ID: 955621622

View in Genome Browser
Species Human (GRCh38)
Location 3:60870478-60870500
Sequence AAAGAGATGCAGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1128
Summary {0: 1, 1: 1, 2: 22, 3: 145, 4: 959}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955621612_955621622 20 Left 955621612 3:60870435-60870457 CCTTCAAGTATTCTAATGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG 0: 1
1: 1
2: 22
3: 145
4: 959

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955621622 Original CRISPR AAAGAGATGCAGGAGGTGGA AGG Intronic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900902277 1:5525175-5525197 GCAGAGATTCAGGAGGTGGCTGG + Intergenic
900974902 1:6010878-6010900 AATGAGTGGCAGGAGGTGCATGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901107495 1:6768548-6768570 ACAGAAATGCAGGAGCTTGAAGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902057255 1:13611629-13611651 AAAGGGGTTCAGGAGGTGGATGG + Intronic
902314299 1:15606261-15606283 TAAGAGAGGCAGGGGGTGGTGGG + Intergenic
902570198 1:17342220-17342242 AAACAGCTGCAGGAAGTGGTAGG + Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
903798755 1:25950785-25950807 AAAGAAATTCAGCAGGTGGTTGG - Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904357045 1:29947022-29947044 AAAGAGAAGGAGGAGGAGGTTGG - Intergenic
904595184 1:31639751-31639773 AAAGAGATGGAGGAGGAGTGAGG + Intronic
904632575 1:31853864-31853886 ATAGAGATGGAGGAGGAGAAAGG - Intergenic
905407706 1:37746949-37746971 CAAGAGCTAGAGGAGGTGGATGG + Intronic
905566260 1:38967511-38967533 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
905892478 1:41526046-41526068 ACAGAGGGGCAGGAGGTGGCTGG + Intronic
905942920 1:41878686-41878708 AAAGAGAGGGAGGAGGAGGGAGG - Intronic
906018886 1:42609114-42609136 GAAGAGGTGGAGAAGGTGGAAGG - Intronic
906105761 1:43291191-43291213 ATAGAGAAACAGGAGGTGGTGGG + Intergenic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906191961 1:43904724-43904746 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192324 1:43906042-43906064 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906321743 1:44821543-44821565 AAAGCCATGCAGCAGGTGGAAGG - Intronic
906668095 1:47635818-47635840 GAAGAGAAGGAGGAGGAGGATGG - Intergenic
906672724 1:47668461-47668483 TGAGAGAAGGAGGAGGTGGAGGG + Intergenic
907489842 1:54801736-54801758 AAAGAGAGGAGGGAGGTGGCAGG - Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907933308 1:59019777-59019799 CAAGAGATGCAGGGAGTGGCAGG + Intergenic
908180719 1:61602510-61602532 AAAGAGAAACAGGCGGTGGGGGG + Intergenic
908450198 1:64247106-64247128 AAAGAGATGTAAGAGGAGGTAGG - Intronic
908931081 1:69316313-69316335 AAGGAGATGCAGGGGGTGTTCGG + Intergenic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561873 1:77016301-77016323 GAAGAGTTTCAGGAGGAGGAGGG - Intronic
909979815 1:82085363-82085385 GAAGAGGTGGAGAAGGTGGAGGG + Intergenic
911440445 1:97920493-97920515 AACGACATACAGGAGGTGAAGGG + Intronic
911724873 1:101232736-101232758 TAAAAGATGGAGGTGGTGGATGG + Intergenic
911781522 1:101885518-101885540 GAAGAGGTGAAGGAGATGGAAGG - Intronic
911991270 1:104699679-104699701 CAAAAGGTGGAGGAGGTGGAAGG - Intergenic
912585091 1:110755474-110755496 AAAAAGATGAGGGAGTTGGAAGG - Intergenic
912664727 1:111568758-111568780 GAAGAGATGGAGGAAGTGGAAGG - Intronic
912913154 1:113783697-113783719 AAAGAGAAAAAGGAAGTGGAGGG - Intronic
913332159 1:117676704-117676726 AACCAGATGCCGGAGGTGGAAGG + Intergenic
913494398 1:119415040-119415062 AAAGGGATTCTGGAGGAGGAGGG + Exonic
913515365 1:119600966-119600988 AAAGGGATGCTGGAGGAGGCAGG + Intergenic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914952672 1:152130782-152130804 AAAGGGATCCAGGAGGTAGTAGG + Intergenic
914956322 1:152165886-152165908 AAACAGAAACAGGAAGTGGAGGG - Intergenic
915016493 1:152738753-152738775 AGAGAGCAGCAGGAGGTGGGAGG + Intronic
915107981 1:153546137-153546159 AAGGAGATGCAGGGGGTGGTGGG + Intronic
915154611 1:153864640-153864662 AAAGAGATGAAAGAGAGGGAGGG + Intronic
915997725 1:160581181-160581203 GAAGAGATAGAGGAGGTTGAAGG + Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916464790 1:165062918-165062940 AAAGAGGTTCAGGAGGAGAAAGG + Intergenic
916523515 1:165587684-165587706 CAAGAAATGCAGCAGGTGGTGGG + Intergenic
916560210 1:165928601-165928623 AAAGATATCCAGGAGGGAGAGGG - Intergenic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
917198605 1:172492596-172492618 AAGGAGATTCAAGAGTTGGAAGG + Intergenic
917274046 1:173311728-173311750 GGAGAGATGCTGGAGGAGGAAGG - Intergenic
917352453 1:174092235-174092257 AAACTGATGCAGGAGGGTGAAGG + Intergenic
918179498 1:182074124-182074146 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
918319879 1:183354257-183354279 AAAGAGATGAGAGAGGAGGAAGG + Intronic
918621907 1:186614909-186614931 AAAAAGAAACAGGAGGTGGAAGG + Intergenic
919567459 1:199206853-199206875 GCAGAGATGCAGAAGATGGAAGG + Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919773687 1:201179422-201179444 AAAGTGGTGTTGGAGGTGGAGGG - Intergenic
919829306 1:201529170-201529192 AAAGAGAGGCGGGAGGGAGAGGG - Intergenic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920704112 1:208239498-208239520 AAAGAAAACCAGCAGGTGGATGG - Intronic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921320702 1:213935567-213935589 AAAGAGAAGAAGGTGGTAGAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921409134 1:214815682-214815704 AAAGAGTTGAGGGAGGAGGATGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921590311 1:216995149-216995171 CAAGAGATGAAGGAGGGGCAGGG - Intronic
922854666 1:228764317-228764339 GAAGAGGTGATGGAGGTGGAAGG + Intergenic
922862979 1:228835227-228835249 AAAGAGAGGGAGGAGGTGTCAGG + Intergenic
922905069 1:229168103-229168125 AAAGAAGTGGAGGAGGTGGAAGG + Intergenic
922918434 1:229278222-229278244 AAAAAGAAGGACGAGGTGGAAGG - Intronic
923290760 1:232543403-232543425 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
923330403 1:232918480-232918502 GAAGAGGTGAAGCAGGTGGAAGG + Intergenic
923378444 1:233390353-233390375 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
923850543 1:237789742-237789764 AAAGAGATGCAGGAAAAGGGAGG - Intronic
924366852 1:243303450-243303472 GAAGAGATGCAGGAGTTAGGAGG - Intronic
924754956 1:246932127-246932149 AAAGAGAAGCAGGGCCTGGAAGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063050949 10:2446787-2446809 AAGGAGATGCCTGAGGTGCAAGG + Intergenic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063288481 10:4715332-4715354 AAAAATGTGTAGGAGGTGGATGG - Intergenic
1063343111 10:5286934-5286956 GAAGAGGTGAAGGAGGGGGAAGG - Intergenic
1063488200 10:6439522-6439544 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
1063997051 10:11629278-11629300 AAAGAGATGGAGGAAGAGGAAGG - Intergenic
1064002297 10:11673741-11673763 TAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1064312879 10:14227215-14227237 GAAGAGAAGGAGGAGGAGGAAGG - Intronic
1065134337 10:22653325-22653347 AAAGAGGTGGAGGAGAAGGAAGG - Intronic
1065480724 10:26191374-26191396 GAATAGATGGAGGAGGTGGAGGG - Intronic
1065858619 10:29851303-29851325 AAAGAGAGACAGGAGTTAGATGG + Intergenic
1066129750 10:32381354-32381376 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
1066206168 10:33191306-33191328 AAAGTAAGGCAGGAGGTGGTGGG + Intronic
1066268961 10:33803367-33803389 CTAGAGATGGAGGAGATGGAAGG + Intergenic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1066453041 10:35548728-35548750 AAAGAGGTGGAGAAGGTGGAAGG + Intronic
1067146869 10:43700710-43700732 AAAGACATGAAGGAGGAGAATGG - Intergenic
1067343132 10:45419928-45419950 AAAGAGAGGCCGGAAGAGGAGGG + Intronic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067558168 10:47286651-47286673 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1067825331 10:49568029-49568051 GAAGAGGTGGAGGAGGTAGAAGG + Intergenic
1068190171 10:53641527-53641549 GAAGAGGTGAAAGAGGTGGAAGG + Intergenic
1068522052 10:58087655-58087677 GCAGAGATGGAGGATGTGGAAGG - Intergenic
1068824553 10:61420355-61420377 GAAGAGGTGGAGGAGGTGAAAGG + Intronic
1068896977 10:62215364-62215386 AAATAAAGGCAGGAGGTGAAGGG + Intronic
1069357787 10:67607521-67607543 GAAGAGATGGAGGAGGTGGAAGG + Intronic
1069377562 10:67809269-67809291 AAAGAGACCCAGGGTGTGGATGG - Intronic
1069405718 10:68095816-68095838 AAAAAGATTCTGGAGGTGGGTGG + Intergenic
1069551423 10:69367071-69367093 GAAGTGTTGCAGGAGGTGGGAGG + Intronic
1069733272 10:70633330-70633352 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1069841299 10:71341080-71341102 AATGAGAGGCAGGAGCTGGAAGG - Intronic
1071152233 10:82649245-82649267 AAGGGGAGGCAGGAGGTAGAGGG - Intronic
1071237707 10:83668364-83668386 AAAGAGTGGAAGGATGTGGAAGG - Intergenic
1071603897 10:86971707-86971729 AAAGACATGGAGCGGGTGGACGG - Intronic
1072532280 10:96330796-96330818 AGAGTGATGCAGGAGGGGCAGGG - Intronic
1072741343 10:97911806-97911828 TAAGAGATGGAGGAGAGGGAGGG - Intronic
1073161369 10:101399278-101399300 AAAAAGATGGAGGAGGAGAAGGG + Intronic
1073597804 10:104817635-104817657 GGAGAGAAGGAGGAGGTGGAGGG - Intronic
1073687007 10:105765819-105765841 AGAGAGATGCAGGAGGAGTCAGG - Intergenic
1073791211 10:106942288-106942310 AAAGGGAAGCCGGAGGTGGGAGG - Intronic
1073956196 10:108874288-108874310 ATAGAGGTGCTGGAGGGGGAGGG - Intergenic
