ID: 955634192

View in Genome Browser
Species Human (GRCh38)
Location 3:61008079-61008101
Sequence GATTAGTAAGAGAGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955634192_955634197 5 Left 955634192 3:61008079-61008101 CCAAGAGCCCTCTCTTACTAATC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 955634197 3:61008107-61008129 CACACCCATCTCCAGTTCTAGGG 0: 1
1: 0
2: 0
3: 17
4: 162
955634192_955634196 4 Left 955634192 3:61008079-61008101 CCAAGAGCCCTCTCTTACTAATC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 955634196 3:61008106-61008128 GCACACCCATCTCCAGTTCTAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955634192 Original CRISPR GATTAGTAAGAGAGGGCTCT TGG (reversed) Intronic
902062270 1:13655695-13655717 AAGTAGTAAAAGAGAGCTCTGGG + Intergenic
902068417 1:13710210-13710232 GATTGGTAATAGAGGGTGCTGGG + Intronic
904352578 1:29918533-29918555 GATTAGTAAGGGAGGGTTTAGGG + Intergenic
908231228 1:62106978-62107000 GATTAGAAACAGAGGTCTATGGG - Intronic
908297526 1:62727932-62727954 GCTTAGCCAGAGAGGGTTCTTGG + Intergenic
908721384 1:67129793-67129815 GATTGGTAAGTGAAGGCTGTGGG - Intronic
908725366 1:67170339-67170361 GATTAGGAACAGAGGACTGTAGG - Intronic
910334077 1:86108479-86108501 GCTTATTAAGAAAGGACTCTCGG + Intronic
911218289 1:95219352-95219374 CATTAGGCTGAGAGGGCTCTGGG + Intronic
912514133 1:110207509-110207531 GAATAGGAAGAGAGGGCCATGGG - Intergenic
915676737 1:157539027-157539049 GTTGGGTAAGAGAGGACTCTTGG + Intronic
917653568 1:177103419-177103441 GATTAGCAGGATAGGGCACTGGG + Intronic
917756327 1:178102763-178102785 GAAGAGTAAGAGAGAGCTCATGG - Intronic
918877291 1:190064174-190064196 GATTAGTAACAGATGGATCGGGG + Intergenic
920424405 1:205862504-205862526 CACCAGGAAGAGAGGGCTCTGGG + Intergenic
922195836 1:223359874-223359896 AATGAGTAAGAGAGAGTTCTAGG + Intronic
924198599 1:241637568-241637590 GCTTAGAAAGACAGGGCTCAGGG + Intronic
924597338 1:245458773-245458795 CATTAGTAAATGAGGGCCCTTGG - Intronic
1063688578 10:8261785-8261807 GAGAAGTAAGACAGGGCTTTAGG + Intergenic
1066377570 10:34871535-34871557 GATTCGTAAGAGAGGTCACAGGG + Intergenic
1071576267 10:86729027-86729049 AATTAGTAAGAGAAAGATCTGGG + Intronic
1072721918 10:97786485-97786507 TATTGGAAAGAGACGGCTCTAGG + Intergenic
1072760373 10:98051616-98051638 TGTGAGTAAGAGAGGGTTCTAGG - Intergenic
1073639378 10:105235097-105235119 GATTAGCTAGAGTGGGCTGTAGG + Intronic
1074960501 10:118440727-118440749 AATTGGTAAGAGAGGGGTTTGGG + Intergenic
1075950704 10:126475277-126475299 GATCAGTGAGTGAGGGCTCATGG + Intronic
1077368424 11:2170668-2170690 GGTAAGTAAGAGGGGACTCTGGG - Exonic
1078636092 11:13051627-13051649 AATTTGTAAGAGAGTTCTCTAGG - Intergenic
1079310147 11:19358158-19358180 AATTAGAAAGAGAGGGATGTGGG + Intronic
1079572809 11:21965613-21965635 GATGAGTAAGAGAGGAGTTTTGG - Intergenic
1080195469 11:29603510-29603532 CATTAGGAAGTGAGGGCTTTGGG + Intergenic
1083608229 11:63991856-63991878 GATAAGCCAAAGAGGGCTCTGGG + Intronic
1083695932 11:64442408-64442430 GATTAGTAAGAGAGAATTCGAGG - Intergenic
1085344707 11:75761070-75761092 TGTTAGTAAAAGAGGGTTCTGGG - Intronic
1088549059 11:110991887-110991909 GCTTAGCAACAGAGAGCTCTAGG - Intergenic
1089018439 11:115186647-115186669 GATTGTTAAGGAAGGGCTCTTGG - Intronic
