ID: 955632880

View in Genome Browser
Species Human (GRCh38)
Location 3:60993622-60993644
Sequence GTGCAGTTCTAGAGTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955632880_955632882 19 Left 955632880 3:60993622-60993644 CCATTAAAACTCTAGAACTGCAC 0: 1
1: 0
2: 1
3: 8
4: 134
Right 955632882 3:60993664-60993686 CTAAAATTATACCAATTCTTTGG 0: 1
1: 0
2: 0
3: 30
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955632880 Original CRISPR GTGCAGTTCTAGAGTTTTAA TGG (reversed) Intronic
904633152 1:31858583-31858605 GTGCAGTTTTATAGTTGTAAAGG + Intergenic
904767506 1:32861822-32861844 GTGCTGTTCTAGGCTGTTAAAGG - Intergenic
909012238 1:70347646-70347668 GTGAAGTTCTATAGTACTAATGG + Intronic
910423214 1:87091799-87091821 GTACAGTTCTAGGGTTTGCAAGG + Intronic
910526446 1:88184275-88184297 GTGCATTGCTACATTTTTAAGGG + Intergenic
910632703 1:89372700-89372722 GTTCTCTTCTAGAGTTTTTATGG - Intronic
916970475 1:170008155-170008177 GTATTGTTCTAGAGTTTTTATGG - Intronic
917007492 1:170431468-170431490 GTGTTCTTCTAGAGTTTTCATGG - Intergenic
919783659 1:201240887-201240909 TAGAAGTTCTAGAGATTTAAAGG - Intergenic
1066326116 10:34360393-34360415 GTGCAGATGTAGTGTTTTCATGG - Intronic
1067761641 10:49052858-49052880 GTGCAGTTTTACTGTTTTGAAGG - Intronic
1072002703 10:91213094-91213116 GTGCAGTTTAAGTGTTTTCAAGG + Intronic
1073622570 10:105064438-105064460 GTGCAATTATAGAGGTTGAAAGG + Intronic
1074543827 10:114387087-114387109 GATCAGTTCTAGAGTATTTATGG - Intronic
1080286307 11:30617914-30617936 ATACATTTCTAGAGTTTCAAGGG - Intergenic
1080621715 11:33992338-33992360 TTGCAGTTCTAGAGGATAAATGG + Intergenic
1081199332 11:40197618-40197640 ATGGAGTTCTAGAATTTGAATGG - Intronic
1082617453 11:55378300-55378322 GTGTTCTTCTAGAGTTTTTATGG - Intergenic
1086597551 11:88591908-88591930 GAGCTGTTCTAATGTTTTAATGG - Intronic
1088112348 11:106277221-106277243 CTGCAGTTCTTTAGTTTCAAGGG + Intergenic
1089209152 11:116788990-116789012 CTGCTGTTCTAGAGTTTGAATGG - Intergenic
1091344148 11:134841639-134841661 GTGCAGTTGTAGAATCTCAAGGG + Intergenic
1094322594 12:29201698-29201720 GTGCAGTTCTAGTGAAATAATGG - Intronic
1096054459 12:48639847-48639869 TTACAGTTCTAGAGTCTAAAAGG + Intergenic
1100754209 12:97732446-97732468 GTTCAGCTCTAGTGTTTGAAAGG - Intergenic
1100980718 12:100160122-100160144 GTGTAGATCTACAGTTTGAAGGG + Intergenic
1102607340 12:114078189-114078211 CTGCAGTTCAAGGATTTTAAAGG - Intergenic
1105983072 13:25538611-25538633 GTGCAGTTCTTGACTTTTTTGGG + Intronic
1108007948 13:45971548-45971570 GTTAATTTCTAGAATTTTAATGG - Intronic
1108196361 13:47999830-47999852 ATGCAGCTCTAGAGTTTGGAAGG - Intronic