1074049261 10:109867489-109867511 AAAGCTAAGCAGGAAGTGGATGG + Intronic
1074253452 10:111777007-111777029 GAAGAGATACAGGAAGTGGCTGG + Intergenic
1074302314 10:112243521-112243543 AAAGAGGTGCAGGAGGGAGGTGG - Intergenic
1074532071 10:114305015-114305037 ACACAGATGCAGGAGGGGGCGGG + Intronic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1074945862 10:118280010-118280032 AAGGAGAATAAGGAGGTGGAAGG - Intergenic
1074947097 10:118290837-118290859 CAAGAGATTGAGTAGGTGGAAGG + Intergenic
1075083267 10:119397704-119397726 CAAGAGGTGCAGGAGGTTGAGGG - Intronic
1075118850 10:119649882-119649904 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075300699 10:121321307-121321329 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
1075404863 10:122188009-122188031 AAAGGCAGGCAGGATGTGGAAGG - Intronic
1075470717 10:122687388-122687410 AGAGAGAGGCAGGGGGTGGGGGG + Intergenic
1076035688 10:127196724-127196746 GAAGAGGAGGAGGAGGTGGAAGG + Intronic
1076036906 10:127206616-127206638 AATGCCATCCAGGAGGTGGAGGG - Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076192562 10:128492968-128492990 AAAGAGATGAAAAAGGTGGAGGG + Intergenic
1076287382 10:129313400-129313422 GAAGAGGTGGAGGACGTGGATGG + Intergenic
1076574224 10:131453357-131453379 GCAGAGAGGCGGGAGGTGGATGG + Intergenic
1077150069 11:1069007-1069029 AAAAATATTCAGGAGGTTGAGGG + Intergenic
1077165874 11:1138047-1138069 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
1077392575 11:2306919-2306941 GAGGAGATGGAGGAGGGGGAAGG + Intronic
1077492420 11:2867903-2867925 AAATAGATACAGGGGGTGGGGGG - Intergenic
1077552803 11:3208918-3208940 AAATAGATGCTGGATCTGGAGGG - Intergenic
1078373558 11:10773251-10773273 AAAGAGGTGGTGGTGGTGGACGG + Exonic
1078461988 11:11521144-11521166 AAAGAGAGCCAGGAGGTGGTGGG - Intronic
1078462275 11:11523253-11523275 AAAGAGATGCTGTACTTGGAGGG - Intronic
1078477851 11:11648059-11648081 GAAGAGATGTAGGAGGTAGAAGG - Intergenic
1078492502 11:11782603-11782625 TAAGAAATGCAGGAGGCAGAAGG + Intergenic
1078836130 11:15031814-15031836 GAAGAGGTGGAGTAGGTGGAAGG - Intronic
1078945920 11:16068658-16068680 AAAAATATGCAGGAGGGGCAAGG - Intronic
1079127280 11:17726654-17726676 AAAAAGGAGCAAGAGGTGGAAGG + Intergenic
1079230838 11:18647433-18647455 AAAGTGGTGCAGGATATGGAAGG - Intergenic
1079505954 11:21152156-21152178 AATGGAATGCAGGGGGTGGAGGG + Intronic
1080232393 11:30032560-30032582 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080312786 11:30913573-30913595 AAAGAGAGGCAGTTAGTGGAAGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080517179 11:33035281-33035303 ACAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081279716 11:41193976-41193998 GAAGAGATGGAGGAGATGGAAGG - Intronic
1081337639 11:41886516-41886538 AAAGAAATGCAATAGGTGGGTGG + Intergenic
1081494815 11:43597929-43597951 AAAGAAAAGCAGGAGGGGGCTGG - Intronic
1082771564 11:57211567-57211589 GAAGAGGTGGAGGAGATGGAAGG - Intergenic
1083430244 11:62610690-62610712 ACTGAGATGGAGGAGGTCGAGGG + Intronic
1083827584 11:65212090-65212112 AAGGAGATGGAGGGGTTGGAGGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084903996 11:72331985-72332007 ATAGCGATGTGGGAGGTGGAGGG + Intronic
1085073946 11:73573059-73573081 AAAGAGGTGCAGATGGTGGCTGG - Intronic
1085246324 11:75104596-75104618 AAGGGGATGCAATAGGTGGAAGG + Intronic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1085871887 11:80359822-80359844 TAGGAGGTGGAGGAGGTGGAAGG + Intergenic
1086249682 11:84798394-84798416 AAAGAGAGGAAAGAGGGGGAAGG - Intronic
1086266322 11:85002773-85002795 GAAGAGATAGAGGAGGTGAAAGG - Intronic
1086952606 11:92906290-92906312 AAAGAAGTAGAGGAGGTGGAAGG + Intergenic
1087005886 11:93470988-93471010 GAAGAGTTGCAGGGGCTGGATGG - Intergenic
1087026992 11:93659917-93659939 AAAGGGATGGAGTAGGAGGAAGG - Intergenic
1087246987 11:95851009-95851031 AAGCATATTCAGGAGGTGGAAGG + Intronic
1087468979 11:98546760-98546782 AAAAAGATGCAGGAAGTGAAGGG + Intergenic
1088015267 11:105050728-105050750 GAAGAGATGGAGGAAGGGGATGG + Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088651634 11:111962490-111962512 AAAAAGAGGCAGGAGTTAGAAGG + Intronic
1088711646 11:112513816-112513838 AAAGAGAAGCAGGAGGCATAGGG + Intergenic
1088883065 11:113986777-113986799 AGACACATGCAGGAGGTGGGAGG - Exonic
1088919539 11:114251180-114251202 AAAGAGCTGGAGGAGGGGCAGGG - Intergenic
1089054242 11:115572364-115572386 AAAGAGGTCCAGTAGGTTGAAGG + Intergenic
1089360938 11:117885988-117886010 AAAGAGAGGCTGGACTTGGAGGG - Intergenic
1089609693 11:119662569-119662591 AAGGAGATGCAGGAGGAGACAGG + Exonic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090019125 11:123111528-123111550 AAAGAAATGCTGTAGTTGGATGG - Intronic
1090168731 11:124579429-124579451 GAAGAGGTGGAGGAGGGGGAAGG + Intergenic
1090267442 11:125362162-125362184 AAAAAGAGGCAGGAGGTGTAGGG - Intronic
1090382640 11:126337842-126337864 AAAGAGAGGTAGGAGGCTGAGGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090703558 11:129316582-129316604 CAAGAGAGGGAGGAGGTGAAGGG - Intergenic
1090854211 11:130598067-130598089 AAAGAGAGAGAGGAGGTGGGAGG + Intergenic
1090972153 11:131653267-131653289 TAAGAGAGACAGCAGGTGGAGGG - Intronic
1091268532 11:134289375-134289397 GAAGAGGTGGAGGAGGTGGCAGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091969429 12:4773202-4773224 AAAGAGATTCTGGAGGCTGAGGG + Intronic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092622598 12:10288991-10289013 AAAGAGACACAGGAGGTAAAAGG - Intergenic
1092746500 12:11677271-11677293 AGAGAGAGGCAGGAGGAGGGAGG - Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1093613187 12:21188207-21188229 GAAGAGGTGGAGGAGGTAGAGGG - Intronic
1093870185 12:24281742-24281764 AAAGTGAAGCATGAGGGGGATGG + Intergenic
1093993250 12:25613828-25613850 AAAGAGATGGATGATGTGGGAGG + Intronic
1094167815 12:27460630-27460652 GAAGAGGTGGAGGACGTGGAAGG + Intergenic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094272597 12:28633526-28633548 GAAGAGATGGAGGAGGTAGAAGG + Intergenic
1094293419 12:28877273-28877295 AAGGAGATGGAGGAGAAGGAAGG - Intergenic
1094528650 12:31251071-31251093 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1094583230 12:31753825-31753847 AGAGAGAAAAAGGAGGTGGAAGG + Intergenic
1095716975 12:45356717-45356739 AAAGAGGTGGAGGAAGTGGAAGG + Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078635 12:48819503-48819525 GCAGAGATGGAGGGGGTGGAAGG - Intronic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096869849 12:54586486-54586508 ACAGAGTGGCAGGCGGTGGAGGG - Intronic
1097452943 12:59757674-59757696 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
1098012749 12:66071758-66071780 CAAGAGAAGCAAGAAGTGGAGGG - Intergenic
1098214932 12:68205631-68205653 AAAGAGGTGGAGGAAGTGGAAGG + Intronic
1098815336 12:75153929-75153951 GAAAAGGTGGAGGAGGTGGAAGG + Intronic
1100627184 12:96347265-96347287 AAAGAAATACAGGACGTGGCTGG + Intronic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1100939141 12:99706281-99706303 AAAGAGATGAAGGTGTTGGGAGG + Intronic
1100990189 12:100243623-100243645 AAAGAGATGCTGGTGGAGGCAGG - Intronic
1101032856 12:100677187-100677209 AAAGACATGAAGGAGGTGAAGGG - Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1101353226 12:103952821-103952843 AAAGACATGGAGGAGGATGAGGG + Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101883938 12:108645359-108645381 AAAGAGAAGCAGGAGGGCAAGGG - Exonic
1101931253 12:109015912-109015934 AAAGAGGAGCAGGTGGAGGACGG + Intronic
1102398600 12:112609488-112609510 AACAATAGGCAGGAGGTGGAAGG - Intronic
1102596457 12:113996508-113996530 GAAGATATTCAGGAGGTGGGGGG - Intergenic
1103247722 12:119472420-119472442 AAATGGGTGCAGGAGGTGGTTGG - Intronic
1103282448 12:119771272-119771294 AAAGTGCTGCAGGAGGTTGCAGG + Intronic
1103507417 12:121451114-121451136 GAAGAGATGGAGGAGGTAGAAGG - Intronic
1103609949 12:122117231-122117253 CAAGAGATCCACGAGGAGGATGG + Intronic
1103966094 12:124640664-124640686 CATGAGACGTAGGAGGTGGATGG - Intergenic
1104069567 12:125332494-125332516 GAAGAAATGCAGTGGGTGGAGGG - Intronic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104726465 12:131078752-131078774 AAAGAACAGAAGGAGGTGGAGGG - Intronic
1104788233 12:131465305-131465327 TGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1105040923 12:132960583-132960605 AAAGAGATGCAGAAGCAGAAGGG - Intergenic
1106129007 13:26924020-26924042 AAAGTGATCCAAGAGGTGGCTGG + Intergenic
1106220009 13:27738629-27738651 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1107031669 13:35860303-35860325 AAAAAAATGCAGGGGGTGGGGGG + Intronic
1107053883 13:36082145-36082167 GAAGAGGTGGAGGAGGTGAAAGG - Intronic
1107135934 13:36944127-36944149 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1107143937 13:37036674-37036696 AAAGAGATAAAGAAGATGGAAGG - Intronic
1107457508 13:40568373-40568395 AAAGAGAGGAAGGAGGAGGGAGG - Intronic
1107497874 13:40946599-40946621 GAAGAGATGGAGGAAGTGGAAGG - Intronic
1107735923 13:43398627-43398649 GAAGAAATGAAGGAGATGGAAGG - Intronic
1108253993 13:48593400-48593422 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1108270946 13:48759021-48759043 CAAAAGATGCAAGAGATGGAAGG + Intergenic
1108711354 13:53035602-53035624 AAAGAGATGGAGGGTGAGGATGG - Intronic
1108781129 13:53835525-53835547 GCAGAGGTGGAGGAGGTGGAAGG - Intergenic
