ID: 955623473

View in Genome Browser
Species Human (GRCh38)
Location 3:60891347-60891369
Sequence CAGGGTGATCAACCTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955623473 Original CRISPR CAGGGTGATCAACCTGATCT GGG (reversed) Intronic
901133249 1:6976121-6976143 CAGGAAGATCAATCTGATCATGG + Intronic
904291903 1:29491833-29491855 CAGTGTGATAAAGCTGTTCTGGG - Intergenic
904327751 1:29738672-29738694 CAGGGTACTCTACCTGAACTGGG - Intergenic
908088402 1:60661236-60661258 TTGGGTGATCAGCATGATCTGGG - Intergenic
912428014 1:109611516-109611538 CATGTTGCTCAACCTGGTCTTGG + Exonic
912691727 1:111809815-111809837 CAGGGTCCCCAACCTGCTCTGGG + Intronic
923073813 1:230591379-230591401 CAGGGTTACCAACATGATCGGGG + Intergenic
924240181 1:242032809-242032831 CAGGCAGATCAACCTGAGGTTGG + Intergenic
1068489410 10:57704009-57704031 CAGCTTGCTCAACCTCATCTGGG - Intergenic
1068961459 10:62870732-62870754 CAGGGAGGCCAACCTGATCCTGG - Intronic
1070341028 10:75498768-75498790 CAGGGTGAGGAAACTGATCCAGG + Intronic
1071183605 10:83015307-83015329 GAGGGAGATCAATCTGGTCTAGG - Intergenic
1074707736 10:116150368-116150390 AAGGCTGACCAGCCTGATCTGGG - Intronic
1075535095 10:123264426-123264448 TAGGGTGACCAACTTGATCTGGG + Intergenic
1076127998 10:127991474-127991496 GAGGGTGTTTAACCTGACCTAGG + Intronic
1085359043 11:75869088-75869110 CAGGCTGAGGAACTTGATCTAGG + Intronic
1091643315 12:2254052-2254074 CTGGGTGACCAACCTCACCTGGG + Intronic
1097380328 12:58887638-58887660 CATTGTAATCAAACTGATCTGGG + Intronic
1101042943 12:100775487-100775509 CAGTGTTATCAAACAGATCTGGG + Intronic
1102816760 12:115872210-115872232 CAGGATGATCAGCATGATTTGGG + Intergenic
1103842574 12:123877069-123877091 CAGGGTGATGAAAATGTTCTGGG - Intronic
1109205692 13:59480427-59480449 CAGCCTGATCAATCTTATCTTGG - Intergenic
1109729030 13:66385837-66385859 CAGAGTTCTCAACCTGATTTTGG - Intronic
1110627349 13:77666162-77666184 CATGTTGATCAGGCTGATCTTGG + Intergenic
1111259778 13:85721990-85722012 CAGATTGATCAAGCTGATTTAGG - Intergenic
1116361162 14:43999804-43999826 CAGTTTGATCACCCAGATCTTGG - Intergenic
1121681639 14:95797659-95797681 CAGGGTGATGAACATGATAAAGG + Intergenic
1123130442 14:105981435-105981457 CAGGGTGATGGACCTGCTTTGGG - Intergenic
1123410010 15:20050364-20050386 CAGGGTGATGGACCTGCTATGGG + Intergenic
1123519342 15:21057071-21057093 CAGGGTGATGGACCTGCTATGGG + Intergenic
1123580679 15:21712656-21712678 CAGGGTGATGGACCTGCTTTGGG - Intergenic
1123617328 15:22155279-22155301 CAGGGTGATGGACCTGCTTTGGG - Intergenic
1126919864 15:53509232-53509254 CAGGATGATGCACCTGCTCTTGG + Intergenic
1128207150 15:65862955-65862977 AAGGGTGAACAAGCTGATTTTGG + Intronic
1130579028 15:85118257-85118279 CAGGGTTATCTACCTAATCCAGG + Intronic
1202989549 15_KI270727v1_random:446901-446923 CAGGGTGATGGACCTGCTTTGGG - Intergenic
1136374832 16:29859242-29859264 CAGCGTCATCCACCTGATCACGG - Exonic
1139624870 16:68179204-68179226 CAGGGTCTTCAACCTAATCTTGG - Intronic
1142778495 17:2161330-2161352 CAGGCTGATCAACCTGAGGTCGG - Intronic
1145988890 17:29066205-29066227 CAGGCTGCTCCACCTGTTCTCGG - Intergenic
1146707729 17:35013809-35013831 CAAGTAGATCAGCCTGATCTTGG + Intronic
1146907734 17:36628853-36628875 CAGGGAGGTCAGGCTGATCTGGG - Intergenic
1147218662 17:38915356-38915378 CAGGGTGAGCAACCTGCCCATGG - Intronic
1149427216 17:56566670-56566692 CAGTGTAATCAACCTGATGCTGG - Intergenic
1152299928 17:79489494-79489516 CATGGTGCCCAACCTGGTCTCGG + Intronic
1153052946 18:917395-917417 CAGGGTCATTAAACTGATCTGGG - Intergenic