1089760985 11:120723192-120723214 GATTCCTAAAGGAGGGCTCTTGG + Intronic
1090002341 11:122972478-122972500 GAGTAATAAGAGAAGGCTCATGG + Intergenic
1092380760 12:7995152-7995174 GAAAAGTAGCAGAGGGCTCTAGG - Intergenic
1093706709 12:22282581-22282603 GAGTAGGAAGACAGGGGTCTGGG + Intronic
1095270227 12:40209992-40210014 AACTAGGAAGACAGGGCTCTGGG - Intronic
1097929529 12:65169291-65169313 GTTTAGTAAGAGACAGCTCCCGG + Intergenic
1100671994 12:96823764-96823786 GTTCTGTAAGAGAGGGCTGTGGG + Intronic
1100914095 12:99398735-99398757 GATTGGTAAGTGATGGCTATGGG - Intronic
1101295660 12:103421099-103421121 GATGAGTAAGACAGGCTTCTTGG - Intronic
1101351697 12:103935711-103935733 GCTTAAAAAGAGAGGGCACTGGG - Intronic
1105630598 13:22161251-22161273 CACAAGTTAGAGAGGGCTCTGGG - Intergenic
1105658824 13:22470664-22470686 GATTAGGAAGAGTGGGCTTTGGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1114942676 14:27634428-27634450 AATTTGTAATAGAGGGGTCTTGG + Intergenic
1115648152 14:35384407-35384429 AATCAGGAAGTGAGGGCTCTGGG - Intergenic
1117380450 14:55156855-55156877 GGAGAGTAAGAAAGGGCTCTTGG + Intronic
1118041452 14:61921394-61921416 GATTAGTAACAGAAGGCTCCTGG - Intergenic
1118792953 14:69112437-69112459 ATTTAGTAAGAGAGGGAACTGGG + Intronic
1118824407 14:69367309-69367331 TATTAGAAAGTGGGGGCTCTTGG + Intergenic
1119938314 14:78614076-78614098 GATTAGTAACAAACAGCTCTTGG - Intronic
1122004750 14:98692912-98692934 GATTAGTAAGACTGAGGTCTGGG - Intergenic
1123692505 15:22850309-22850331 CAGAAGTAAGAGAGGCCTCTAGG + Intronic
1126425673 15:48524695-48524717 GGGTAGTGAGAGAGGGATCTGGG - Intronic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1129360756 15:75022484-75022506 CCTTAGTAAAAGAGGGCTCGTGG - Intergenic
1134641510 16:15832814-15832836 GATTAGTAGCAAAGGGCTCTTGG - Intronic
1136096676 16:27962022-27962044 GGAGATTAAGAGAGGGCTCTGGG - Intronic
1136626611 16:31465777-31465799 GGTGAGTGAGACAGGGCTCTGGG - Intronic
1138249367 16:55490336-55490358 GATGGGGGAGAGAGGGCTCTGGG - Intronic
1139021973 16:62761035-62761057 GGTTCATAAGAGAGTGCTCTTGG - Intergenic
1139743332 16:69054327-69054349 GAGTAGTAGAAGAGGGCTCAGGG + Intronic
1203050643 16_KI270728v1_random:872406-872428 GATCAGTGAGAGAGCGTTCTTGG + Intergenic
1142667219 17:1470077-1470099 GATTGGTCAGGGAGGGCTCACGG - Intronic
1143112524 17:4560360-4560382 GGTAAGTAAGGGAGGGGTCTGGG - Exonic
1145046756 17:19624350-19624372 GATAAGTGGGAGAGGGCACTGGG + Intergenic
1145771320 17:27495249-27495271 GATCAGTATTAGAGGGCTCAGGG - Intronic
1147715102 17:42501089-42501111 GATTAGTAAGAAAGTACTGTTGG + Intronic
1152035106 17:77867550-77867572 GAATAGTTTCAGAGGGCTCTGGG - Intergenic
1155015464 18:21834335-21834357 GATTAAGATGAGAGGGCTGTAGG + Intronic
1155060559 18:22224457-22224479 GATTTGTAAGGGAGAGCCCTGGG - Intergenic
1155254760 18:23985117-23985139 CATTAGGAAGTGAGGCCTCTGGG - Intergenic
1156210503 18:34935476-34935498 CATTATTAATAGAGGGCTTTGGG - Intergenic
1157452732 18:47800582-47800604 GAATTGTGAGAGAGGGCTTTGGG + Intergenic
1163512221 19:17742084-17742106 GCTTAGTCTGAGAGGGTTCTTGG + Intergenic
1165906548 19:39197903-39197925 GATGAGTGAGTCAGGGCTCTGGG - Intronic
1166690468 19:44819213-44819235 GATGAGTGAGAGGGGGCTCAGGG - Intronic