1108821751 13:54359324-54359346 AATGGGAGGTAGGAGGTGGAAGG - Intergenic
1108908707 13:55514583-55514605 GAAGAGGTGGAAGAGGTGGAAGG + Intergenic
1109464847 13:62716832-62716854 GAAGAGATGGAGGAGGTGATAGG - Intergenic
1110100957 13:71601188-71601210 AAAGAGATCGAAGAGGTGCAAGG - Intronic
1110268739 13:73569277-73569299 GAAGAGGTGGAGGAGGTGAAAGG + Intergenic
1110398879 13:75066291-75066313 AAAGAGATGGAGGATGGGCATGG + Intergenic
1110519229 13:76455827-76455849 GAAGAGAAGCAGGAGAGGGAGGG + Intergenic
1110524985 13:76525582-76525604 AAAGACATGGGGGAGGTAGAAGG - Intergenic
1110529289 13:76577746-76577768 AGAGAGAAGGAGGAGGTGCAAGG - Intergenic
1110704723 13:78592546-78592568 AGAGAGATGGGGGAGGAGGAGGG - Intergenic
1110832845 13:80051554-80051576 AAAGGGAAGCAGGAGGTGAGAGG - Intergenic
1110929634 13:81198955-81198977 AAAGAGGTGAAGGAGGAGCAGGG - Intergenic
1111495569 13:89044743-89044765 GAAGAAGTGGAGGAGGTGGAAGG + Intergenic
1111743022 13:92228140-92228162 TAAGAGATGGAGAAGATGGAAGG + Intronic
1112067322 13:95807328-95807350 GAAGAGGTGGAGGAGGTAGAAGG + Intronic
1112160441 13:96861373-96861395 GAAGAGGTAGAGGAGGTGGAAGG - Intergenic
1112359918 13:98708134-98708156 AAAGAGAGGGAGGAAGTGGTGGG + Intronic
1112542269 13:100326615-100326637 GGAGAGGTGGAGGAGGTGGAAGG - Intronic
1112839121 13:103553677-103553699 GAAGAGATGGAGGAGGTAGAAGG - Intergenic
1112957102 13:105073387-105073409 TAATAGATGCAGGAGGCAGATGG - Intergenic
1113088404 13:106592180-106592202 AAAGAGGTGGAGGAGGTAGAAGG - Intergenic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113180089 13:107615070-107615092 AAAGAGATGCAGGATGTGCGAGG - Intronic
1113221425 13:108107978-108108000 AAAGAAAGGAAGGAGGAGGAGGG + Intergenic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113356191 13:109582694-109582716 AAGGAGATGCAGAAGGTGTTTGG + Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114366462 14:22032459-22032481 AAAGAGATGAGAGAGGGGGAAGG - Intergenic
1114673567 14:24427550-24427572 GAACAGATGCAGCAGGTGGCTGG + Exonic
1114913999 14:27239100-27239122 AAAGAAATGCAAGAGGGGCAAGG + Intergenic
1115113125 14:29848252-29848274 AAAAAGATGCAAAAGGTGGATGG + Intronic
1115253475 14:31373786-31373808 GAAGAGGTGGAGCAGGTGGAAGG - Intronic
1115488105 14:33932114-33932136 ATAGGGATGCAGTAGGTGCAAGG + Intronic
1115955566 14:38775282-38775304 ACAGAAATGCTGGAGGAGGAGGG - Intergenic
1116520124 14:45836196-45836218 GAAGATGTGGAGGAGGTGGAAGG + Intergenic
1117035699 14:51726415-51726437 AAAGAAAGGCAGGAGGAGGGAGG - Intronic
1117432582 14:55683326-55683348 AAAGAGATGAAGCAGGTGGAGGG - Intronic
1117555241 14:56877035-56877057 TGGGAGATGCAGGGGGTGGAAGG + Intergenic
1117623492 14:57611730-57611752 GAAGAGGTGAAGGAGGTGGAAGG + Intronic
1117762021 14:59039069-59039091 AAAGGGGTGCAGGAATTGGAAGG + Intergenic
1117859264 14:60073171-60073193 AAAGAAAAGCAGGGGGTGGCTGG + Intergenic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118614793 14:67567896-67567918 AAACAGATCCAGAAGGTGCAGGG + Intronic
1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG + Intronic
1118773734 14:68960175-68960197 GAAGAGGTGGAGGAGGAGGAAGG + Intronic
1118832246 14:69445238-69445260 GAAGAGGTGAAGGAGGTGGAAGG - Intronic
1119019302 14:71093720-71093742 TCAGAGGTGGAGGAGGTGGAAGG - Intronic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119092392 14:71796792-71796814 GAAGAGGTGGAGGAGGTAGATGG - Intergenic
1119636727 14:76279381-76279403 AAAGAGTGGAAGGAGGGGGATGG - Intergenic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1119961395 14:78860848-78860870 GAAGATATGGAGGAGGTGGAAGG + Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1119970455 14:78964454-78964476 AAAGAGAAACAGGAGGTGTTAGG + Intronic
1120147405 14:80993987-80994009 GAAGAGATGGAGGATGTGCAAGG - Intronic
1120391602 14:83915654-83915676 AAAGACATGCAGTAGGTAGTTGG - Intergenic
1120464439 14:84838764-84838786 AAAGAGAAGCAGCATGTGGTTGG + Intergenic
1120831443 14:89000897-89000919 AAAGAAATGAAGGAGTAGGAGGG - Intergenic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121914473 14:97824093-97824115 GAAGCGGTGCAGGAGGTGGAAGG + Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1123953477 15:25308937-25308959 AAAGAGGTGGAGGTGGAGGAAGG - Intergenic
1124007454 15:25806158-25806180 AGAGAGGTGGAGGAGGTGGAAGG - Intronic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1125978889 15:43981478-43981500 GAAGAGGTAGAGGAGGTGGAAGG + Intronic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1126860424 15:52877573-52877595 AGAGAGATGGAGGAAGGGGAGGG - Intergenic
1127587526 15:60393005-60393027 ATAAAGATGCAGTAGGTGGGTGG - Intronic
1127782028 15:62325436-62325458 AGAGAGAGGAAGGAGGAGGAGGG + Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1129229174 15:74187217-74187239 AGAGAGAGGTAGGAGGTAGATGG - Intronic
1130093997 15:80842749-80842771 AGAGAAATCCAGGATGTGGAGGG + Intronic
1130630073 15:85558940-85558962 AAAGGGAGGGAGGAGGAGGAGGG - Intronic
1131077838 15:89507231-89507253 AAAGATGTGGGGGAGGTGGAAGG - Intergenic
1131407219 15:92175343-92175365 CATGGGATGCAGGAAGTGGAGGG - Intergenic
1131537974 15:93253446-93253468 AATTGGATTCAGGAGGTGGAGGG - Intergenic
1131951222 15:97683707-97683729 AAAGAGAAGGGGGAGGGGGAGGG + Intergenic
1133218055 16:4305393-4305415 AAAGGGATTTAGGAGGTGGGTGG + Intergenic
1133404097 16:5509371-5509393 AAAGAGATGTCGGTGGTGGAGGG - Intergenic
1133488972 16:6248661-6248683 AAAAAGATGCATGTGATGGAGGG + Intronic
1133748619 16:8707021-8707043 AAAGAGATGCAGGCAGAGGTGGG + Intronic
1133821373 16:9239704-9239726 AAAGAAATGCAGGAGGAGAAGGG - Intergenic
1133993443 16:10728553-10728575 AGAGGGATGCATGAGGTGCAGGG + Intergenic
1134171917 16:11976109-11976131 AAGGAGATTGAGGAGGTGGAGGG - Intronic
1134692083 16:16197673-16197695 GGAGAGATGCAGGAGGAGGGAGG + Intronic
1134862237 16:17570677-17570699 GAAGAGGTGGAGGAGATGGAAGG - Intergenic
1135517170 16:23145752-23145774 ACAGTGATTCCGGAGGTGGATGG - Intronic
1135628993 16:24021370-24021392 AGAGAGATGGAGGAGGGGGGAGG - Intronic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1135975473 16:27106462-27106484 ACAGAGATGCAAGAGGCGGGTGG - Intergenic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136068225 16:27772636-27772658 AAAGGGATGGAGGAGGTTGCAGG + Intronic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1137854060 16:51775815-51775837 GAAGAGAAGGAGGAGGTGGGAGG - Intergenic
1137989533 16:53139636-53139658 AAAGAGGTGCTGGAGGTGACTGG + Intronic
1138089842 16:54165139-54165161 AAGGACACACAGGAGGTGGAGGG - Intergenic
1138173539 16:54875491-54875513 AGAGCCATGCAGGAGATGGAAGG - Intergenic
1138217369 16:55215950-55215972 AAAGATATGCAGTCGGAGGAAGG - Intergenic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138630808 16:58292987-58293009 AGAGAGCTGCAGGAGGCTGAGGG + Intronic
1138701431 16:58867426-58867448 AAAAAGATTCAGGAGGTTAATGG + Intergenic
1138758082 16:59513050-59513072 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1138857288 16:60709699-60709721 GAAGAGGTGGAGGAAGTGGAAGG + Intergenic
1139349033 16:66323679-66323701 AAAGAGAAGCAGGGGAGGGAGGG - Intergenic
1139748529 16:69094032-69094054 ACAGAGCTGCAGGAGGCTGAGGG + Intergenic
1140018683 16:71215257-71215279 AAAGGGAGGAAGGAGGGGGAAGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140223354 16:73059172-73059194 AAAGAAAAGGGGGAGGTGGAGGG + Intronic
1140258061 16:73353747-73353769 AAAAAGAGGCAGGAGGAGAAAGG + Intergenic
1140502290 16:75444143-75444165 AAAGAAATGCAAGAGAGGGAGGG - Intronic
1140724440 16:77799333-77799355 AAAGAGATGGAGAAAGTGGGAGG - Intronic
1140754688 16:78056701-78056723 AATGAGCTGCAGGAGGTGGGAGG - Intronic
1140893998 16:79309070-79309092 AGAGAGAGGTGGGAGGTGGAAGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141186470 16:81791109-81791131 AGAGAGAGGGAGGAGGAGGATGG + Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141231893 16:82175497-82175519 ATAGAGATGGAAGATGTGGAAGG + Intergenic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1141920390 16:87131924-87131946 ACAGTGAAGCAGGAGGTGCAGGG + Intronic
1142480145 17:214003-214025 AATGAGATGGAGGAGCTGGTGGG + Intronic
1142767249 17:2071786-2071808 AAAGAGTGGCAGGCGGAGGAGGG + Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143232591 17:5369667-5369689 AAAAAGATGCAAGGGGTCGAAGG - Intronic
1143275226 17:5705384-5705406 AAGAAGACGCAGGAGGTGGCAGG - Intergenic
1143280910 17:5753483-5753505 AGAGAGATGGAGGAGGAAGAGGG - Intergenic
1143443528 17:6994165-6994187 AAACAAAAGCAGGAGGGGGAAGG + Intronic
1143663045 17:8339064-8339086 AAAGGGAGGCAGAAGCTGGAGGG + Intergenic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144288469 17:13802711-13802733 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1144554190 17:16267347-16267369 GAAGAGGTGGAGGAAGTGGATGG + Intronic
1144554199 17:16267377-16267399 GAAGAGGTGGAGGAAGTGGATGG + Intronic
1144811177 17:17999895-17999917 ACAGAGATACAGGAGTAGGAGGG - Intronic
1144837814 17:18166411-18166433 TCAGAGATGGAGCAGGTGGACGG + Exonic
1145235554 17:21205639-21205661 AAAGGAATCCTGGAGGTGGATGG - Intronic
1145857616 17:28177163-28177185 AAAGTGGTGGAGGAGGTGGAAGG + Intronic
1145923895 17:28631737-28631759 ACAGAGATGGAGGAGGGGAATGG + Intronic
1146117213 17:30151628-30151650 GAAGAGGTGGAGGAGGTGAAAGG + Intronic
