ID: 955632984

View in Genome Browser
Species Human (GRCh38)
Location 3:60994863-60994885
Sequence CCAGCCAGTCGTTCCCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955632984 Original CRISPR CCAGCCAGTCGTTCCCATGA AGG Intronic
900155957 1:1203362-1203384 CCAGCCAGGAGTTCCCAGAATGG + Intergenic
901679035 1:10902550-10902572 GCAGCCAGTAGCTTCCATGAAGG + Intergenic
901843113 1:11965915-11965937 CCAGCCTGTCTTACCCATGAGGG + Intronic
903511045 1:23875093-23875115 ACAGCAAGTCCATCCCATGAGGG + Exonic
903728815 1:25474140-25474162 ACAGCCAGTTGTTGCCATGGGGG + Intronic
908431651 1:64064403-64064425 CCAGCCAGTTTCTCCCATTAGGG + Intronic
908549048 1:65191021-65191043 CAAGTCAGTGGTTCTCATGATGG - Intronic
913538836 1:119799677-119799699 CCAGCCTGGCTTTCCCAAGAGGG + Intronic
917728636 1:177852063-177852085 CCAGCCTCTCTTTCCCATCATGG + Intergenic
919906913 1:202084858-202084880 CCAGCCAGTCTTTCCTGTGTGGG + Intergenic
921425933 1:215001100-215001122 CCAGCCAGTGGTTTCCCTGAAGG - Intergenic
1063171075 10:3510510-3510532 CCAGCCAGTCCCTCTCATGCCGG - Intergenic
1067399177 10:45955395-45955417 CCAACCACCCGTTCCCATCATGG - Intergenic
1067867495 10:49924611-49924633 CCAACCACCCGTTCCCATCATGG - Intronic
1074790391 10:116880853-116880875 CCAGCCAGACGTTACCACGAGGG + Intronic
1075269018 10:121032915-121032937 CCACCCAGTAGTTCCCATTAGGG - Intergenic
1075445363 10:122509329-122509351 CCCTCCAGTCGCTCCCTTGACGG - Intronic
1080554287 11:33401982-33402004 CCAGCCAGTTGTTCCCGTGGGGG + Intergenic
1080708276 11:34720234-34720256 ACAGCCAGTTACTCCCATGATGG + Intergenic
1083083112 11:60114019-60114041 CCAACCAGTCTTTCCAATCATGG + Intergenic
1083326280 11:61874558-61874580 CCCGCCAGTCATTCCCAGTAGGG + Intronic
1084769096 11:71331153-71331175 CCAGCCCCTCCTTCCCATGTGGG + Intergenic
1086083670 11:82932539-82932561 ACAGCCAGCAGTTCCCAGGATGG + Exonic
1092458447 12:8665651-8665673 CGCGCCAGTCAGTCCCATGAGGG - Intergenic
1093017702 12:14171339-14171361 CCAGCAAGTCTTTCCTCTGAAGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1108493651 13:51004485-51004507 CCATCCAGTCCTTCACATGATGG - Intergenic
1109597434 13:64574712-64574734 CCTGGCACTGGTTCCCATGAAGG + Intergenic
1114065861 14:19059521-19059543 GCAGGCAGTCGTCCCCTTGATGG - Intergenic
1114096406 14:19340504-19340526 GCAGGCAGTCGTCCCCTTGATGG + Intergenic
1120825241 14:88948969-88948991 TCAGCCAGTCTATCCCAGGAGGG - Intergenic
1121156556 14:91690471-91690493 CCATCCAGAAATTCCCATGAAGG - Intronic
1124007205 15:25803754-25803776 ACACCCAGTCTTTACCATGATGG + Intronic
1131181662 15:90244199-90244221 CCAGTCAGTGGTTCCCATGGTGG + Exonic
1132661217 16:1062349-1062371 CCAGCCAGTGGGTGCCAGGAAGG - Intergenic
1133989248 16:10691985-10692007 GCAGCCACTGGTTCCCTTGATGG - Intronic
1135282524 16:21165032-21165054 CCAGCCAGTCTGTCCCAGGAGGG - Intronic
1136049157 16:27638338-27638360 CCAGCCTGTCTTCCTCATGACGG - Intronic
1137468839 16:48736353-48736375 CCAGCCTGTGGTAACCATGAAGG - Intergenic
