ID: 955635066

View in Genome Browser
Species Human (GRCh38)
Location 3:61019399-61019421
Sequence GCATGCAACAGGTGGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955635056_955635066 26 Left 955635056 3:61019350-61019372 CCTCTTGATGTCTTGAATGTTGC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 955635066 3:61019399-61019421 GCATGCAACAGGTGGGAGTAAGG 0: 1
1: 0
2: 2
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955635066 Original CRISPR GCATGCAACAGGTGGGAGTA AGG Intronic
900788318 1:4663563-4663585 GCAGGCTGCAGGTGGGAGGAGGG + Intronic
905130877 1:35756244-35756266 GAAAGCAACAGGTGGTAGCAGGG + Intronic
907352604 1:53845159-53845181 GCATGCACTGGTTGGGAGTATGG - Intergenic
908121869 1:60993492-60993514 GAATGACAGAGGTGGGAGTAGGG + Intronic
908827381 1:68146716-68146738 ACATGGCACAGGTGGGAGTCTGG + Intronic
910252696 1:85214620-85214642 GGATGCAACATGTGTGAGGAAGG + Intergenic
910524645 1:88164078-88164100 GCATGTAACTGGAGGGAGAAGGG + Intergenic
910699133 1:90053446-90053468 CCCAGCAACTGGTGGGAGTAAGG + Intergenic
912466609 1:109878992-109879014 GCAGGTAGCAGGTGGGAGTTGGG + Intergenic
915832969 1:159147975-159147997 GCTTGTAAGAGGTGGGACTAGGG + Intergenic
918359481 1:183741133-183741155 GCATGCATGAGGTGGGAGAAGGG + Intronic
920500606 1:206482768-206482790 GCTTGCAACATGTGGGAGCTGGG - Intronic
923072745 1:230580800-230580822 GCAAACAACAGGTGGGGATAGGG - Intergenic
1063294649 10:4792535-4792557 GGATTTAGCAGGTGGGAGTAGGG - Intronic
1064261744 10:13791770-13791792 GCATGCTACAGCTGGGATGATGG + Intronic
1070598810 10:77851481-77851503 CCATGCAGCAGGTGCGAGAAGGG + Intronic
1072623553 10:97096613-97096635 CCCTGCAAGAGGTGGGAGTGAGG - Intronic
1077976303 11:7252005-7252027 GCATGCAACCGGTGGGAGGCCGG + Exonic
1079529067 11:21427110-21427132 GCATGAAACAGGGGAGAGTGAGG + Intronic
1080099241 11:28440066-28440088 GCATGAGGCAGGAGGGAGTACGG + Intergenic
1080220217 11:29894384-29894406 AAGTGCAAGAGGTGGGAGTATGG + Intergenic
1083010082 11:59388609-59388631 GCATGCACCAGCTGTGACTAGGG + Intergenic
1083628192 11:64082622-64082644 GCAGGCACCAGGTGGGAGGGTGG + Intronic
1089398638 11:118152151-118152173 GCATGCACCAGTTGGGGGTGGGG - Intronic
1090408091 11:126489376-126489398 GCCTGCATCAGGTGGGAGTTAGG + Intronic
1091851255 12:3698950-3698972 GGGAGCAGCAGGTGGGAGTAGGG - Intronic
1096870440 12:54589027-54589049 GCATGCAGCAGGAGGGATTAAGG + Intergenic
1099001687 12:77185606-77185628 GCAGGCAAGAAGTGGGAATATGG - Intergenic
1106018556 13:25892619-25892641 GCATGACACAGGTGGAAGAAAGG - Intronic
1106953920 13:34914572-34914594 GCATGCCACAGGAGGGGGCAGGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1110879696 13:80556602-80556624 GCTTGCTGGAGGTGGGAGTAGGG + Intergenic
1113446214 13:110369603-110369625 GCACTCAACAGGTGGCACTATGG + Intronic
1121787739 14:96675203-96675225 GCATTTAGCAGGTGGGAGTTTGG - Intergenic
1202833566 14_GL000009v2_random:60667-60689 GCAGGCAACATGTGGCAGAAGGG + Intergenic
1124012781 15:25852140-25852162 GCATTCAATAGGAGGGAGGATGG - Intronic
1124012801 15:25852239-25852261 GCATTCAATAGGAGGGAGGATGG - Intronic
1124012806 15:25852261-25852283 GCATTTAACAGGAGGGAGGATGG - Intronic
1128647611 15:69388655-69388677 GCCTGCTGCAGCTGGGAGTATGG + Intronic
1129152853 15:73699834-73699856 GGATCCCACAGGTGGAAGTAAGG - Intronic
1131536327 15:93240888-93240910 TCATGCAGCAGATGGAAGTAAGG - Intergenic