1168684638 19:58340882-58340904 GAGTTGTAAGAGAGGTATCTAGG - Exonic
925311996 2:2891194-2891216 GATAAGTCAGGAAGGGCTCTAGG + Intergenic
927476134 2:23415579-23415601 GATTAGTAAGGGGCAGCTCTGGG - Intronic
928328419 2:30338233-30338255 TATTAGCAAGAGAAGGCACTTGG + Intergenic
931473230 2:62561497-62561519 GATTAGGAAGTGAGAGCACTTGG - Intergenic
934030071 2:88036586-88036608 GATTAGTAAAGGAAGACTCTGGG + Intronic
938735113 2:134178687-134178709 GAGGAGTAAGAGATTGCTCTAGG + Intronic
939833046 2:147095595-147095617 GATTAGGGAGAGAGGGCGATAGG - Intergenic
939963038 2:148583053-148583075 GATCAATAAGAGAGCCCTCTGGG + Intergenic
942210237 2:173662916-173662938 GATTCAAAAGAGAGAGCTCTAGG - Intergenic
945386784 2:209210239-209210261 GCTTAGTCAGGGAGGGTTCTTGG - Intergenic
948918316 2:241049648-241049670 GATTCCTCAGAGTGGGCTCTAGG - Intronic
1169560113 20:6790708-6790730 GATTAGTGAGTGATGGCTTTAGG - Intergenic
1170258785 20:14378552-14378574 GGTTAATCAGAGAGTGCTCTTGG - Intronic
1170977271 20:21176673-21176695 GATTAATATGCTAGGGCTCTAGG + Intronic
1171067594 20:22033407-22033429 GAGCAGGAAGAGAGGGGTCTCGG - Intergenic
1171170990 20:23015206-23015228 GCTTAGCCTGAGAGGGCTCTTGG + Intergenic
1179228022 21:39473397-39473419 GATTAGTAAGTGTGTACTCTGGG + Intronic
1184077842 22:42194666-42194688 GAGAACTAAGAGAGTGCTCTTGG + Intronic
1185139378 22:49091851-49091873 GTTTAGTCAGGGAGGGTTCTTGG + Intergenic
951461425 3:22955677-22955699 GATTAGGTAGAGAGGGGTTTTGG - Intergenic
951863163 3:27276509-27276531 GATTACGAAGAAAGGGCTTTGGG + Intronic
951924003 3:27887328-27887350 GATTTAAAAGAGAGGGCTGTGGG - Intergenic
955634192 3:61008079-61008101 GATTAGTAAGAGAGGGCTCTTGG - Intronic
957242274 3:77674511-77674533 GATTAGAAAGAGAGGCCTTTGGG + Intergenic
961444679 3:126973694-126973716 GAGAAGGAAGAGATGGCTCTGGG + Intergenic
961563795 3:127749053-127749075 GCTTAGTAAGAGAGTGATCAGGG - Intronic
966756378 3:183375358-183375380 GACCTGTAAGAGAGGGTTCTTGG - Intronic
967788942 3:193526806-193526828 CTTTAGTTAGAGAGGGCTCCAGG + Intronic
971197951 4:24487228-24487250 GAGTAGGGAGAGAGGGGTCTTGG + Intergenic
971616754 4:28800294-28800316 AATTAGTAAGAGGGACCTCTAGG - Intergenic
971939231 4:33192585-33192607 TATTAGTAAAAGAGGAGTCTAGG - Intergenic
971974986 4:33673086-33673108 TATTAATAAGGGAGGCCTCTGGG - Intergenic
976210459 4:82663508-82663530 GCTTTGTAAGAGAGGGCCCTGGG - Intronic
985250575 4:188020763-188020785 GATTTTTAAGAGAGGGATTTAGG - Intergenic
986760261 5:10873908-10873930 AATTAGTAGGAGAGGACTTTGGG + Intergenic
987632814 5:20497168-20497190 AAATAGTAAGTGAGGGCTCAGGG + Intronic
988247661 5:28708366-28708388 CATTTGTAAGAAAGGACTCTGGG + Intergenic
989278218 5:39612620-39612642 GATTTCTAAAAGAGGGCTCGGGG - Intergenic
991648081 5:68821410-68821432 AATTAGTAATAGGGGGCACTTGG + Intergenic
992766222 5:80003131-80003153 TATTATTAAGAGAGGGATATAGG + Intronic
992888400 5:81181844-81181866 AATTAGAAAAAGAGGGCACTGGG - Intronic
993069034 5:83135073-83135095 GATTACTTAGAGTGGGTTCTTGG - Intronic
997575475 5:134973106-134973128 AATTACTAAGGAAGGGCTCTTGG - Intronic
1000257053 5:159549485-159549507 AATTAGTTATAGAGGGCTTTTGG + Intergenic
1001094720 5:168767410-168767432 GATAATAAAGAGAGGGATCTTGG - Intronic