1153364433 18:4238319-4238341 CAGGGATATAAACCTGACCTTGG - Intronic
1154315152 18:13298329-13298351 CACGGTGATGGACCTGCTCTAGG + Intronic
1154394555 18:13975075-13975097 CACTGTGATCAACTTGGTCTTGG + Intergenic
1160969614 19:1761740-1761762 CAGGGAGACCCACCTGACCTTGG + Intronic
1161131006 19:2588680-2588702 CAGGGTGACCAACCCCAGCTGGG + Intronic
1166727375 19:45037186-45037208 CAGGGGAATCAACTTGAACTGGG + Intronic
1167162289 19:47776094-47776116 CAGTCTGATCCCCCTGATCTTGG - Intergenic
928673101 2:33622258-33622280 CTGGGTCATCAACCTGCTATGGG + Intergenic
935155756 2:100482321-100482343 AAGGGTGATGAAGCTGATCTTGG - Intronic
945370446 2:209009778-209009800 CAGAGTGATGAACTAGATCTGGG - Intergenic
1173549483 20:43922754-43922776 CAGGATGAGCAACCTGATTGTGG + Intronic
1174367674 20:50066315-50066337 CAGGGTGACCCACCAGAGCTGGG - Intergenic
1177020537 21:15850918-15850940 TAGGGTGATCAACTTGTCCTGGG - Intronic
1180154499 21:45971467-45971489 CAGGGTGACCTCCGTGATCTAGG - Intergenic
1181311327 22:21946440-21946462 GAGGGGGTTCAACCTGATCACGG + Intronic
1184484183 22:44766077-44766099 CAGGGAGGCCAACCTGATCCTGG + Intronic
949947697 3:9203257-9203279 CAGGGTGATTCTCCTGAGCTTGG - Intronic
950198325 3:11025474-11025496 CAGGATGATCAGCATGATGTAGG - Exonic
955623473 3:60891347-60891369 CAGGGTGATCAACCTGATCTGGG - Intronic
963710790 3:148745349-148745371 CAGTGAGATCAACATAATCTTGG + Intergenic
964502436 3:157363179-157363201 CAAGATGATCAACCTTTTCTTGG + Intronic
966526386 3:180923905-180923927 CTGGGTGATCATCGTTATCTAGG - Intronic
975088311 4:70369936-70369958 CAAGGTCATCTACCTGAACTTGG + Intergenic
983383001 4:167021609-167021631 CAGTTTTATCAATCTGATCTGGG - Intronic
990222126 5:53604471-53604493 CATTGTCATCATCCTGATCTAGG + Intronic
991522528 5:67516542-67516564 AAGGGTGATAAACCTGAGCTTGG + Intergenic
996779493 5:127170661-127170683 CAGGGTGATCAGCCTGGTGAGGG - Intergenic
996781005 5:127186598-127186620 CAGGGTGGGCCTCCTGATCTGGG + Intergenic
997715473 5:136039535-136039557 CAGGGTCATCAACCTTCTCCAGG + Intronic
1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG + Intergenic
1002939962 6:1707499-1707521 CAGGGTGAGCAACCAGATGGAGG + Intronic
1003912440 6:10754557-10754579 CAGGGGGATCAACCTATTCAGGG - Intronic
1004021403 6:11779222-11779244 CAGGTTGATAAACCAGATCATGG + Intronic
1005876525 6:30014098-30014120 CAAGGTACTCAACCTGCTCTGGG + Intergenic
1010965913 6:82208379-82208401 CAGGGTAATCATCATGACCTTGG + Intronic
1011016709 6:82764333-82764355 AATGGTGTTAAACCTGATCTGGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1026802109 7:73406643-73406665 AAGGGTGATCAATTTGACCTGGG - Intergenic
1033448400 7:141441470-141441492 CTGGGTGAGCAACCTGAGCCTGG - Intronic
1034959010 7:155352727-155352749 CACTGTCATCATCCTGATCTGGG + Intergenic
1035187099 7:157134865-157134887 CACGTTGATCAGGCTGATCTTGG - Intergenic
1037945662 8:22987956-22987978 CAGTGTCATCTACTTGATCTTGG - Intronic
1041453486 8:58032788-58032810 CAAGGTGAACACCCTTATCTTGG + Intronic
1041770673 8:61469405-61469427 CACGGTGAGCCATCTGATCTTGG + Intronic
1045508942 8:102798574-102798596 CAGGTTGATCGTCTTGATCTTGG + Intergenic
1052034361 9:23663056-23663078 CAGGTAGAACAATCTGATCTTGG + Intergenic
1060701494 9:125754253-125754275 CAGTGTGATCAGCATGATTTAGG + Intronic
1187148285 X:16657431-16657453 CAGGGTGACCAAAGTGAACTGGG + Intronic
1189113428 X:38318339-38318361 CAGTAAGATCAAGCTGATCTTGG + Intronic
1192608242 X:72542240-72542262 TAGAGTGATCCAGCTGATCTGGG + Intronic
1200863247 Y:8015351-8015373 CATGGTGATCAAGCTTATATTGG - Intergenic