1108565077 13:51688610-51688632 GTGGAGTTTTAGAGTTTGTAAGG - Intronic
1112026353 13:95414701-95414723 TTGCAGATCTTGAGTTTTCATGG - Intergenic
1112217472 13:97448297-97448319 AGGCAGTTCTAGAATCTTAATGG - Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1115122688 14:29956480-29956502 GTTTTCTTCTAGAGTTTTAATGG + Intronic
1116076328 14:40115788-40115810 GTTGTCTTCTAGAGTTTTAATGG + Intergenic
1119198358 14:72733857-72733879 GTGCATTTGTTCAGTTTTAATGG - Intronic
1120529524 14:85615153-85615175 CTGCAGTTCCAGATTTTAAAGGG + Intronic
1124005259 15:25790846-25790868 GGGCACTTCTAGAGTTTTCAAGG + Intronic
1126406751 15:48330730-48330752 GGGCAGTTTTAGAGTATTATTGG - Intergenic
1126891691 15:53212236-53212258 TTTCAGTTTTAGAGTTTTATGGG - Intergenic
1129248428 15:74294296-74294318 ATGCAGTCCTAGGGTTTTCAGGG - Intronic
1132836594 16:1956834-1956856 GTGGAATTCTAGAGTTTTTCAGG + Intronic
1134386057 16:13773756-13773778 GTGCAGTCCTAGAGCATTACTGG + Intergenic
1137280749 16:46974232-46974254 ATACATTTCTAGTGTTTTAAGGG + Intergenic
1137362037 16:47827165-47827187 GTTCAACTCTAGAGATTTAAGGG + Intergenic
1140317006 16:73908260-73908282 GAGTAGTTCTTGAGTTTTAGGGG - Intergenic
1143589941 17:7877825-7877847 GAGATGTCCTAGAGTTTTAAAGG - Intronic
1144601349 17:16617501-16617523 GTGCAGTTGGAGAGATTTAAAGG - Intergenic
1147572622 17:41580622-41580644 GTGAAGTACTAGAGTTTCAGGGG - Intergenic
1149854771 17:60071996-60072018 TTGCAATTCTAGATTTTTAGAGG - Intronic
1155615641 18:27718211-27718233 GCTCATTTCTAGATTTTTAAGGG - Intergenic
1160485257 18:79285722-79285744 GTTCTCTTCTAGAGTTTTTATGG + Intronic
1162933770 19:13970334-13970356 GTGCAGTTCTAGAGTTCTGTGGG - Intronic
931764526 2:65443067-65443089 ATGTAGTACTAGAGTTCTAAAGG + Intergenic
935842650 2:107130047-107130069 GTACAGTTCTATGGTGTTAAGGG + Intergenic
939731270 2:145787401-145787423 GTCCTGTTCTAGGGTTTTTATGG - Intergenic
941426941 2:165359024-165359046 GTGCTGTTTTATAGTTTTATTGG - Intronic
944093678 2:195942844-195942866 CTGCAGTTCTAGAGTGTACATGG - Intronic
944294933 2:198051373-198051395 TTACAGTTTTAGATTTTTAATGG + Intronic
944355677 2:198784931-198784953 GTTCTTTTCTAGAGTTTTTATGG + Intergenic
944668768 2:201978087-201978109 GCACATTTCTAGAGTGTTAAGGG - Intergenic
945715658 2:213354968-213354990 GTTCTGTTCTAGGGTTTTTATGG + Intronic
947400983 2:229731336-229731358 ATGCAGGTCTAGAGTTTTAAGGG + Intergenic
947446615 2:230168933-230168955 GTGTAGATATAGACTTTTAAAGG + Exonic
1169390869 20:5189886-5189908 GTGCAATTCTAGAATTTTAGCGG + Intronic
1170256778 20:14353456-14353478 GTGGAATTTTAGGGTTTTAAGGG + Intronic
1174316685 20:49708395-49708417 ATGCAGTTCTAGTTTTTCAAAGG + Intronic
