ID: 955633559

View in Genome Browser
Species Human (GRCh38)
Location 3:61000857-61000879
Sequence CTCTACCACTAGGGCAGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955633547_955633559 8 Left 955633547 3:61000826-61000848 CCTAGTGGGGAAGCCCCAGCCCC 0: 1
1: 0
2: 1
3: 35
4: 325
Right 955633559 3:61000857-61000879 CTCTACCACTAGGGCAGCGATGG 0: 1
1: 0
2: 0
3: 3
4: 87
955633550_955633559 -7 Left 955633550 3:61000841-61000863 CCAGCCCCAGCCCCTACTCTACC 0: 1
1: 0
2: 6
3: 85
4: 919
Right 955633559 3:61000857-61000879 CTCTACCACTAGGGCAGCGATGG 0: 1
1: 0
2: 0
3: 3
4: 87
955633549_955633559 -6 Left 955633549 3:61000840-61000862 CCCAGCCCCAGCCCCTACTCTAC 0: 1
1: 0
2: 4
3: 76
4: 765
Right 955633559 3:61000857-61000879 CTCTACCACTAGGGCAGCGATGG 0: 1
1: 0
2: 0
3: 3
4: 87
955633546_955633559 18 Left 955633546 3:61000816-61000838 CCAGTAGAGACCTAGTGGGGAAG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 955633559 3:61000857-61000879 CTCTACCACTAGGGCAGCGATGG 0: 1
1: 0
2: 0
3: 3
4: 87
955633548_955633559 -5 Left 955633548 3:61000839-61000861 CCCCAGCCCCAGCCCCTACTCTA 0: 1
1: 0
2: 13
3: 114
4: 1079
Right 955633559 3:61000857-61000879 CTCTACCACTAGGGCAGCGATGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955633559 Original CRISPR CTCTACCACTAGGGCAGCGA TGG Intronic
902963456 1:19980726-19980748 TTCTACCAGTGGGGCAGGGAAGG - Intergenic
904251917 1:29231034-29231056 CGCCACCACTTGGGCAGCGAAGG - Intergenic
910341530 1:86193808-86193830 CTCTACAACTGGAGCAGCTAAGG - Intergenic
914437093 1:147670058-147670080 CTCAACCCGGAGGGCAGCGAGGG - Exonic
914983697 1:152438866-152438888 CACTACCCTTAGGGCACCGAAGG + Intergenic
916383628 1:164242115-164242137 CTCTATCACAAGAGCAGCAAGGG - Intergenic
920287183 1:204888891-204888913 CTCTAACTCTAGGGCAGCACAGG - Intronic
1063575692 10:7260110-7260132 TACTACCACTATGGCAGCAATGG + Intronic
1068449468 10:57166784-57166806 CTCTATCACAAGGACAGCAAGGG + Intergenic
1072753300 10:97999642-97999664 CCCTACCTTTAGGGCAGGGAGGG + Intronic
1074395798 10:113097012-113097034 GGCTACCACTAGGACAGGGATGG - Intronic
1075691856 10:124401720-124401742 CTTTACCTCAAGGGCTGCGATGG + Exonic
1079392612 11:20035623-20035645 CTCTGCCACTAGGCCTGGGAAGG + Intronic
1083892103 11:65600614-65600636 CTAGACCACTTGGGCAGGGATGG + Intronic
1084149770 11:67282629-67282651 CCCTACCACCAAGGCAGCTATGG - Intronic
1087895323 11:103579846-103579868 CTCTACCACAAGAGCAGCATGGG - Intergenic
1089248132 11:117137408-117137430 CTCATCCCCTAGGGCAGCAAGGG - Intergenic
1089258581 11:117207153-117207175 CTCATCCCCTAGGGCAGCAAGGG + Exonic
1096709243 12:53443379-53443401 TTCTTCCACCAGGGCAGCCAGGG + Exonic
1105748022 13:23395301-23395323 CTCCACCACTAGGGCCACTAGGG + Intronic
1107560978 13:41557098-41557120 CCCATCCACTAGGACAGCGATGG + Intergenic
1110690057 13:78422491-78422513 CTATACCAGAAGGGCAGTGACGG + Intergenic
1114355926 14:21907979-21908001 CTCTACTCCTAGGGCAGGGTAGG - Intergenic
1124961918 15:34404797-34404819 ATCTACCACTAAGGCAGGAATGG + Intronic
1124978541 15:34551018-34551040 ATCTACCACTAAGGCAGGAATGG + Intronic
1125302473 15:38270637-38270659 CTCTATCACAAGAACAGCGAGGG + Intronic
1125611254 15:40972402-40972424 CTCTCTCACTAGGGGAGGGAAGG + Intergenic
1132770989 16:1563182-1563204 CTCCACCACCAGAGCAGGGAGGG - Intronic
1133757715 16:8775079-8775101 CTCTACATCCAGGGCAGAGAAGG + Intronic
1134807290 16:17136941-17136963 CTCTGCGATTAGGGCAGTGAGGG + Intronic
1137927920 16:52558778-52558800 CTCTTCCACTAGAGCTGCTAAGG - Intergenic
1146492002 17:33290372-33290394 CTTTTCCACTAGTGCAGGGAAGG - Intronic
1151512598 17:74570429-74570451 CTGTCCCTCAAGGGCAGCGATGG - Intergenic
1155929130 18:31686891-31686913 GTCTACCACTAGGTCAGCAAAGG - Intergenic
1158054700 18:53264586-53264608 CTCTTCCACAAGGTCAGAGATGG + Intronic
1163446907 19:17352361-17352383 CTCAGCCACTAGGGCAGGAAGGG + Exonic