1146552368 17:33792346-33792368 AAAGAGAAGCCGGGAGTGGAGGG - Intronic
1146586720 17:34089171-34089193 AAATAAATGGAGGAGGAGGATGG - Intronic
1146846920 17:36187965-36187987 AGAGAGAAGCAGGACTTGGAGGG - Intronic
1147042789 17:37731177-37731199 CCAGAGATGGAGGAGGTGGCCGG + Intronic
1147369960 17:39985562-39985584 AAGGAAATGCAGGTGCTGGAAGG - Intronic
1147777278 17:42911257-42911279 AAAGACGTGCAGGAGGACGAGGG - Exonic
1148038245 17:44685191-44685213 AAAGAATTGGGGGAGGTGGATGG - Intronic
1148114708 17:45168990-45169012 AAAGAGAGGGAGGAGGAAGAAGG - Intronic
1148126652 17:45240920-45240942 CCAGTGATGCGGGAGGTGGAGGG - Intronic
1148239863 17:45993164-45993186 AAAGACACGCAGCAGGTGGTGGG - Intronic
1148448731 17:47759163-47759185 GAAGAGTTGGAGGAGGTGGAAGG + Intergenic
1148521018 17:48275016-48275038 AAAGAGTTGGTGGAGGAGGAGGG - Intronic
1149717463 17:58806613-58806635 AGAGAGAGGGATGAGGTGGAAGG + Intronic
1149819866 17:59765750-59765772 AAGGAGGTGGAGGAGGTAGATGG + Intronic
1149926358 17:60705958-60705980 GAGGAGATGGAGGAGGTGGAAGG - Intronic
1149984963 17:61340322-61340344 ACACAGATGCAGGGGGTGGGTGG + Intronic
1150121909 17:62610724-62610746 TAAGAGAGGCAGGAGGGTGAGGG + Intronic
1150489237 17:65563006-65563028 AAAGAGATCCAAGAAGTGAAAGG + Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150794406 17:68226428-68226450 AAAGAGACGCAGGGGCTGGGGGG - Intergenic
1150892381 17:69167929-69167951 AAAGAGGTGGAAGAGGTGGAAGG - Intronic
1151491141 17:74432770-74432792 ACCGAGAGGCAGGCGGTGGAGGG - Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1152774407 17:82191532-82191554 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
1152879926 17:82808830-82808852 GAAGGGATGAAGCAGGTGGAGGG + Intronic
1153141522 18:1977914-1977936 GAAGAGGTGGAGGAGGAGGAAGG - Intergenic
1153365056 18:4246633-4246655 AAAGAGATGCTGGGGATAGAGGG - Intronic
1153372491 18:4334758-4334780 AAACAGATGCAGGTGGAGGCAGG - Intronic
1155076765 18:22364250-22364272 GAAGAGGAGGAGGAGGTGGAAGG - Intergenic
1155940994 18:31801929-31801951 AAAGAGATGAAGGGAGTAGAGGG + Intergenic
1156598846 18:38579821-38579843 AAGGAGAAGGAGGAGGTAGAAGG + Intergenic
1156681748 18:39598319-39598341 GAAGAGGTGAAGGAGGTGGCAGG - Intergenic
1156854128 18:41762447-41762469 AGAGAGATGGCGGAGGGGGAGGG - Intergenic
1156957720 18:42988845-42988867 GCAGAGCTGCAAGAGGTGGATGG + Intronic
1157398782 18:47368277-47368299 GCAGAGATGGAGGAGGTAGAAGG + Intergenic
1157650097 18:49319532-49319554 AAAAAGATGAAGTAGGTGAATGG + Intronic
1157662603 18:49459450-49459472 CAAGAGAAGAACGAGGTGGAAGG - Intronic
1157799262 18:50605686-50605708 AACAAGAAGCAGGAGGTAGAGGG + Intronic
1158135295 18:54201345-54201367 GAAGAGATGGAGGTGGTGGTTGG + Intronic
1158357743 18:56639308-56639330 AAAGAGAAGCAGGGGTTAGATGG + Intronic
1158536888 18:58316259-58316281 AAAGAGAGGGAGCTGGTGGATGG - Intronic
1159021320 18:63145383-63145405 CAAGAGATCCAGGGGGTGGGGGG + Intronic
1159927385 18:74281455-74281477 AAAAGGAGACAGGAGGTGGAGGG + Intronic
1160006858 18:75074516-75074538 AAATAGTGGCAGGAAGTGGAAGG - Intergenic
1161284552 19:3462628-3462650 ACAGGGTTGCAGGAGGTGGGGGG + Intronic
1161727664 19:5939591-5939613 AAGGAGGTGCAGGCGGGGGAGGG + Intronic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1162000611 19:7742668-7742690 AAAGGGGTGCAGGAGGTGGTAGG + Exonic
1162839595 19:13346382-13346404 AAAGACATGAAGGAGATGAAGGG - Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1163160063 19:15458878-15458900 AAAGTGATGGATTAGGTGGAGGG - Intronic
1163164014 19:15483042-15483064 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
1163175232 19:15560070-15560092 CAAGAGATGCAGGAGAAGCAGGG - Intergenic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1164053227 19:21600672-21600694 AAAGAAAGGTAGGAGGGGGAGGG - Intergenic
1164515561 19:28932462-28932484 AAATAGAACCAGGAGATGGAGGG - Intergenic
1164542063 19:29128670-29128692 AAAGACATGGAGGGGGAGGATGG + Intergenic
1164654489 19:29910505-29910527 GGAGAGATGCAGGAGAGGGAGGG - Intergenic
1164858637 19:31544966-31544988 AAAGAGAAGGAGGAGGAGGGAGG - Intergenic
1164858645 19:31545018-31545040 AAAGAGAAGAAGGAGGAGGGAGG - Intergenic
1164868643 19:31625649-31625671 AAAGAGAAACATGAGGGGGAGGG - Intergenic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1165904524 19:39185548-39185570 AAAAAGATGCAGGGAGAGGAGGG - Intergenic
1166151907 19:40880982-40881004 AGAGAGATGGAGGAAGAGGATGG + Intronic
1166301702 19:41914972-41914994 ACAGAGATGCTGGAGGGGGAGGG - Intronic
1166309003 19:41951972-41951994 AGAGAGATTCAGGAGGTTGAAGG - Intergenic
1166404634 19:42511280-42511302 TAATAGAGGCAGGAGGCGGAAGG + Intronic
1166441931 19:42823049-42823071 AGAGAGATGTAGGACATGGAAGG + Intronic
1166508791 19:43389801-43389823 AGAGAGATGTAGGACATGGAAGG - Intergenic
1166960290 19:46492917-46492939 AAAGAGGAGGAGGAGGGGGAGGG - Exonic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167191308 19:47991808-47991830 GAAGAGAGGAAGGAGGAGGAGGG - Intronic
1167194126 19:48015295-48015317 GAAGCAATGGAGGAGGTGGAAGG + Intronic
1167508181 19:49882103-49882125 AAAGAGCTGCAGGTGGTGGAAGG - Exonic
1167648769 19:50718945-50718967 AAGGAGAAGCGGGAGCTGGAGGG + Intronic
1168307828 19:55445087-55445109 AAAGGGATGGAGGGGGTGGATGG + Intergenic
1168367373 19:55799997-55800019 AAAGGGATGAAGGGGGTGAAAGG + Intronic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168517051 19:57017483-57017505 AAAGAGGGGAGGGAGGTGGAGGG - Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925617117 2:5754213-5754235 AACGAGACACTGGAGGTGGAGGG + Intergenic
925651437 2:6093738-6093760 GAAGAGATGGAGGAGGTGAAAGG + Intergenic
925947638 2:8880404-8880426 GAACAGATGCGGGAGGAGGAAGG + Intronic
926209323 2:10857569-10857591 AAAGAGAGGGAGGAGGTGTTGGG - Intergenic
926544135 2:14217954-14217976 AAGGAGGTAGAGGAGGTGGAAGG + Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926989851 2:18666745-18666767 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
927187354 2:20491316-20491338 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
927482487 2:23465360-23465382 ACAGAGAGGCAGGAGGTGAGAGG - Intronic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927681079 2:25139437-25139459 ACAGAGGGGCAGGAAGTGGAGGG - Intronic
928636428 2:33251360-33251382 AAAGAGATGCTAGAGGAGGCTGG + Intronic
928822707 2:35381247-35381269 GAAGAGATGGAAGAGATGGAAGG + Intergenic
928831155 2:35485388-35485410 AACGAGATGAAGGATGTGGAAGG + Intergenic
928850635 2:35741087-35741109 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
929316467 2:40484869-40484891 AGAAGGATGCTGGAGGTGGAAGG + Intronic
929355852 2:41023426-41023448 GAAGAGGTGAAGGAGGTGAAAGG - Intergenic
929849838 2:45576065-45576087 GAAGTGGTGGAGGAGGTGGAAGG - Intronic
930073455 2:47388013-47388035 GAAGAGGTGGAGGAGGTAGAAGG + Intergenic
931014811 2:57964447-57964469 GAAGGGATGGAGGAGGTAGAAGG + Intronic
931320399 2:61170320-61170342 GAAGAGGTGGAGGAGGTAGAAGG - Intergenic
931321735 2:61179075-61179097 AACGAGTTGAAGCAGGTGGAAGG + Exonic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931638819 2:64363624-64363646 ACAGAGAAGGAGGAGGTGAAAGG - Intergenic
931740132 2:65234724-65234746 TAAGAGAAGCTGGAGGTGGCAGG - Intronic
932347482 2:71005115-71005137 ACAGAGATGACGGCGGTGGAGGG + Intergenic
932556352 2:72828213-72828235 AAACAGATGTAGGAGGGGTAGGG + Intergenic
932569805 2:72932638-72932660 GAACAGATGCTGGAGGAGGAGGG + Intronic
932954999 2:76341334-76341356 AAAAAGGTGGAGGAGGTGGAAGG + Intergenic
933902446 2:86859734-86859756 GCAGAGATGCAGGAGTTGGGAGG + Intronic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
933969688 2:87460345-87460367 GAAGAGAGGAAGGAAGTGGAGGG + Intergenic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934159479 2:89234830-89234852 AAGGAGATGAGGGAGGAGGAGGG - Intergenic
934207798 2:89947601-89947623 AAGGAGATGAGGGAGGAGGAGGG + Intergenic
935375121 2:102387810-102387832 AGAGAGATACATGAGATGGAGGG + Intronic
935803394 2:106722675-106722697 GAAGAGATGGAGGAGATGGAAGG + Intergenic
935867573 2:107407573-107407595 GAAAGGATGAAGGAGGTGGAAGG - Intergenic
935961383 2:108429130-108429152 AAAGAGATTAAAGAGGTGGCTGG + Intergenic
935976135 2:108580801-108580823 AGAGAGTTTCAGGAGGGGGATGG + Intronic
936066848 2:109339148-109339170 GAAGAGGTAGAGGAGGTGGACGG + Intronic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936379250 2:111969670-111969692 AAAGAAAGGCTGGAGGTGGTGGG - Intronic
936838584 2:116740582-116740604 AAAATTATGCTGGAGGTGGAAGG + Intergenic
937160845 2:119759828-119759850 GAAGAGATAGAGGAGGAGGAGGG + Exonic
937162360 2:119776574-119776596 GAAGAGGTGGAGGAAGTGGAAGG - Intronic
937670094 2:124529580-124529602 GAAGAGAGGCAGGAGTTAGAAGG + Intronic
937854008 2:126659862-126659884 CAGGAGGTGGAGGAGGTGGAGGG - Intronic
938317360 2:130339401-130339423 AAAGACCTGAAGGAGGTGTAAGG - Intronic
938776290 2:134544303-134544325 AAGGAGGTGCTGGAGATGGAGGG - Intronic
939031881 2:137086440-137086462 AGACAGAAGCAGGAGTTGGAGGG - Intronic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939911097 2:147984191-147984213 GAAGAGGTGGAGGAGGTAGAAGG - Intronic
940196645 2:151102711-151102733 AAATAGATGTAGGGTGTGGATGG - Intergenic
940261587 2:151785442-151785464 AGAAGGAGGCAGGAGGTGGAGGG + Intergenic
940750412 2:157621414-157621436 AAAAGGATGGAGGAGGTGGGTGG - Intronic