1001222807 5:169917043-169917065 GAGTAGTAAGAGAGGCATATAGG - Intronic
1001564352 5:172689924-172689946 GAATAACAAGAGAGGGCCCTTGG - Exonic
1001810464 5:174623725-174623747 GGCTACTTAGAGAGGGCTCTGGG - Intergenic
1002178192 5:177414509-177414531 CATGAGGAAGAGAGAGCTCTTGG - Intronic
1002954636 6:1850074-1850096 GATTAGGAAGAAAAGGCACTGGG - Intronic
1003676163 6:8206502-8206524 GATTAATTTGAGAGGACTCTGGG - Intergenic
1005895031 6:30170727-30170749 GATCACTAAGGGAAGGCTCTGGG - Intronic
1006281569 6:33058501-33058523 GGTAAGGAAGAGAGGGCTATGGG - Intergenic
1006419891 6:33926200-33926222 GGTTATTAAGAGAGGGCCCTGGG - Intergenic
1007859841 6:44897144-44897166 GATTAGTTAGTGTGGGCTTTGGG + Intronic
1008804190 6:55407755-55407777 GATGAACAAGAGAGGGCTTTTGG + Intergenic
1011353576 6:86450241-86450263 CATGAGGAAGAGAGGCCTCTTGG + Intergenic
1011677810 6:89752466-89752488 CATTAGGAAGAGAGAGCCCTTGG - Intronic
1013925874 6:115471924-115471946 GCTTAGTAAGAGAGGCGACTAGG + Intergenic
1014497660 6:122146399-122146421 GAATAGTAAGAGAGGAATGTAGG - Intergenic
1017740378 6:157400911-157400933 GATCAATAAGACAGGGTTCTGGG - Intronic
1019221064 6:170473214-170473236 GCTTAGAAAGACAGGGCTCTAGG - Intergenic
1021229742 7:18071823-18071845 GATAAATCAGAGTGGGCTCTTGG + Intergenic
1021549746 7:21857855-21857877 GAAAAATAAGAGAGGGCTTTGGG + Intronic
1023061894 7:36335555-36335577 GACTAATAAGAGAGGCTTCTCGG + Intronic
1023637622 7:42228245-42228267 GATTGCTCAGAGACGGCTCTGGG + Intronic
1024244288 7:47457501-47457523 GATTAGGAGGAGTGGCCTCTTGG - Intronic
1024529960 7:50383484-50383506 GCAGAGGAAGAGAGGGCTCTTGG + Intronic
1026893570 7:73997279-73997301 GATGAGGAAGAGAGGGCTTCAGG + Intergenic
1027939209 7:84651848-84651870 TATTAATAACAGAGGGCTCCAGG - Intergenic
1030770253 7:113465779-113465801 GATTATTAATAGGGGGCTTTAGG + Intergenic
1033325859 7:140377901-140377923 AATTAATGAGAGAGGCCTCTGGG + Intronic
1034526747 7:151668805-151668827 GTTTATTAAGGGAGTGCTCTCGG - Intronic
1042473007 8:69212858-69212880 TATTAGAAAGCGAGGCCTCTGGG + Intergenic
1048059241 8:130900422-130900444 AATTGGTAAGAGGTGGCTCTGGG - Intronic
1048261691 8:132950517-132950539 GGGTAGTCAGGGAGGGCTCTTGG - Intronic
1050351204 9:4741900-4741922 GAGTGGGAAGAGAGGGCGCTCGG - Intronic
1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG + Intronic
1056279607 9:85028453-85028475 GGGAAGCAAGAGAGGGCTCTGGG - Intergenic
1057424269 9:94935838-94935860 GATCAGTAAGAGATGACTGTGGG - Intronic
1057522132 9:95768546-95768568 TATTAGAAAGAGAGGCCTTTGGG + Intergenic
1058555225 9:106159701-106159723 GATTAGGAAGAGAGGGATGGTGG + Intergenic
1185531219 X:820594-820616 GATTGCTAAGAGATGGCTCTGGG + Intergenic
1187847565 X:23556621-23556643 GATTGGCAAGGGTGGGCTCTAGG + Intergenic
1188524025 X:31070796-31070818 GAGTAGCAAGTGGGGGCTCTGGG - Intergenic
1189942338 X:46137712-46137734 GATGAGTTAAAGAGGCCTCTGGG + Intergenic
1190953340 X:55167662-55167684 GCTTAGCCTGAGAGGGCTCTTGG - Intronic
1191713781 X:64179805-64179827 TATTAGTAAGTGAGGCCTTTAGG + Intergenic
1195683985 X:107569457-107569479 GTTTAGTAAGAGGTGGCTCTGGG + Intronic
1195863262 X:109403565-109403587 GATTGGTAAGTGATGGCTGTAGG - Intronic
1197665174 X:129215645-129215667 GATTAGATAGAGAGAGCTATAGG - Intergenic