1132176245 15:99717583-99717605 GCCTGCAACAGCTGGGATCAGGG - Intronic
1132851944 16:2028745-2028767 CCAGGCCGCAGGTGGGAGTAGGG + Intronic
1132892469 16:2210983-2211005 GCATCCCCCAGGTGGGAGGAGGG - Exonic
1135740046 16:24967463-24967485 GCATGTGACAGTTGGGAATAGGG - Intronic
1137320216 16:47372927-47372949 GCATGCAACATCTGGACGTAGGG - Intronic
1144141895 17:12357461-12357483 GACTCCAAAAGGTGGGAGTATGG - Intergenic
1144170613 17:12656451-12656473 GTATGCAACAGGAGTGAGGAAGG - Intergenic
1147359785 17:39923404-39923426 GGATGGAGCAGCTGGGAGTATGG + Intronic
1149725174 17:58885863-58885885 GCATTCTACACATGGGAGTAGGG + Intronic
1150303430 17:64064740-64064762 GCATGCAAAGGGTTTGAGTAGGG + Intronic
1151576199 17:74953656-74953678 GCAGGGCACAGGTGGGAGTGAGG + Intronic
1157236400 18:45968622-45968644 GTATGCTACAGGTGGGTGGATGG - Intergenic
1161086353 19:2337358-2337380 GCAGGCTTCAGGTGGGAGAACGG + Intronic
1163815886 19:19464193-19464215 GCATGCCACAGGTGTGAATTGGG + Intronic
1166794995 19:45420572-45420594 CCCTGCCACAGGTGGGAGGAGGG - Intronic
1166808586 19:45501421-45501443 GCATGGCAGAGGTGGGAGTTTGG + Intronic
1167169575 19:47822188-47822210 GATTGCAGCAGGAGGGAGTAAGG + Intronic
926339956 2:11896805-11896827 GGCTGCAACAGCTGGGAGTTAGG + Intergenic
932023054 2:68107657-68107679 AGATGCAACAGGTTGGAGTATGG - Intronic
934494578 2:94786638-94786660 GCAGGCAACATGTGGCAGAAGGG - Intergenic
936098713 2:109555461-109555483 GCCTGCAACAGGGGAGAGTGGGG - Intronic
937116002 2:119405362-119405384 GCATACACCAGGTGTGAGTCTGG - Intergenic
938685926 2:133737547-133737569 GAATGCAGCAGGAGGGAGTTGGG - Intergenic
940019918 2:149145912-149145934 ACAGGCAACAGTTGGGAGAAAGG + Intronic
941214484 2:162688803-162688825 TCATTTAACAGGTGGGTGTATGG + Intronic
944523547 2:200595833-200595855 GAATGCACCAGATGGGAGGAAGG - Intronic
945905470 2:215588081-215588103 GCATGCCAGAGGTGGAACTAGGG - Intergenic
946307311 2:218863525-218863547 GCATGCATCACATTGGAGTAAGG - Intronic
1170974393 20:21148912-21148934 GCAAGGATCAGGTGGGAGAATGG + Intronic
1171885712 20:30651216-30651238 GCAGGCAACATGTGGCAGAAGGG - Intergenic
1173923000 20:46759888-46759910 GCATTCAGCATGTGGGAGGAAGG + Intergenic
1174307871 20:49627394-49627416 GTAAGGAATAGGTGGGAGTAGGG - Intergenic
1175853316 20:62105272-62105294 TCCTGGAAGAGGTGGGAGTACGG + Intergenic
1176657108 21:9596975-9596997 TCATGCACCAGGTTGGAGAATGG + Intergenic
1178027941 21:28489414-28489436 GCATCCAACATGTGGGTGAAAGG + Intergenic
1178505545 21:33159821-33159843 GCAAGCAGCAGGTGGGAGGAAGG + Intergenic
1180362845 22:11914838-11914860 GCAGGCAACATGTGGCAGAAGGG + Intergenic
1180922096 22:19526201-19526223 GCATGGAAGGGCTGGGAGTAGGG - Intronic
1181757277 22:25032879-25032901 GCATTTAACACCTGGGAGTAGGG - Intronic
949421668 3:3872562-3872584 GCATTCATTAGCTGGGAGTAAGG - Intronic
950644656 3:14369816-14369838 CCATCCAACAGGTGGCAGGAGGG - Intergenic
952556033 3:34532422-34532444 CCCTGCTACAGATGGGAGTAAGG + Intergenic
955635066 3:61019399-61019421 GCATGCAACAGGTGGGAGTAAGG + Intronic
959084680 3:101838907-101838929 GTATGTAACAGCTGGGAGAATGG - Intronic
961813577 3:129535848-129535870 GCATGCAGCAGATGAGACTATGG + Intergenic
966547749 3:181170101-181170123 GACTTCAACAGGTGGGAGGAAGG - Intergenic
968725428 4:2245744-2245766 GCAGGGAGCAGGTGGGAGTGGGG + Intergenic
969154641 4:5199830-5199852 GCATTCCTCAGGTGGGAGTGGGG - Intronic
970295467 4:14624787-14624809 GCAAGCTACAGGTAGGAATACGG + Intergenic