940945697 2:159615620-159615642 AAAGGGCAGCAGGAGGCGGACGG + Intronic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
941350645 2:164429840-164429862 AAATAACTGCAGGGGGTGGACGG + Intergenic
941795547 2:169595075-169595097 AATGAGCTGCATGAGGTGGTGGG - Intronic
942379267 2:175371383-175371405 AAGGAGATGAGGGAGGGGGAGGG - Intergenic
942550516 2:177111232-177111254 AAAGATTTCCAGGAGCTGGAAGG + Intergenic
943135876 2:183912532-183912554 AAAGAGAAGCAGGAGAAAGAAGG - Intergenic
943204458 2:184875401-184875423 AAAGAGAGGGAGGAGGTGCCAGG - Intronic
943357111 2:186870442-186870464 AAAGAGAAGGAGGAGGAGAAAGG - Intergenic
944627442 2:201585945-201585967 GAAGAGGTGGAGGAGGTAGAAGG - Intronic
944663957 2:201943905-201943927 GCAGAGATGGAGGAGGTGGAAGG + Intergenic
944900992 2:204215984-204216006 AAGAAGATGGAGGAGGTAGAAGG - Intergenic
945193565 2:207216118-207216140 AAAGGGAAGCAGGTGGTAGAAGG + Intergenic
945863011 2:215145148-215145170 AAAGAGAAGAAGGAAATGGAAGG - Intergenic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946334027 2:219025717-219025739 AAACAAATGCAGGAGCTGGAGGG + Intronic
947035625 2:225851127-225851149 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
947557087 2:231102707-231102729 GAAGAGGTGGAGGAGGTAGAAGG + Intronic
947682770 2:232050882-232050904 ACAGAGATGAAGGAGGTGTATGG + Intronic
947762593 2:232614321-232614343 TAAGAGATGGAGGAGGTGGGAGG - Intronic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
948233221 2:236366801-236366823 AAAGAGAGAGAGGAGGAGGAAGG - Intronic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948458534 2:238118361-238118383 GAATGGATGGAGGAGGTGGATGG + Intronic
948458781 2:238119301-238119323 AAATGGATGAAGGAGTTGGATGG + Intronic
948458800 2:238119380-238119402 AGTTGGATGCAGGAGGTGGATGG + Intronic
948458825 2:238119468-238119490 GAATGGATGGAGGAGGTGGATGG + Intronic
948458843 2:238119521-238119543 GGGGAGATGGAGGAGGTGGATGG + Intronic
948458854 2:238119562-238119584 GAATGGATGGAGGAGGTGGATGG + Intronic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
1168989510 20:2082236-2082258 AAACAAATGAAGGAGGTTGAAGG + Intergenic
1169315016 20:4583194-4583216 TAAGAGATGGAAGAGGTTGATGG + Intergenic
1169478009 20:5950003-5950025 AAAAGGATGCTGAAGGTGGACGG + Intronic
1169844685 20:9976854-9976876 GAAGAGATGAAGGAGATGAAAGG - Intergenic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170158493 20:13289653-13289675 GAAGAGAAGGAGGAGGAGGAGGG + Intronic
1170187239 20:13604362-13604384 AAAGAGAGGGAAGAGGTGGCAGG - Intronic
1170312515 20:15007942-15007964 AAAGAAATGTAGGATCTGGAGGG + Intronic
1170640608 20:18149300-18149322 AAAAAAATTCTGGAGGTGGATGG - Intronic
1170807685 20:19647245-19647267 GAAGTGAGGCAGGCGGTGGAAGG - Intronic
1170941046 20:20848231-20848253 AAAGAGATGCAGGAGCGAGTAGG + Intergenic
1171418120 20:24997412-24997434 GAAGAGGTGGAGCAGGTGGAAGG - Intergenic
1172205425 20:33159863-33159885 CAGGAGCTGCAGGAGGTGGTGGG + Intergenic
1172678589 20:36694188-36694210 GAAGAGGTGGAGGAGGTGAAAGG + Intronic
1172832640 20:37849047-37849069 TATGAGATGTGGGAGGTGGAGGG - Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1173377156 20:42496221-42496243 GAAGAAGTGGAGGAGGTGGAAGG + Intronic
1173538996 20:43837659-43837681 AAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1173662541 20:44744619-44744641 AAAGAGATGGAGCACGTGTAGGG + Intergenic
1173817522 20:45999211-45999233 AAAAGGAGGTAGGAGGTGGATGG + Intergenic
1173841314 20:46158867-46158889 AAATAGGTGCAGGGGGTGAAAGG + Intergenic
1173925779 20:46780167-46780189 ATACAGATGGAGGAGGTGGAGGG - Intergenic
1174202640 20:48818057-48818079 AAAGGCCTGAAGGAGGTGGAGGG + Intronic
1174302542 20:49592942-49592964 AGAGAGAGAGAGGAGGTGGAGGG + Intergenic
1174663027 20:52231583-52231605 AAAGAGAAGGAGGAGGAGAAGGG - Intergenic
1175446560 20:59024203-59024225 AAAGAAGTGCAGGCGGGGGAAGG - Exonic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1177036930 21:16055824-16055846 AAATAGAAGAGGGAGGTGGAAGG + Intergenic
1177403804 21:20640056-20640078 AAAAACATTCTGGAGGTGGATGG + Intergenic
1177928341 21:27248142-27248164 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1177968587 21:27760011-27760033 GGAGAGATGCTGGAGGTGGAAGG + Intergenic
1178098779 21:29243521-29243543 CAAGAGAGGCAGGAGGTGCCAGG + Intronic
1178150947 21:29793107-29793129 AAACATATTCAGGAGGAGGATGG + Intronic
1178389158 21:32184601-32184623 AAAGGGATGCAGGAAGCCGAAGG - Intergenic
1178624114 21:34201551-34201573 CAAGAAATGCAGAAGGTGGCAGG - Intergenic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1178660740 21:34505506-34505528 AAAGAGAGGCAGAGGCTGGAGGG + Intergenic
1178794149 21:35728106-35728128 GCAGAGATGGAGGAGGTGGAAGG - Intronic
1179076283 21:38124956-38124978 AAAAAGGTTCTGGAGGTGGATGG - Intronic
1179391514 21:40996491-40996513 AAGGAGGTGGAGGAGTTGGAAGG + Intergenic
1179730667 21:43365604-43365626 GAAGAGTGGAAGGAGGTGGAGGG + Intergenic
1179772483 21:43632600-43632622 GTAGAGGTGGAGGAGGTGGAAGG - Intronic
1180229887 21:46420940-46420962 AAAGATTTGCAGGCGGTGGGTGG + Intronic
1180280975 22:10695167-10695189 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1180280985 22:10695202-10695224 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1180825115 22:18856360-18856382 AAAGAGCTGCAGGAGGCAGTGGG + Intronic
1181187614 22:21118187-21118209 AAAGAGCTGCAGGAGGCAGTGGG - Intergenic
1181211584 22:21292306-21292328 AAAGAGCTGCAGGAGGCAGTGGG + Intergenic
1181397923 22:22634580-22634602 AAAGAGCTGCAGGAGGCAGTGGG - Intergenic
1181500669 22:23313951-23313973 AAAGAGCTGCAGAAGGCGGTGGG - Exonic
1181651484 22:24261478-24261500 AAAGAGCTGCAGGAGGCAGTGGG + Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181705892 22:24649261-24649283 AAAGAGCTGCAGGAGGCAGTGGG - Intergenic
1182003433 22:26939721-26939743 TGAGAGATGCAGGAGATGTAAGG - Intergenic
1182027303 22:27130421-27130443 TAAGAGATACTGGAGGTGGGCGG - Intergenic
1182132529 22:27867239-27867261 CAGGAGATGGAGGAGGTGGGGGG + Intronic
1182307632 22:29381776-29381798 ACAGAGCTGCAGAAGGTGGGGGG + Intronic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182834346 22:33329621-33329643 AAAAGGCTGGAGGAGGTGGAGGG - Intronic
1182924867 22:34112667-34112689 AAAAAGATGCATGAGGTGGGCGG + Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183124083 22:35758563-35758585 AAAGAGATGTCAGAGGTTGAAGG + Intronic
1183361144 22:37384144-37384166 GGAGAGAGGCAGGGGGTGGAAGG + Intronic
1183929875 22:41229870-41229892 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1184013544 22:41767895-41767917 GAGGAGATGGAGGAGGTGAAGGG + Intronic
1184185854 22:42864840-42864862 AAAGAAGTAGAGGAGGTGGAAGG - Intronic
1184275590 22:43407839-43407861 AAAGCCAGGCAGGAGCTGGATGG - Intergenic
1184306806 22:43608707-43608729 AAGGTGATTAAGGAGGTGGATGG - Intronic
1184482998 22:44759061-44759083 AAAGAGGTGAACGAGGTGGATGG + Intronic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1184581469 22:45420721-45420743 AAATATATGCAGGAGGTAGAAGG - Intronic
1184959373 22:47917934-47917956 AAAGAGAGGGAGGAGGGAGAGGG - Intergenic
1185311810 22:50160224-50160246 AAAAAGAAACAGGAGGTGGGGGG - Intronic
1203215366 22_KI270731v1_random:3126-3148 AAAGAGCTGCAGGAGGCAGTGGG - Intergenic
1203238069 22_KI270732v1_random:26667-26689 AAAAAGATGGAGGAGGGGGAGGG - Intergenic
1203275261 22_KI270734v1_random:82266-82288 AAAGAGCTGCAGGAGGCAGTGGG + Intergenic
949198546 3:1342958-1342980 AAAGAGGTGGAGGAGGTGAAAGG - Intronic
949364272 3:3263682-3263704 GAAGAGGTGGAGGAGGTAGAAGG + Intergenic
949364383 3:3264821-3264843 GAAGAGGTGGAGGAGGTAGAAGG - Intergenic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
949872881 3:8604267-8604289 AAAGATATGCTGCAGGTGAATGG - Intergenic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950143714 3:10633054-10633076 AAGGAGATGCAGGGGCTGGCTGG + Intronic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950901685 3:16503687-16503709 AAAGAGATTCAAGAGATTGAGGG - Intronic
950917151 3:16657528-16657550 GAAAAGATGGAGGTGGTGGAAGG - Intronic
951128625 3:19014351-19014373 AAAGAGATGGAGGAGGAGAATGG - Intergenic
951403092 3:22259908-22259930 GTAGGGATGCAGGAGGTTGATGG - Intronic
951787848 3:26442743-26442765 AAATAGAGGCAGGAGGTTCAGGG - Intergenic
952263151 3:31760226-31760248 GAAGAGTTGGAGGAGGTGAAAGG + Intronic
952954833 3:38550463-38550485 GAGGAGATGGAGGAGCTGGAGGG + Exonic
953231593 3:41070108-41070130 AAAGTGAGGCAGGGGGTGAATGG + Intergenic
953411470 3:42692746-42692768 AAAGAGAAGCCGGAGTAGGAGGG - Exonic
953778773 3:45846778-45846800 AAAGAGTTGGAGGAGGTGGAAGG + Intronic
953843111 3:46405861-46405883 AAAAAGAAGAAGGAGGAGGAGGG - Intergenic
953916898 3:46926143-46926165 ACAGAGAAGCAGGTGCTGGAGGG + Intronic
954344137 3:49982233-49982255 AAAGAAATGCAGAAGGTACAGGG - Intronic
954474027 3:50726358-50726380 AAGGAGATACAGGAGGTATAAGG + Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
955183925 3:56697065-56697087 ATAGACATGCATAAGGTGGAGGG - Intergenic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955371797 3:58358267-58358289 AAAGAGATGATGCTGGTGGAAGG - Intronic
955382559 3:58451519-58451541 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
955472848 3:59304041-59304063 AATGGGATGGAGGAGGTGAAAGG - Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955628310 3:60945064-60945086 AAAGAGATGGAGGATGATGAGGG + Intronic