949645390 3:6087745-6087767 GTAGAGTTCTAGATTTTTCAGGG + Intergenic
951728093 3:25782533-25782555 TTGCACTTCTAGAGGTCTAAGGG - Intronic
954391748 3:50271214-50271236 GTGAGGTTCTAGAGTTTCTAAGG - Intronic
955632880 3:60993622-60993644 GTGCAGTTCTAGAGTTTTAATGG - Intronic
957151265 3:76488792-76488814 AATCAGTTCTAGGGTTTTAAAGG - Intronic
960415398 3:117379204-117379226 GGACAGTTCCTGAGTTTTAATGG + Intergenic
965141247 3:164838410-164838432 GTGAAGTTTTAATGTTTTAATGG - Intergenic
966287728 3:178317250-178317272 GAGCAATTCTAGATTATTAAGGG + Intergenic
966436162 3:179886226-179886248 GGGTAGTTCTCGAGTTTTGAAGG + Intronic
968409859 4:380947-380969 GGGCAATTCTAGAGTTTATATGG - Intronic
969190497 4:5514557-5514579 GGGCAGATCTAGATTTTGAATGG + Intergenic
970129706 4:12853932-12853954 GTGCAATTCTAGAAATGTAAGGG + Intergenic
970892108 4:21058741-21058763 CTTCAGTTCTAGAGTGTTATAGG - Intronic
972787399 4:42339919-42339941 GTGTAGTTCTAGAGTTTAGTTGG + Intergenic
973536917 4:51892415-51892437 GTGCAGTTTTAGAGCTTAAAAGG + Intronic
973681290 4:53323298-53323320 CTGTAGTTCTAGAGTATCAAAGG - Intronic
973786904 4:54340953-54340975 GTGCTGGTCTAGACTCTTAAGGG - Intergenic
973866518 4:55119645-55119667 GTGCATATCTGGAGTATTAAGGG + Intronic
977212514 4:94235992-94236014 CTTCAGTTCTAGAAATTTAAAGG + Intronic
978986913 4:115024248-115024270 CTACAGTTCTAGGGTTTTCAAGG - Intronic
981212360 4:142122974-142122996 GTGCAGTTCTAGACATTACAGGG + Intronic
982879685 4:160697135-160697157 GAACAATTCTAGAGTTCTAATGG + Intergenic
984234045 4:177134785-177134807 GTGTTCTTCTAGAGTTTTTATGG - Intergenic
986952626 5:13109067-13109089 CAGCAGTTCTTCAGTTTTAATGG + Intergenic
988355398 5:30167391-30167413 GTTAAGTTCTAGAATTTTTATGG + Intergenic
988682567 5:33498192-33498214 GCTCAGTTCTAGTCTTTTAAAGG + Intergenic
989730964 5:44648129-44648151 GTGCAGTTCTAGTTTCCTAATGG + Intergenic
989831292 5:45922862-45922884 GTTTTGTTCTAGAGTTTTTATGG + Intergenic
990355612 5:54963334-54963356 GTTCAGTTCTTCATTTTTAAAGG - Intergenic
991098159 5:62761629-62761651 ATGCAGTTCTAAAATTTTGACGG - Intergenic
993342848 5:86746038-86746060 TTGCAATTTTAGAGTTTGAATGG - Intergenic
993493533 5:88581634-88581656 ATGCAGGTCAAGATTTTTAAAGG + Intergenic
993495071 5:88599786-88599808 GTGAAGTACTTGAGTTTTATAGG - Intergenic
997033711 5:130161458-130161480 ATCAAGTTCTAAAGTTTTAAAGG + Intronic
998828857 5:146135960-146135982 GTGGTGTTCTAGAGTTATAGTGG - Intronic
999048591 5:148496646-148496668 GGGCAGCTCTAGAGCTTGAAAGG - Intronic
1001132567 5:169076695-169076717 AACCAGTTCTAGAGTTTTCAAGG - Intronic
1003249896 6:4417261-4417283 GTGAAGTTCTAGAGTTGTTCAGG + Intergenic
1011273790 6:85607447-85607469 GTGCAGTTTTTGAGTTTTCAGGG - Intronic