1141049403 16:80746953-80746975 CCAGCCAGTTGTTACCATATTGG - Intronic
1142123644 16:88399539-88399561 CCAGCCTGGCCCTCCCATGAAGG - Intergenic
1147684225 17:42277023-42277045 CCAGCCAGATTTTCCCAGGAAGG - Intergenic
1149422243 17:56521936-56521958 ACAGCCAGCCCTACCCATGAGGG + Intergenic
1151582731 17:74989231-74989253 CCAGCCAGTCTTGGCCATGTGGG - Intronic
1152862259 17:82703247-82703269 CCCGCCAGTGGTTCCCACGCTGG + Intergenic
1153433004 18:5039276-5039298 CCAACCCCTCCTTCCCATGATGG + Intergenic
1156940083 18:42756470-42756492 GCAGCCAGTAGTTGCTATGAAGG + Intronic
1157539065 18:48486399-48486421 CCAGCCAGCCCTGGCCATGATGG + Intergenic
1159516184 18:69461394-69461416 CCTGCCAGCTGTTCCCATGGTGG - Intronic
1161241553 19:3226010-3226032 CCAGCCCTTGGTTCCCATCATGG + Intronic
1161539969 19:4844655-4844677 CAAGCCAGAGGTACCCATGAGGG - Exonic
926172380 2:10560487-10560509 CCAGCCAGTGGTTCTCAGGTGGG + Intergenic
927131841 2:20066648-20066670 CCAGGCTGTGGTTACCATGATGG - Intergenic
929923839 2:46193329-46193351 CAAGCCAGTCTTTCCCATGGTGG - Intergenic
931643460 2:64401150-64401172 CCAGCGAGTGCTTCCCATGCAGG - Intergenic
933717421 2:85371525-85371547 CCTCCCAGTGGTTTCCATGAAGG - Exonic
935671976 2:105563624-105563646 CCAGCCATTCCTTCCAATGAGGG + Intergenic
937311192 2:120904478-120904500 CCAGGCAGACGTTCTCCTGATGG - Intronic
937974343 2:127572982-127573004 CCAACCAGTCGCCCCCATGATGG + Intronic
938262404 2:129905334-129905356 CCTGCCAGGTGTTCCCATGCGGG - Intergenic
938727701 2:134121554-134121576 CCTGGCAGTCGGTCCCAGGAGGG - Intronic
941918170 2:170825541-170825563 CCAGCCAGTTGTTGCCAAGTGGG - Intronic
942068307 2:172292726-172292748 CCTGCCAGTTGTTGCCATGCAGG - Intergenic
944180591 2:196888286-196888308 CCAGTCAGTCTTTCACTTGATGG - Intronic
947846436 2:233247887-233247909 CCAGCCAGTCATTCCCCTCAGGG + Intronic
1168818562 20:757746-757768 CCAGTCAGTCCCTCCCAGGAAGG - Intergenic
1169968142 20:11239758-11239780 CCAGCCAGTTATCTCCATGAAGG + Intergenic
1179430566 21:41318320-41318342 TCAGGCAGACGTTCCCAGGAGGG + Intronic
1179974910 21:44859261-44859283 CCAGTCAGTGGCTCCCATGGGGG + Intronic
1180484342 22:15782113-15782135 GCAGGCAGTCGTCCCCTTGATGG - Intergenic
1184664361 22:45979305-45979327 CCAGCGAGTCGCTCCCACCACGG + Intergenic
949797019 3:7862577-7862599 CCAGCCAGTCGCTCCCTCTAAGG - Intergenic
951698306 3:25468761-25468783 GCAGTCAGTCTTTCCCAAGAAGG + Intronic
955632984 3:60994863-60994885 CCAGCCAGTCGTTCCCATGAAGG + Intronic
958797917 3:98726003-98726025 CCTTTCATTCGTTCCCATGATGG - Intergenic
962164868 3:133038457-133038479 CCCCCCAGTCCTTCCCATGCTGG + Intronic
967257886 3:187611940-187611962 CCAGCCAGTAGTTCCCCTGTAGG + Intergenic
968940170 4:3633588-3633610 CCATCCAGGGGTTCCCATGTGGG - Intergenic
977080136 4:92516172-92516194 CTAGCCAGTCTTTCCCTTTAGGG - Intronic
978194275 4:105952889-105952911 TAAGCCAATGGTTCCCATGAAGG - Intronic
979488666 4:121298511-121298533 TCAGCCAGATGTTTCCATGATGG - Intergenic