955891753 3:63657629-63657651 AAAGAGATGCAGGAAAAGAATGG + Intronic
956027199 3:64995947-64995969 AAACAGCTGCAGGGGGTGGGGGG - Intergenic
956310835 3:67877814-67877836 AAAGAGAAGGAGGAGAGGGAGGG - Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956699181 3:71943809-71943831 GAAGAGGTGGAGGAGCTGGAAGG + Intergenic
956729616 3:72184824-72184846 AAAGAGGTGCATGAGGTGAGAGG - Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
956921532 3:73934928-73934950 AGAGAGATGGAGGAGGTGCCAGG + Intergenic
956980141 3:74626971-74626993 CAACAGATGCAGGAGGTTGGAGG - Intergenic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957192133 3:77022880-77022902 AAAAACATTCCGGAGGTGGATGG - Intronic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
957642772 3:82879310-82879332 AAGGAAATGTAGCAGGTGGAAGG + Intergenic
957968133 3:87347190-87347212 AAAAAGATGCATGATGTAGATGG - Intergenic
958415387 3:93867691-93867713 AAAGTGAGGCAGGAGGAAGAGGG - Intergenic
958913988 3:100027051-100027073 AAAGGGATGCAGGGGATGAATGG - Intronic
959467976 3:106713599-106713621 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
959612828 3:108314230-108314252 AAAGAGATGGAGGAGATTGGGGG + Intronic
959969228 3:112390141-112390163 AAAGAGGTGGAAGAGGTGGAAGG - Intergenic
960763476 3:121098355-121098377 AGAGAGAGGCAGGAGGTGCCAGG + Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961808930 3:129510259-129510281 AAAGAAATGCCCAAGGTGGAAGG - Intronic
962035510 3:131647405-131647427 AAAGGAATGTAGGACGTGGAAGG + Intronic
962963447 3:140332322-140332344 AAAGAGATGAAGCTGGGGGAGGG + Intronic
963015944 3:140823946-140823968 GAAGAGGTGGAGGAAGTGGAAGG - Intergenic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963680879 3:148374977-148374999 AAAGAGAAGCAGGAGGTCTGTGG + Intergenic
964033987 3:152173171-152173193 GAAGAGGTGGAGAAGGTGGAAGG - Intergenic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
965506924 3:169526342-169526364 ACAGACATGAAGGAGGTGGGAGG + Intronic
965852076 3:173040094-173040116 GAAGAGAAGAAGGAGGTGGGGGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966581686 3:181574217-181574239 GAAAAGATGAAGGAGGTTGAGGG - Intergenic
966863348 3:184242611-184242633 GCAGAGCTGCAGGATGTGGAAGG + Exonic
966966126 3:184996261-184996283 AAAGAGATAGAGGAGATGAATGG - Intronic
967055273 3:185824892-185824914 AAAGAGCTGCCGGAGGTCGTCGG + Exonic
967148432 3:186626436-186626458 AAGGAGATGCAGATGTTGGATGG - Intergenic
967566261 3:190977044-190977066 AAAGATGTAGAGGAGGTGGAAGG - Intergenic
967999189 3:195191239-195191261 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
969200891 4:5604884-5604906 GAAGAGTTGAAGGAGGTGGAAGG - Intronic
969352877 4:6608299-6608321 AAAGGGAGGCAGGCTGTGGAGGG - Intronic
969507676 4:7598282-7598304 AAACAGAGTGAGGAGGTGGAGGG + Intronic
969649702 4:8458287-8458309 GAAGACATGGAGGAGGTGGAAGG - Intronic
969978145 4:11126092-11126114 TTAGAGAGGTAGGAGGTGGAGGG - Intergenic
970397403 4:15682255-15682277 AGGGAAATGCAAGAGGTGGAAGG + Intronic
970523546 4:16909335-16909357 AAAGAGAGGCAGGAGGCACATGG - Intergenic
970609968 4:17716062-17716084 AAAGAGATGCAAGAGGAAGGAGG + Intronic
971278494 4:25220861-25220883 AAAGAAAAGTTGGAGGTGGATGG + Intronic
971436602 4:26632584-26632606 AAAGAGGTAGAGGAGGTGGAAGG + Intronic
971862823 4:32130160-32130182 AAAGAGGTGAAGGAAGTGAAAGG + Intergenic
972161915 4:36237554-36237576 CAAGAGATGGAGGAGGTGCCAGG - Intronic
972751552 4:41994635-41994657 AAAGAGGTTGAGGAGGAGGAGGG - Intronic
972847633 4:43008964-43008986 TAAGAGGTGCAGGAGAAGGAAGG - Intronic
973690754 4:53428113-53428135 GAAGAAATGGAGGAGGTGGAAGG - Exonic
973978731 4:56288210-56288232 AAAGAAGAGCAGGAGGAGGAAGG - Intronic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
975095265 4:70450174-70450196 AAAGGGAGGAAAGAGGTGGAAGG - Intronic
975182723 4:71365442-71365464 AAAGAGATATAGGAGAGGGAAGG + Intronic
975344959 4:73282886-73282908 AAAGTGATCCAGGAGGTGAGAGG - Intergenic
976131338 4:81887591-81887613 AGAGAGGGGAAGGAGGTGGAAGG + Intronic
976168748 4:82282411-82282433 AAAAAAATGGAGGAGGAGGAAGG + Intergenic
976231338 4:82846509-82846531 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
976267255 4:83195755-83195777 AAAGAAAGGAAGAAGGTGGAAGG - Intergenic
976426834 4:84913849-84913871 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
977099685 4:92795130-92795152 GAACAGGTGGAGGAGGTGGAAGG + Intronic
977233293 4:94477765-94477787 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
977338968 4:95733562-95733584 GATGAGATGGAGGAGGTAGAAGG + Intergenic
977542535 4:98334932-98334954 AAAGAGATGGGGAAGGTAGAAGG + Intronic
978058891 4:104311517-104311539 AAAAATATGCGGGAGGTAGATGG + Intergenic
978386458 4:108180385-108180407 AAAGAATTGGAGGAGGAGGAAGG + Intergenic
978661044 4:111126653-111126675 TAAGAAATGCAGGAGGTGTCTGG + Intergenic
978887990 4:113788442-113788464 GAAAAGATGCTGGAGGGGGAGGG + Intergenic
979038143 4:115751866-115751888 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG + Intergenic
980657146 4:135804016-135804038 AAAGAGAAGGTGGAGGTAGAGGG - Intergenic
980678875 4:136128707-136128729 AGAGAGATGGAGGAGGTGCCAGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
981175401 4:141677183-141677205 GAAGAAGTGGAGGAGGTGGAAGG - Intronic
981186196 4:141806843-141806865 AAAGACATGTAAGAAGTGGATGG - Intergenic
981571719 4:146158735-146158757 GAAGAGGTGGAGGAGATGGAAGG - Intergenic
981595247 4:146414026-146414048 AAAGACATGAAAGAGGAGGATGG + Intronic
981666617 4:147234239-147234261 GAGGAGGTGGAGGAGGTGGAAGG + Intergenic
982088185 4:151857613-151857635 AATGAGATGGAGGAGGGAGATGG - Intergenic
982111549 4:152061033-152061055 GAAGAGGTAGAGGAGGTGGAAGG + Intergenic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982305347 4:153924566-153924588 TAAGAGATGCAGAAGATGGCAGG - Intergenic
982653157 4:158112709-158112731 AAAGAGATTGAGGATGTTGAAGG + Intergenic
983137944 4:164107937-164107959 AAGAGGATGGAGGAGGTGGAGGG - Intronic
983168769 4:164512206-164512228 AAAGAGGTGCAAGAGGAGGAAGG - Intergenic
983248808 4:165321231-165321253 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
983279127 4:165658480-165658502 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
983741896 4:171145307-171145329 GAAGAGGTAGAGGAGGTGGAAGG - Intergenic
983933779 4:173481578-173481600 GAAGAGGTGGAGGATGTGGAGGG - Intergenic
983978175 4:173962643-173962665 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
984019713 4:174470298-174470320 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
984190873 4:176604321-176604343 GAAGAGGTGGAGGAGTTGGAAGG + Intergenic
984723111 4:182995023-182995045 GAAGAGATGGAGGAAGTGAAAGG - Intergenic
984768188 4:183415533-183415555 AAAGACCTGCAGGAGATGGTGGG - Intergenic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985886805 5:2686410-2686432 TAAGAGCTGCTGGTGGTGGAAGG - Intergenic
986210347 5:5665688-5665710 GAGGAGCTGCAGGAGGTGGAGGG + Intergenic
986342539 5:6803149-6803171 AATGGGATGCACTAGGTGGAGGG + Intergenic
986763167 5:10898385-10898407 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
987080111 5:14418560-14418582 AAAGAGATTTAGGGGGTGGGAGG + Intronic
987202381 5:15590503-15590525 AAAGAGAAAAAGGAGGTGGGAGG - Intronic
987292358 5:16520858-16520880 AAAGAGGAGCAGGAGGTGGCAGG + Intronic
987370041 5:17184804-17184826 AAAGAAATGCTGGTGGTGGCAGG - Intronic
987455132 5:18134876-18134898 GAAGAGGTGGAGGAGGTAGATGG - Intergenic
987518601 5:18948261-18948283 AAAGAGAAGAAGGAGAAGGAAGG + Intergenic
987577854 5:19753283-19753305 AAAAAGATGCAAGAAGTGAAGGG + Intronic
988043373 5:25916274-25916296 AAAGTGATGCAGGAGCTGAAGGG + Intergenic
988296034 5:29363437-29363459 GAAGAGGTGGAGGAGGTGAAAGG + Intergenic
988360387 5:30229870-30229892 AAAGAGAGAGAGGAGGAGGAAGG + Intergenic
988518945 5:31929105-31929127 ACAGCCATGCAGCAGGTGGATGG - Intronic
988880140 5:35493592-35493614 GAAGAGGTGGAGGAGGTAGAAGG + Intergenic
989110426 5:37901999-37902021 AGAGAGATGCAGGAGGTCGTTGG + Intergenic
990079757 5:51898923-51898945 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
990105517 5:52254014-52254036 TAATAGATGATGGAGGTGGAGGG + Intergenic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
991544900 5:67770798-67770820 CAAAAGATGTAGGAGGTAGAGGG - Intergenic
992081017 5:73234288-73234310 AAAAAGATGGAGGTGGGGGAAGG - Intergenic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992636334 5:78728987-78729009 GCAGAGATGGAGGAGGTGGTAGG + Intronic
992919712 5:81502038-81502060 AAAATGAGGCAGTAGGTGGAGGG - Intronic
992999429 5:82365741-82365763 AGAGAGATGCAGGAGAGGAAAGG + Intronic
993302455 5:86227587-86227609 GAAGAGGTGGAGGAGGTGAAAGG - Intergenic
993852669 5:93030808-93030830 AAACAGATGAAGGAGATGGAAGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994501412 5:100583243-100583265 GAAGAGTTGAAGCAGGTGGAAGG + Intronic
994570606 5:101508500-101508522 AAAGGGGAGAAGGAGGTGGAAGG - Intergenic
994703411 5:103166924-103166946 GAAGAGGTGAAGGAGGTGGAAGG + Intronic
995412681 5:111876342-111876364 CAAGTGATACAGGAGGTAGAAGG - Intronic
995815384 5:116161795-116161817 GAATAGACGGAGGAGGTGGAAGG + Intronic
995926549 5:117381837-117381859 ATAGAGAGGCAGGAGAGGGAGGG - Intergenic
996018404 5:118566522-118566544 AAAGATAGGCTGGAGGTGAATGG - Intergenic
