGATGCTCCTGGG + Intronic
988966786 5:36426649-36426671 CATTTTTTTCATATGCTTGTTGG + Intergenic
989348947 5:40462364-40462386 CATTTTTTCCATATGTTTGTTGG - Intergenic
989693955 5:44177411-44177433 CATTTTTTTCATATGCTTGTTGG + Intergenic
993912749 5:93704361-93704383 CAGAGTCTCCCTATGCTTGTAGG - Intronic
994013026 5:94929957-94929979 CAGCGTTAACATAAGCTTTTGGG - Intronic
994227429 5:97269143-97269165 CGTTTTTATCATATGCTTGTAGG + Intergenic
996585043 5:125077968-125077990 CATTTTTTCCATATGCCTGTTGG - Intergenic
997421459 5:133770488-133770510 CAGTGTTTTCATATGTTTGTTGG + Intergenic
1006439448 6:34043963-34043985 CAGTCTTTCCATATGCTACTGGG - Intronic
1007438613 6:41837834-41837856 CATTCTTTTCATATGCTTGTTGG - Intronic
1007724977 6:43910363-43910385 CTGTGTTAATATATGTTTGTGGG - Intergenic
1008172111 6:48220748-48220770 TTGTGTTACAATATCCTTGTTGG + Intergenic
1008686975 6:53935931-53935953 CTTTTTTTCCATATGCTTGTTGG - Intronic
1008940871 6:57044295-57044317 CATTTTTTCCATATGTTTGTTGG - Intergenic
1009265629 6:61551129-61551151 CACTTTTTTCATATGCTTGTTGG + Intergenic
1009624440 6:66121176-66121198 CATTTTTTTCATATGCTTGTTGG + Intergenic
1010177915 6:73051215-73051237 CAGTGTGAACATATGCATGGAGG + Intronic
1010229988 6:73525698-73525720 CAGTGTTTCTACATGCTTTTTGG + Intergenic
1011448652 6:87470400-87470422 CAGTGCTGGCATATGCTTCTGGG + Intronic
1011804448 6:91055524-91055546 CATTTTTTCCATATACTTGTTGG + Intergenic
1014567167 6:122963732-122963754 CATTTTTTTCATATGCTTGTTGG - Intergenic
1016652512 6:146478966-146478988 CAGTTTTTTCATATGCTTGTTGG + Intergenic
1017911844 6:158800025-158800047 CATTCTAACCATATGCTTGCTGG - Intronic
1022545246 7:31181331-31181353 CATTTTTTTCATATGCTTGTTGG + Intergenic
1023908849 7:44540100-44540122 CAGTGATACCAGCTGCTTGGCGG + Exonic
1024217634 7:47261317-47261339 CATTTTTTTCATATGCTTGTTGG - Intergenic
1024473407 7:49786743-49786765 GCATGTTATCATATGCTTGTTGG + Intronic
1028411867 7:90538738-90538760 CAGTGTTACCATGATATTGTGGG - Intronic
1029901336 7:104043422-104043444 CATTTTTTTCATATGCTTGTTGG - Intergenic
1031429333 7:121647365-121647387 GAATGTTTTCATATGCTTGTTGG + Intergenic
1032660939 7:133983043-133983065 CAGTGCTAGCATCTGCTTCTGGG + Intronic
1035473177 7:159123912-159123934 CCTTTTTTCCATATGCTTGTTGG + Intronic
1035517890 8:252047-252069 CTTTGTTTCCATATGCTTGGAGG + Intergenic
1035644483 8:1207828-1207850 CATTTTTTCCATATGTTTGTTGG + Intergenic
1036055004 8:5242027-5242049 CATTTTTTTCATATGCTTGTTGG - Intergenic
1037205741 8:16318175-16318197 CAGAGGTAACATATTCTTGTGGG + Intronic
1038750481 8:30290646-30290668 CTGTTTTTCCATATGCATGTTGG + Intergenic
1042769873 8:72367842-72367864 GAATGTTTCCATATGTTTGTTGG - Intergenic
1043475208 8:80599400-80599422 CAGTGTGACCTTATGGTTTTGGG - Intergenic
1043556260 8:81433746-81433768 CATTTTTTCCATATGCTTTTTGG + Intergenic
1043558251 8:81459627-81459649 GAGTGTTACGATAACCTTGTGGG + Intronic
1043988311 8:86720379-86720401 GAATTTTTCCATATGCTTGTTGG - Intronic
1046418233 8:113943070-113943092 GAAGGTTACCAAATGCTTGTAGG + Intergenic
1046429829 8:114110041-114110063 ACGTGTTTTCATATGCTTGTTGG - Intergenic