980145213 4:128974425-128974447 CCAGGCAGGAGTTCCCATCAGGG - Intronic
984141974 4:176014431-176014453 GGAGCCAGTCGTTGCCATTATGG + Intergenic
984864718 4:184271857-184271879 CCAGCCTGGCTTTCCCATGCTGG + Intergenic
986030741 5:3890483-3890505 CCCTCCATTCGTTCCCATGTGGG + Intergenic
994353372 5:98770302-98770324 CCAGCCACTCGCTCCCAAGAAGG - Intronic
994876293 5:105426527-105426549 CAAGCAGGTAGTTCCCATGAAGG + Intergenic
995920286 5:117304161-117304183 CAAACCAGTAGTTCCCCTGAGGG + Intergenic
997346907 5:133198702-133198724 CCAGCCAGACTTTGCCCTGACGG - Exonic
1001577586 5:172774189-172774211 CCACCCCCTCCTTCCCATGATGG + Intergenic
1004871990 6:19914536-19914558 CCAGCAAGCAGCTCCCATGATGG + Intergenic
1005711139 6:28503721-28503743 CCACCCAGTAGTTCTCATGTAGG - Exonic
1006946123 6:37785501-37785523 CCACCCAGCCGTTCCCATGTGGG - Intergenic
1013835348 6:114328426-114328448 CCAGCCATTGGTTCCCATTCTGG - Intronic
1018180739 6:161221211-161221233 CTAGCCAGTGGTTGCCATGCTGG - Intronic
1022431656 7:30328938-30328960 ACAGGCAGTCCTTCACATGAAGG - Intronic
1030247327 7:107397841-107397863 CCTGTCAGTCTTTCCCATAATGG - Intronic
1031072470 7:117177447-117177469 CCAGCCAGCCATTACCATCAGGG + Intronic
1031845004 7:126794878-126794900 CTAGCCAGTGGTTCCCAAGTCGG + Intronic
1032203223 7:129838454-129838476 CTAGCCAGTTTTTCACATGATGG - Intronic
1034350715 7:150413091-150413113 CCAGCCAGGCATTCCATTGACGG - Intergenic
1034392697 7:150799702-150799724 CCAGCCAGACCTTCCCTTGACGG + Intronic
1037174755 8:15933470-15933492 CCAACCACTCGTTCCCATCATGG + Intergenic
1040097629 8:43462049-43462071 CCACCCAGGCTTTCTCATGAAGG + Intergenic
1041171267 8:55144486-55144508 CCAGGCAACCGTTGCCATGATGG + Intronic
1042422637 8:68609828-68609850 CCAGCCACTAGTTTCCAGGAAGG + Intronic
1046818034 8:118606956-118606978 CCAGCCAGGTGGTACCATGAGGG - Intronic
1047308911 8:123676138-123676160 CCAACCCGTCCTTCCCATGGGGG - Intergenic
1054450585 9:65401709-65401731 CCATCCAGGGGTTCCCATGTGGG + Intergenic
1056424607 9:86464534-86464556 CCAGCCTGTCCTTCCCTTCAGGG + Intergenic
1056997247 9:91474417-91474439 CCTGGCACTAGTTCCCATGAAGG + Intergenic
1058541307 9:106015145-106015167 CTAGTCAGTTGTTACCATGAGGG + Intergenic
1059667793 9:116465349-116465371 CCAGCCAGTTGCTCCCATTCTGG - Intronic
1061195225 9:129103621-129103643 CCAGCCACTGGTCCCCATGGTGG - Intronic
1062140745 9:134957436-134957458 CCAGCCAGACTTTCCAGTGAGGG - Intergenic
1062432012 9:136530428-136530450 GCAGACAGCCGTTCCCATGTCGG - Intronic
1062717316 9:138017765-138017787 CCAGCCAGTCACTCCCTGGAGGG - Intronic
1190010444 X:46780198-46780220 GCAGCAAGTCCTTCCCTTGAGGG - Intergenic
1192921081 X:75707140-75707162 CCAGCCAGTCCTTCCATTCAGGG - Intergenic
1193044470 X:77036903-77036925 CCAGCCAGTCTCTCCAATCAGGG + Intergenic
1193358717 X:80555115-80555137 TCAGTCAGTCTTTCCCCTGAGGG - Intergenic
1195178869 X:102338027-102338049 CCAGCCAGTTGTTTCCTTAAGGG + Intergenic
1195179995 X:102349056-102349078 CCAGCCAGTTGTTTCCTTAAGGG - Intergenic