996095062 5:119389694-119389716 AAAGAGCTTCAGATGGTGGAGGG + Intronic
996408929 5:123135593-123135615 AGGGAGTTGCAGGGGGTGGAGGG - Intronic
996560515 5:124823579-124823601 ACAGAGATGCAAGAGGTGGCAGG + Intergenic
996601862 5:125273555-125273577 AGAGAGATGGAGGTGGTGGGAGG - Intergenic
996961457 5:129255318-129255340 AAAGAGAGGGAAGAGTTGGAAGG - Intergenic
996977435 5:129451793-129451815 AAAAAGATGCATGAGTTGGCCGG + Intergenic
997084120 5:130776312-130776334 AAAGAGAGACAGGAAATGGAAGG + Intergenic
997118054 5:131147206-131147228 AAATAAATGCAAGAGGTGCATGG + Intergenic
998049325 5:139018479-139018501 ACAGAGATGGCTGAGGTGGAAGG + Intronic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
998765100 5:145477838-145477860 AAAGAGAAGGAGGAGGAGAAAGG + Intronic
999039963 5:148398028-148398050 AATGAGATGCACCAGCTGGAGGG - Intronic
999157128 5:149466079-149466101 TAAAAGATGCAGGAGTTGGCCGG - Intergenic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999495443 5:152092008-152092030 AAATTGAGGCAGGAGCTGGAAGG - Intergenic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
999876262 5:155809655-155809677 AAAGAGAGGAGGGAGGTGGATGG + Intergenic
1000034364 5:157432339-157432361 AGAAAGGTGGAGGAGGTGGAAGG - Intronic
1000277845 5:159754749-159754771 AGAGGGATGCAGGAGGGTGATGG + Intergenic
1000752465 5:165113889-165113911 GAAGAGTTGGAGGAGGTGGAAGG - Intergenic
1000895047 5:166845343-166845365 AAAGAGAGACAGCAGGTTGAGGG + Intergenic
1000922380 5:167153501-167153523 GAAGAGGGGGAGGAGGTGGAAGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001220076 5:169893011-169893033 AAAGAAATGAAGGAAGAGGAAGG - Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001663542 5:173413989-173414011 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1002367435 5:178724173-178724195 GGAGGGAGGCAGGAGGTGGAAGG - Intronic
1002386014 5:178867997-178868019 GGAGGGAGGCAGGAGGTGGAAGG + Intronic
1002658655 5:180774227-180774249 AGAGAGAGGCAGGAGGTGCCAGG + Intergenic
1002817098 6:691369-691391 GAAGAGATGGAGGAAGTGAAAGG - Intronic
1003064881 6:2895333-2895355 GAAGAGCCGCAGGAGGAGGACGG + Intronic
1003226316 6:4209076-4209098 ACACAGATGCAGGAGATAGAAGG + Intergenic
1003232516 6:4267501-4267523 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003532201 6:6947074-6947096 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1003643925 6:7899033-7899055 AGAGGGCTGCAGGTGGTGGAGGG + Intronic
1003765736 6:9234398-9234420 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1004065898 6:12243375-12243397 GAAGAGGTGGAGGAGGTGGGAGG + Intergenic
1004226532 6:13789811-13789833 AAAGAGATGGAGAAGAGGGAGGG + Exonic
1004364606 6:15001097-15001119 GAAGAGATAGAGGAGGTGGGAGG + Intergenic
1004446673 6:15706551-15706573 GAAGAGGTGGGGGAGGTGGAAGG - Intergenic
1004537397 6:16515807-16515829 AAGCGGATGCAGGAGGGGGATGG + Intronic
1004618812 6:17315438-17315460 TAAGGGAAGCAGGGGGTGGAAGG + Intergenic
1004834187 6:19512467-19512489 GAAGAGGTGGAAGAGGTGGAAGG - Intergenic
1004918534 6:20355068-20355090 GAAGAGGTGGAAGAGGTGGAAGG - Intergenic
1005018235 6:21393845-21393867 AAAGAGATGAGGGAGTTAGAAGG + Intergenic
1006512692 6:34530212-34530234 AGGGAGATGGGGGAGGTGGAGGG - Intronic
1006514021 6:34536133-34536155 AAATAGATTCAGGAGGAGTAAGG - Intergenic
1006808331 6:36803349-36803371 TTAGAGATGCAGGAGGATGATGG - Intronic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007212066 6:40201420-40201442 AGAGAGATGCGGGAGGTGCCAGG - Intergenic
1007345262 6:41224165-41224187 AAAGGCCTGCTGGAGGTGGAGGG - Intergenic
1007464887 6:42044723-42044745 AAAAAGATGCAGGAGGTGAGAGG - Intronic
1007505425 6:42331834-42331856 AAAGGGAGGCTGGGGGTGGAAGG - Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007665640 6:43511333-43511355 AAAGAGGTGGTGGGGGTGGATGG + Intronic
1007732837 6:43959812-43959834 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1007824755 6:44592121-44592143 AAAGAGAGGCAGGAGAAGGCAGG + Intergenic
1007847945 6:44776304-44776326 GCAGATATGCATGAGGTGGAAGG - Intergenic
1008095670 6:47337023-47337045 GCAGACATGTAGGAGGTGGAGGG + Intergenic
1008139979 6:47821140-47821162 GAAGTGATGGAGGAAGTGGAAGG + Intronic
1008980278 6:57475175-57475197 AAAAAGTTGTAGGAGGAGGAAGG - Intronic
1009031015 6:58058119-58058141 AAAGAGAAGGAGGTGGGGGAAGG + Intergenic
1009168383 6:60368118-60368140 AAAAAGTTGTAGGAGGAGGAAGG - Intergenic
1010249476 6:73693310-73693332 CAAGAGAAGCAGGAGGTGCCAGG + Intergenic
1010256665 6:73765687-73765709 AAAGAGAGGTAGGAAGTGAAGGG + Intronic
1010285057 6:74067383-74067405 GAAGAGAGCAAGGAGGTGGAGGG - Intergenic
1010447171 6:75961258-75961280 AAAGATATAAAGGAGTTGGATGG - Intronic
1010941648 6:81926129-81926151 GTAGAGATGGTGGAGGTGGAGGG + Intergenic
1011529323 6:88302773-88302795 AGACAGAGGCAGGAGATGGAGGG + Intergenic
1011566487 6:88678978-88679000 GAAGAGGTGGAAGAGGTGGAAGG - Intronic
1011591338 6:88973153-88973175 AAAGAGATAGTGGAGGTGGGAGG - Intergenic
1011712837 6:90072002-90072024 GAAGGGGTGGAGGAGGTGGAAGG + Intronic
1011724444 6:90195186-90195208 AAAGAGATGGGGGAGGGGGGAGG - Intronic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1012106021 6:95159349-95159371 GAAGAGGTAGAGGAGGTGGAAGG + Intergenic
1012416211 6:99016815-99016837 AAAGACTTGAAGGAGGTGAAGGG - Intergenic
1012584305 6:100903994-100904016 AGAGAAATGCAGGAGTTGGGAGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1012732798 6:102903116-102903138 AAAAAGATGTAGGAGATAGATGG + Intergenic
1012969056 6:105707042-105707064 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013095492 6:106940777-106940799 GAAGAGAGGAAGGAGATGGAAGG + Intergenic
1013236950 6:108205532-108205554 AGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013374054 6:109496999-109497021 AAGGCGAGGCTGGAGGTGGAGGG - Intronic
1013395374 6:109732013-109732035 AAAGAGATGCATGGACTGGAAGG + Intronic
1013851504 6:114521450-114521472 AAAGAGATGCGGGAAGTGACAGG + Intergenic
1014121692 6:117733480-117733502 AAAGAGAGGGAGGAGGTGCCAGG + Intergenic
1015138182 6:129897912-129897934 GAAGAGGTGGAGGAGGTGAAAGG + Intergenic
1015295035 6:131581422-131581444 GTAGACATTCAGGAGGTGGAAGG + Intronic
1016798845 6:148147508-148147530 AAAGAAAGGCAGGAGGGGAAAGG - Intergenic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017515453 6:155152265-155152287 AGAAGAATGCAGGAGGTGGAAGG + Intronic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1017593715 6:156006007-156006029 AGAGAGATAAAGGAGGAGGAGGG + Intergenic
1017625074 6:156339759-156339781 AAAGAAATGCAGATGCTGGAAGG - Intergenic
1017988975 6:159469919-159469941 AAAGAGATGAGGGAAGAGGAAGG + Intergenic
1018203119 6:161413326-161413348 AAAGAGACTCAGGAAGTGAAGGG - Intronic
1018944789 6:168340004-168340026 AGTGAGCTGCAGGAAGTGGAAGG - Intergenic
1019096540 6:169585818-169585840 GAAGAGGTGGAGGAGGTGGAAGG + Intronic
1019199042 6:170298930-170298952 CAAGACATGCAGGAAGTAGAAGG + Intronic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019911594 7:4103688-4103710 GGAGAGATGCTGGAGGTGCAGGG + Intronic
1021040934 7:15861165-15861187 AAAGACACGGAGGAAGTGGAAGG + Intergenic
1021280147 7:18707121-18707143 AAAGAGAGGGAGGAACTGGAAGG + Intronic
1021746602 7:23746774-23746796 ACAGAGATGGAAGAGGTGGAGGG + Intronic
1021760263 7:23896749-23896771 AAAGAGATTCAGGAAGGAGAGGG - Intergenic
1022094594 7:27130799-27130821 GAAGCGAGGCAGGAGGGGGAGGG - Exonic
1022253208 7:28629321-28629343 AAGGAAAGGGAGGAGGTGGAAGG - Intronic
1023115693 7:36859890-36859912 AGAGAGGTGGAAGAGGTGGAAGG - Intronic
1023211101 7:37805550-37805572 AAAGTGATTCAAGAGGTGAAAGG + Intronic
1023215153 7:37854394-37854416 GAAGAGGTGGAGGAAGTGGAAGG + Intronic
1024196426 7:47063890-47063912 GAAGAGGAGGAGGAGGTGGAGGG - Intergenic
1024926696 7:54623231-54623253 AAACAGAGGCAGGAGCTGCAAGG - Intergenic
1025111452 7:56220129-56220151 AAAGAGAGGAAGGAGGAGGAGGG + Intergenic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1026124884 7:67570751-67570773 AAAGAGATGATGAAGGTAGAAGG - Intergenic
1026257266 7:68723546-68723568 AATGAGATACAGGATGTGCAGGG + Intergenic
1026679813 7:72457366-72457388 AAGGAGATGAAGGTGGTGAATGG - Intergenic
1027544024 7:79503789-79503811 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1027780777 7:82517317-82517339 AAAGAGAGGAAGGTGGAGGAAGG + Intergenic
1028307704 7:89286923-89286945 AAAGAAGTGGAGAAGGTGGAAGG - Intronic
1028520922 7:91729485-91729507 GAAGAGAGGGAGGAGATGGAGGG + Intronic
1028920639 7:96306711-96306733 AAAGAGAAGATGGAAGTGGATGG - Intronic
1028987427 7:97019029-97019051 AAAAAAATAAAGGAGGTGGAAGG + Intergenic
1029380475 7:100211139-100211161 AAAGAGATGGAGGAAGAAGATGG + Exonic
1030005267 7:105112391-105112413 AAGGAGGTGGAGGAGGTGGAGGG - Exonic
1030308324 7:108042139-108042161 AAAGAGAAGCAAGAGGTCGGTGG + Intronic
1030619603 7:111774587-111774609 AAAGAACTTCAGGAGGGGGATGG + Intronic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031060701 7:117048206-117048228 GCAGAGATGGAGGAGGTGAAAGG + Intronic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031590164 7:123581118-123581140 AAAGAGCTGAAGGAGGTTGGTGG - Intronic
1031796192 7:126176936-126176958 GAAGCGGTGGAGGAGGTGGAAGG - Intergenic
1031961403 7:127993480-127993502 TAAGAGCTGCATGAGGTGGGAGG - Intronic
1032134729 7:129265418-129265440 AAAGAGATGAGGGAGTTGAATGG + Intronic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032663383 7:134010836-134010858 AAAGAAATGAAGGATCTGGAGGG + Intronic