924978933 2:202723-202745 CTCTATCACGAGAACAGCGAGGG - Intergenic
926636825 2:15189199-15189221 CTCTACCTTTGTGGCAGCGATGG - Intronic
927090353 2:19706006-19706028 CCATAGCACTAGGGCAGGGAGGG - Intergenic
927957431 2:27217550-27217572 CTCCAACACTAGGGCCGCCATGG - Exonic
928108164 2:28486185-28486207 CTCTTTCACTAGGCCAGAGAAGG + Intronic
930688974 2:54339618-54339640 CACAAACACTAGGGCAGCTAAGG - Intronic
934714288 2:96534566-96534588 CTTTACCTCTGGGGCAGGGAGGG + Intergenic
937264024 2:120604900-120604922 CACTACCACCCTGGCAGCGATGG - Intergenic
938744542 2:134264845-134264867 CTCTGCCTCTCGGGCAGCCATGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1176236566 20:64056364-64056386 CCCCACCAGCAGGGCAGCGACGG - Intronic
1176299318 21:5091087-5091109 CTCTCCCACTGAGGCAGCGGGGG + Intergenic
1178916300 21:36707414-36707436 CTCCACCACGGGGGCAGCGGTGG - Intronic
1179372975 21:40824165-40824187 ATCTGCCACTAGGACAGTGATGG - Intronic
1179857708 21:44170860-44170882 CTCTCCCACTGAGGCAGCGGGGG - Intergenic
1180113155 21:45675256-45675278 CTCTACCTCTTGGGCAGCTGAGG + Intronic
1180736890 22:18024089-18024111 CTTTCCCACTAGGGGAGAGAGGG + Intronic
1183355071 22:37354210-37354232 CTCTCCCTCGAGGGCTGCGAGGG - Intergenic
1184530022 22:45049474-45049496 CTCTTCCACCAGGGCATCCACGG - Intergenic
1203245703 22_KI270733v1_random:67152-67174 CTTTACCACCAGGACAGAGAGGG - Intergenic
950670183 3:14521273-14521295 CTCTCTCACTAGGGGAGTGAGGG - Intronic
952011860 3:28908786-28908808 CTCTATCACGAGGACAGCAAGGG - Intergenic
955633559 3:61000857-61000879 CTCTACCACTAGGGCAGCGATGG + Intronic
957711193 3:83861169-83861191 CTCTATCACAAGAGCAGCAAGGG + Intergenic
959739847 3:109705384-109705406 CTCTATCACAAGAGCAGCAAGGG + Intergenic
961678459 3:128582980-128583002 CTCTACAACTCGGGCAAAGAAGG - Intergenic
969611247 4:8228820-8228842 CTCCCCCAGTAGGGCAGAGAGGG - Intronic
973771305 4:54209446-54209468 CTCAACTACTAGGGAAGCTAAGG + Intronic
976389341 4:84493232-84493254 CTCCACCTCTGGGGCCGCGAGGG - Exonic
993738381 5:91505728-91505750 CTCTTTGACTAGGGCAGGGATGG + Intergenic
999353856 5:150905021-150905043 CTGTACCACAGCGGCAGCGAAGG + Intergenic
1006445150 6:34075957-34075979 CTCTGCCACTAGCCCAGCGCTGG - Intronic
1011163766 6:84422409-84422431 CTCAACCACTGGTGCAGAGAAGG + Intergenic
1018377528 6:163227327-163227349 CTCACTCACTAGGGCAGGGATGG + Intronic
1019502973 7:1374557-1374579 CACTACCACGAGGACAGCAAAGG + Intergenic
1027598876 7:80213321-80213343 CTCTTCCAGAAGGGCAGGGAAGG + Intronic
1028339135 7:89695773-89695795 CACTACCACTATGGCTGCGCTGG - Intergenic
1029494396 7:100889390-100889412 TACTACCACTACGGCTGCGACGG - Exonic
1032378538 7:131449917-131449939 CTCTACTCCTAGGGTAGCCATGG - Intronic
1032733461 7:134667455-134667477 CTCAACTACTAGGGAAGCGGAGG + Intronic
1041076759 8:54176146-54176168 CTCGACCCCTAGGGGAGAGAGGG + Intergenic
1046097108 8:109575272-109575294 ATCAACCACTAAGGCAGAGAGGG + Exonic
1046646030 8:116786593-116786615 CTCTACCACCAGAGCAGAGTTGG - Intronic
1048705446 8:137148160-137148182 CTCTATCACTAGAACAGCAAAGG + Intergenic
1051374275 9:16388225-16388247 CCCTCCCACTAGGGCAGCTGAGG + Intergenic
1052717511 9:32134775-32134797 CTCTGCCACTAGGACAGCAAAGG + Intergenic
1054869571 9:70036873-70036895 CTCTGCCCCGAGGCCAGCGATGG - Intergenic
1058147638 9:101429807-101429829 CTCTACCAGAAGGACAGCCAGGG - Exonic
1203462039 Un_GL000220v1:50224-50246 CTTTACCACCAGGACAGAGAGGG - Intergenic
1185550636 X:980707-980729 CTCAACCACTGGGGCTGCCATGG + Intergenic
1189396062 X:40623869-40623891 CTCTACTACTACGGCGGCGGCGG + Intergenic
1194755068 X:97729498-97729520 ATCTACCACTGTGGCAGCAAAGG - Intergenic
1201741858 Y:17332720-17332742 CTCTCCCGCTATGGCAGCAAAGG - Intergenic
1202364017 Y:24142586-24142608 ATCTACCACTAAGGCAGGAATGG - Intergenic
1202506763 Y:25527536-25527558 ATCTACCACTAAGGCAGGAATGG + Intergenic