1012318269 6:97808150-97808172 CTCAAGTTCTAGAGTTTTGAGGG - Intergenic
1015347486 6:132176683-132176705 TTGGAGTTCTAGAGCTTTAGTGG - Intergenic
1015473135 6:133629026-133629048 CTGCTGGTCTAGAGTTCTAAAGG + Intergenic
1021146983 7:17101208-17101230 GTTCTGTTCTAGTGCTTTAAGGG + Intergenic
1023257133 7:38323159-38323181 GTGCAGTGCAAGAGTTTTGCTGG - Intergenic
1024474399 7:49794923-49794945 GTGCATATTGAGAGTTTTAAAGG - Intronic
1026402762 7:70032340-70032362 TTGCATTTTTAGAATTTTAAAGG + Intronic
1028319818 7:89446144-89446166 GGGCAGTTCTTGAGTTAGAATGG + Intergenic
1029841839 7:103372825-103372847 GTGAATTTTTATAGTTTTAATGG - Intronic
1030019885 7:105262950-105262972 GTGCAGTTGCTGAGTTTTAGTGG - Intronic
1033799571 7:144884272-144884294 TTGCTGTGCTTGAGTTTTAATGG + Intergenic
1040627833 8:49172266-49172288 GTGGACTTCTAGATTTCTAAGGG + Intergenic
1045634476 8:104167779-104167801 GTTGTGTTCTAGAGTTTTTATGG + Intronic
1051938635 9:22475802-22475824 TTGCAGTTTTAGATTTATAAAGG + Intergenic
1055278950 9:74651756-74651778 CTGCAGTTGATGAGTTTTAAGGG - Intronic
1055943632 9:81673473-81673495 GAGCAGGGGTAGAGTTTTAAAGG + Intronic
1059364400 9:113774773-113774795 GTGAATTTCAAGAGCTTTAATGG - Intergenic
1060915005 9:127383154-127383176 GTGAAGTTCTACAGATTAAATGG + Intronic
1062723501 9:138057978-138058000 GTGCAGGTCTTGAGTTCTTAGGG + Intronic
1203381283 Un_KI270435v1:47548-47570 TTCCAGTTCTACAGTGTTAAAGG + Intergenic
1203366186 Un_KI270442v1:259054-259076 GTCTAATTCTAGAGTTTTTATGG - Intergenic
1186820578 X:13283912-13283934 GTGCAGCTTTAGAAATTTAATGG + Intergenic
1188323665 X:28772841-28772863 GGCAAGTTTTAGAGTTTTAAGGG - Intronic
1188786895 X:34357731-34357753 GTGTAGTTTTAGAATTTTGAAGG - Intergenic
1190132326 X:47760112-47760134 GAACAGTTTAAGAGTTTTAAAGG + Intergenic
1190638115 X:52456267-52456289 GTTCAGTGCTAGGGTTTTGATGG + Intergenic
1190678542 X:52804181-52804203 GTTCAGTGCTAGGGTTTTGATGG - Intergenic
1190975078 X:55391103-55391125 GTTATGTTCTAGAGTTTTTATGG - Intergenic
1191177633 X:57522199-57522221 GTTTTGTTCTAGAGTTTTTATGG + Intergenic
1191597515 X:62961794-62961816 GTTTTCTTCTAGAGTTTTAATGG + Intergenic
1193688210 X:84605398-84605420 GTGCTCTTCTAGGGTTTTTATGG + Intergenic
1197909577 X:131466097-131466119 GTGCTCTTCTAGGGTTTTTAAGG - Intergenic
1198239771 X:134773023-134773045 GTCCAGATCTGGAGTTTTACTGG - Intronic
1201794869 Y:17884140-17884162 GTGCAGTTATACAGGGTTAAGGG - Intergenic
1201806686 Y:18021845-18021867 GTGCAGTTATACAGGGTTAAGGG + Intergenic
1202356241 Y:24051919-24051941 GTGCAGTTATACAGGGTTAAGGG - Intergenic
1202514537 Y:25618190-25618212 GTGCAGTTATACAGGGTTAAGGG + Intergenic