1032746946 7:134795606-134795628 AAAGAAAAGGAGGAGGGGGAAGG - Intronic
1033440304 7:141372430-141372452 AAAGACCTGAAGGAGGTGAAGGG - Intronic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034120339 7:148621035-148621057 CAAGAGAGGCAGTAGGTCGAAGG - Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035133967 7:156682064-156682086 AAGGATATGCATGGGGTGGAAGG - Exonic
1035738154 8:1904166-1904188 AAAGAGATGCAGGACCCAGAAGG + Intronic
1036459276 8:8937583-8937605 GAAGAGGTGGAAGAGGTGGAAGG + Intergenic
1036494118 8:9253792-9253814 GAAGAGTTGGAGGAAGTGGAAGG + Intergenic
1036509521 8:9387506-9387528 AAAGTGAGGCCGCAGGTGGATGG + Intergenic
1036655909 8:10677168-10677190 AATGAAGTGCAGGAGGAGGAGGG - Intronic
1037598466 8:20373866-20373888 GAAGAGAAGGAGGAGGAGGAGGG + Intergenic
1037613810 8:20498990-20499012 GAAGAGGTGAAGGAGGTGGAAGG - Intergenic
1037745711 8:21642567-21642589 AGAGAAAAGCAGGAGGTGAAAGG + Intergenic
1037843409 8:22261753-22261775 AAAGAGAATGGGGAGGTGGACGG + Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038927251 8:32154358-32154380 AAAGGAAGGCAGGAAGTGGAAGG - Intronic
1039033668 8:33335932-33335954 GAAGAGATGGAGGAGGAGGCAGG + Intergenic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1039809051 8:41028348-41028370 TGAGAGGTGCAGGAGGTAGAAGG - Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041602084 8:59731071-59731093 AAAGAGATAGCGGAGGTGAAAGG - Intergenic
1041611331 8:59853314-59853336 AAAGAGGTGGAGGAGGTGAAAGG + Intergenic
1042765823 8:72321127-72321149 CAAGAGATGCATGAGGGAGAGGG + Intergenic
1044106101 8:88209204-88209226 GAAGAGGTGCAGGAGGTGGAAGG - Intronic
1044343100 8:91070445-91070467 AAAGAGAAGAAGGAGTTGCAAGG + Exonic
1044485494 8:92748286-92748308 AGAAAGATGCAGTAGCTGGAGGG + Intergenic
1044585966 8:93869511-93869533 AAAGAGAAGTAGGGGGTGGGGGG - Intronic
1045377217 8:101586048-101586070 AAAAAGAAACATGAGGTGGAAGG - Intronic
1045458939 8:102411022-102411044 AAACAGACTCAGGAGGTTGAGGG - Intronic
1045832154 8:106475467-106475489 GAAGAGGTGGAGGAGGTGGAAGG + Intronic
1046446326 8:114325198-114325220 GAAGAGATGGAGGAGATGAAAGG + Intergenic
1046540022 8:115567811-115567833 AAAGAGCTGCAGGAGGCACAGGG - Intronic
1047793291 8:128227902-128227924 AAAGAGGTTCTGGAGATGGATGG - Intergenic
1047978700 8:130157838-130157860 CAAGAGATGCAGGTGGTGTGGGG - Intronic
1048431791 8:134377601-134377623 ACAGGGATGCAGGTGGTAGAGGG - Intergenic
1048651583 8:136484315-136484337 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1049350591 8:142162443-142162465 AAAGAGATGAAGATGGGGGATGG + Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1050796791 9:9556351-9556373 AAAGAGGTGGAGGAGGTAGAAGG + Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051823270 9:21192446-21192468 ACATACATGCAGGAGGTGGCTGG - Intergenic
1051825089 9:21210982-21211004 ACATACATGCAGGAGGTGGCTGG - Intronic
1051827078 9:21233045-21233067 ACATACATGCAGGAGGTGGCTGG - Intronic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1052205255 9:25831143-25831165 CAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1052431897 9:28377191-28377213 GAAGAGGTGGGGGAGGTGGAAGG - Intronic
1052817858 9:33115466-33115488 AAAGAGCCCCAGGATGTGGATGG + Intronic
1052998651 9:34565368-34565390 AGAGAGATGGGGGAGGTGGGGGG - Intronic
1054785091 9:69202756-69202778 GAAGAGGTGGAGGAGGTGAAGGG + Intronic
1055030355 9:71767804-71767826 ACAGAGAGGCAGGGGGCGGAGGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055107035 9:72523680-72523702 GTAGAGGTGCAGGAGGTGGAAGG + Intronic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055517437 9:77047377-77047399 AAAGAGCTGCAGTAGGGGCAGGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056024213 9:82475732-82475754 GAAAAGATGGAGGAGGTGGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056161176 9:83895647-83895669 AAAAAGATACAGAAGGTGAAAGG + Intronic
1056358952 9:85833611-85833633 AAAAAGATACAGAAGGTGAAAGG - Intergenic
1056496841 9:87164485-87164507 AAAGAGTTGGAGGAGGGTGAGGG - Intergenic
1056543723 9:87595760-87595782 AAAGAGATGCAGAAAGAGAAGGG - Intronic
1056615284 9:88160245-88160267 AAAGAGGAGCAGGGGCTGGAGGG - Intergenic
1056718856 9:89056514-89056536 AAAGAAATGGAAGAGGTGGGTGG - Intronic
1057051573 9:91928075-91928097 AGTGTGATGCAGGAGGTGGCGGG - Intronic
1057134499 9:92677919-92677941 AAAGAGAGGCAGGTGGAGGGTGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057588618 9:96351982-96352004 AAAGAAATGCAGTGGGTGGGAGG + Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058111094 9:101030946-101030968 AAAAAGAAGCAGGGGGTGGGGGG + Intronic
1058454426 9:105126084-105126106 AAAGAGGCCCAGGAGGTAGAAGG - Intergenic
1058580200 9:106447540-106447562 AAAGAGGTGGAGAAGGTGGAAGG - Intergenic
1058665030 9:107305445-107305467 GCAGAGATGGAGGAGGTAGAAGG + Intronic
1058824649 9:108764170-108764192 GAAGACACGGAGGAGGTGGAAGG - Intergenic
1058959264 9:109977757-109977779 AGAGAGAGGCAGGGGGTGAAGGG - Intronic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1059348251 9:113646822-113646844 AATGAGATCCCGGAGGTGAACGG - Intergenic
1059568541 9:115409088-115409110 AAAGATATGAAGGAGGTGAAGGG + Intergenic
1060265545 9:122109694-122109716 AAAGGGATGCAGGAGTTCAAAGG - Intergenic
1060579486 9:124731570-124731592 AAAGAGGTAGAGGAGGTGAAAGG - Intronic
1060960964 9:127680403-127680425 AACGGGATGCTGGAGGGGGAAGG - Intronic
1061153928 9:128845763-128845785 GAAGAGGAGCAGGAGGTGGGTGG + Intronic
1061168931 9:128940833-128940855 AAAGAGAAGGAGGGGCTGGATGG + Intronic
1061380117 9:130251098-130251120 AACGAGATACAGGTGGTTGATGG + Intergenic
1061731418 9:132617303-132617325 AAGGAGATGGGGGAGGTGAAGGG - Intronic
1061865684 9:133490830-133490852 AAGGAGGTGCTGGAGGAGGAGGG + Intergenic
1062074723 9:134579738-134579760 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1062129408 9:134884530-134884552 AAAGGGGTGCATGTGGTGGAGGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1203582211 Un_KI270746v1:19448-19470 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185662053 X:1735650-1735672 AAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185691977 X:2162830-2162852 CAACAGGTGCAGGAGGTGCAGGG - Intergenic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1186586714 X:10882678-10882700 AAAGATAAGCAGGAGGTGTCAGG - Intergenic
1186672517 X:11781663-11781685 GAAGAGAGGGAGGAGGAGGATGG + Intergenic
1187061904 X:15794668-15794690 GAAGAGGTGGAGGAGGTAGAAGG + Intronic
1187121642 X:16413441-16413463 GAAGAGGTGGAGGAGATGGAAGG - Intergenic
1187223591 X:17354350-17354372 TAAGATAGGCCGGAGGTGGATGG - Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187275258 X:17811224-17811246 AAAGAGCTGCTGGTGGTGGTAGG + Intronic
1187742078 X:22366646-22366668 AAAGAGAAGGGGGAGATGGAGGG + Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188362463 X:29273017-29273039 AAAAAGACACAGGAGCTGGAAGG - Intronic
1188605808 X:32028018-32028040 GAAGAGAGGCAGGAGAGGGAGGG + Intronic
1188659643 X:32743062-32743084 AAAGAGATGCAGGAGCTGGCAGG - Intronic
1188724276 X:33562286-33562308 GAAGAGGAGCAGGAGGGGGAGGG - Intergenic
1188987011 X:36776997-36777019 TAAGAGCTGCAGGAGTTGCATGG - Intergenic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189546996 X:42051610-42051632 GGAGAGAGGGAGGAGGTGGAAGG - Intergenic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1190432064 X:50387731-50387753 AAAGAGAGAGAGGAGGAGGATGG - Intronic
1190795029 X:53732998-53733020 GAAGAGTTGGAGGAGGTGGAAGG - Intergenic
1191842409 X:65522643-65522665 CAAGGGATGCAGGAAATGGAGGG + Intronic
1192182150 X:68922775-68922797 CAAGTGAGGCAGGAGGTGGCTGG + Intergenic
1192432714 X:71123291-71123313 CGAGAGATGGAGGTGGTGGAGGG + Intronic
1192446229 X:71213569-71213591 AAAGACAGGTAGGAGCTGGAAGG - Intergenic
1192488944 X:71557001-71557023 AAGGAGATGCAGGATGTTCAGGG + Exonic
1192819055 X:74624053-74624075 GAAGAGGGGCAAGAGGTGGAAGG - Intergenic
1194213163 X:91093888-91093910 AGAGATATTCAGGACGTGGAGGG - Intergenic
1195609357 X:106847664-106847686 AAACAGATGCAGCAGATAGAGGG + Intronic
1195859231 X:109363494-109363516 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1196025048 X:111033315-111033337 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1196144792 X:112304843-112304865 AGAGAGATGCAGGAGTGGGATGG - Intergenic
1196230827 X:113219060-113219082 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1196714493 X:118798600-118798622 AAACAGAAGCTGGAAGTGGAGGG - Intergenic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1196936741 X:120737813-120737835 AAAGAGAAGCAAAAGGTGAAGGG + Intergenic
1196964172 X:121037762-121037784 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1197441521 X:126496413-126496435 GAAGAGGCGAAGGAGGTGGAAGG - Intergenic
1197968532 X:132091460-132091482 AAAGACTTGAAGGAGGTGGGAGG - Intronic
1198688236 X:139250656-139250678 ACAGATATGCAGGAGGTGATTGG + Intergenic
1199780346 X:151052427-151052449 AGAGAGAGGAAGCAGGTGGAAGG - Intergenic
1200013522 X:153140045-153140067 AAAGACATGCAGAAGATAGAGGG + Intergenic
1200026079 X:153259873-153259895 AAAGACATGCAGAAGATAGAGGG - Intergenic
1200087444 X:153614660-153614682 AGAGAGAAGGAGGAGGTGGGTGG - Intergenic
1201300227 Y:12498706-12498728 AAAGAGGAGAAGGAGGGGGAAGG - Intergenic