1050160648 9:2715392-2715414 AAGCTTTACCATAAGCTTGTAGG + Intergenic
1050734132 9:8744014-8744036 GCGTTTTTCCATATGCTTGTTGG - Intronic
1050881336 9:10703779-10703801 CATTTTTTCCATATGTTTGTTGG + Intergenic
1051886683 9:21900395-21900417 CATTTTTGTCATATGCTTGTTGG - Intronic
1052263475 9:26545131-26545153 GAGTTTTTTCATATGCTTGTTGG - Intergenic
1052481647 9:29035833-29035855 CTGTGTTTCCATTTCCTTGTGGG - Intergenic
1054994707 9:71372614-71372636 GCTTTTTACCATATGCTTGTGGG + Intronic
1055472409 9:76626111-76626133 CATTGTGACCAGATGCTTGCAGG + Intronic
1056127445 9:83549711-83549733 CATTTTTTTCATATGCTTGTTGG + Intergenic
1056847692 9:90055033-90055055 CAGCAATACCATTTGCTTGTTGG - Intergenic
1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG + Intronic
1058505360 9:105660930-105660952 CAGTGGAACCATATGCATGGTGG - Intergenic
1058526380 9:105863402-105863424 CATTTTTTTCATATGCTTGTTGG - Intergenic
1061157888 9:128876003-128876025 CAGTGTCACCACAGGCTTCTGGG - Intronic
1061563740 9:131423484-131423506 CAGTGGGGCCAGATGCTTGTGGG + Intronic
1061676795 9:132221828-132221850 CACTGTTACAATATGCTTCTTGG + Intronic
1061732923 9:132630592-132630614 CACTGTTCACATTTGCTTGTCGG - Intronic
1062683332 9:137796796-137796818 CTGTGTTTTCATCTGCTTGTTGG - Intronic
1186051971 X:5605997-5606019 CATTTTTTTCATATGCTTGTTGG - Intergenic
1187622013 X:21067044-21067066 AAGTCTTTCCATATACTTGTTGG + Intergenic
1187804107 X:23099422-23099444 CATTTTTTTCATATGCTTGTTGG - Intergenic
1188036852 X:25328238-25328260 CACTATTACCATGTGCTTATTGG + Intergenic
1188738930 X:33753310-33753332 CATTTTTTTCATATGCTTGTTGG + Intergenic
1188888323 X:35578377-35578399 CATTTTTTGCATATGCTTGTTGG - Intergenic
1189652550 X:43205745-43205767 CATTTTTATCATATGATTGTTGG + Intergenic
1190155693 X:47990719-47990741 CACTGATAATATATGCTTGTGGG + Intronic
1190437900 X:50445052-50445074 CATTTTTCTCATATGCTTGTAGG + Intronic
1190440002 X:50468040-50468062 CAGTGTTGCCAGATGTCTGTGGG + Intronic
1190485104 X:50916226-50916248 CTGAGATACCATCTGCTTGTCGG - Exonic
1191763748 X:64672894-64672916 CATTTTTTTCATATGCTTGTTGG - Intergenic
1192531014 X:71885674-71885696 CATTTTTTTCATATGCTTGTTGG + Intergenic
1193629930 X:83872151-83872173 CCATATTACCATTTGCTTGTTGG + Intronic
1194060966 X:89197397-89197419 CATTTTTTTCATATGCTTGTTGG - Intergenic
1194544889 X:95220980-95221002 GCGTTTAACCATATGCTTGTTGG - Intergenic
1194602248 X:95936473-95936495 GAATTTTTCCATATGCTTGTTGG + Intergenic
1195156737 X:102130871-102130893 CAGTGTTGTCAGATGCTGGTGGG + Intergenic
1195838677 X:109148650-109148672 CATTTTTTCCATATGCTTGTTGG - Intergenic
1197120509 X:122885506-122885528 CATTTTTTCCATATGCTTGTTGG - Intergenic
1197611662 X:128645858-128645880 GCGTTTTTCCATATGCTTGTTGG + Intergenic
1198560122 X:137840556-137840578 CAGTGTTGCCATATGTTTTCAGG + Intergenic
1198884236 X:141316352-141316374 GATTGTTTACATATGCTTGTTGG + Intergenic
1199313600 X:146350154-146350176 CAGAGTTACCATTTGCATGGTGG + Intergenic
1199357603 X:146880048-146880070 TAGTGTGACCATTTGCTTGAGGG - Intergenic
1199654014 X:149976671-149976693 CAGTATTACCATTTGGGTGTAGG - Intergenic
1201983568 Y:19935284-19935306 CATTTTTTTCATATGCTTGTTGG - Intergenic