971825333 4:31614243-31614265 GCAGGAAACAGGTGGAAGTGGGG + Intergenic
972716880 4:41655397-41655419 TCATGCAACAAGTGGGAGTAAGG + Intronic
973369353 4:49233461-49233483 GCAGGCAACATGTGGCAGAAGGG - Intergenic
973391683 4:49561955-49561977 GCAGGCAACATGTGGCAGAAGGG + Intergenic
975789382 4:77932297-77932319 TCATGCACCAGCTGGGAGAAAGG - Intronic
977016942 4:91702390-91702412 GAATACAAGAGGTGGGAGAAAGG + Intergenic
977513789 4:97995108-97995130 GCAGGCAGCATGGGGGAGTAGGG - Intronic
978666303 4:111187056-111187078 GCATGCATAAGGTGGGTGTGGGG - Intergenic
983547672 4:168979898-168979920 GCATGCTGGAGGTGAGAGTAAGG - Intronic
983661394 4:170133640-170133662 GACTGAAACAGGTGGGAGTGGGG + Intergenic
985418316 4:189759156-189759178 TCATGCACCAGGTTGGAGAATGG - Intergenic
989356767 5:40552171-40552193 GCATGCCAAAGGTGGAAGAAAGG + Intergenic
992668765 5:79037548-79037570 GAAGACAACAGGTGGGAGTGGGG - Intronic
997411063 5:133691377-133691399 GCATCCATCTGGTGGGAGTCTGG - Intergenic
1001794516 5:174490949-174490971 CCAGGCAACAGGTGGGAATGAGG + Intergenic
1012720677 6:102738397-102738419 GCATGCAACATGTGTGATTTGGG - Intergenic
1013305514 6:108843839-108843861 GCCTGGGATAGGTGGGAGTATGG - Intergenic
1015899861 6:138053306-138053328 TCATTCATCAGGTGGGAGCAGGG - Intergenic
1017399417 6:154042125-154042147 GCCTGCCACAGGTGGGTGTTTGG - Intronic
1019652729 7:2169280-2169302 GGATGCGACTGGTGGGATTACGG + Intronic
1020382008 7:7557284-7557306 GCAGGGCACTGGTGGGAGTAGGG - Intergenic
1026104994 7:67413817-67413839 GCTTGCAGCAGGTGGGTGGATGG - Intergenic
1036798560 8:11773064-11773086 GCAAGGAACAGGTGAGAGCACGG + Intronic
1039604120 8:38866835-38866857 TCATGAAACAGGTTGCAGTAAGG + Intergenic
1040102076 8:43514230-43514252 GCAGGCAACATGTGGCAGAAAGG + Intergenic
1047071325 8:121347104-121347126 GCAGTCAACAGGTGGTAGCAGGG + Intergenic
1047948751 8:129910099-129910121 GCATGCCATAGGTGCTAGTATGG + Intronic
1048044784 8:130763340-130763362 CCATGCACCAGGTGGGGGGATGG + Intergenic
1048217653 8:132511167-132511189 GGATGGACCTGGTGGGAGTATGG - Intergenic
1049329696 8:142043622-142043644 GCTTGGAACAGGTGGCAGGAGGG + Intergenic
1050149750 9:2607761-2607783 GCATGTAACAGGTGGGAGTTTGG - Intergenic
1050289511 9:4139530-4139552 GTATGTAACAGGAGGGAATATGG - Intronic
1052721999 9:32183117-32183139 GCATGGACCAGGTGGTAGGATGG + Intergenic
1052877357 9:33576820-33576842 GCAGGCAACATGTGGCAGAAGGG + Intergenic
1053498646 9:38567573-38567595 GCAGGCAACATGTGGCAGAAGGG - Intronic
1053821720 9:41974577-41974599 GCATGCAGCAGGTGGGCTGAAGG + Intronic
1053912990 9:42923908-42923930 GCAGGCAACATGTGGCAGAAGGG + Intergenic
1054374668 9:64439958-64439980 GCAGGCAACATGTGGCAGAAGGG + Intergenic
1054608850 9:67212831-67212853 GCATGCAGCAGGTGGGCTGAAGG - Intergenic
1055124420 9:72702721-72702743 GGATGCAACAGAAGGAAGTAAGG + Intronic
1060947550 9:127579091-127579113 GCATGGAAGAGGTGGGAGGGAGG - Intergenic
1203547208 Un_KI270743v1:137773-137795 GCAGGCAACATGTGGCAGAAGGG - Intergenic
1203634831 Un_KI270750v1:100549-100571 TCATGCACCAGGTTGGAGAATGG + Intergenic
1193773881 X:85620163-85620185 GCATGCTGGAGGTGTGAGTAAGG - Intergenic
1195241697 X:102959357-102959379 GCATGCTGGAGGTGTGAGTAAGG + Intergenic
1195488853 X:105442576-105442598 GCATGCAAGAGATGGGAGGTTGG - Intronic
1197993218 X:132341254-132341276 GCCTACAAGAGGTGGGAGGATGG + Intergenic
1200134784 X:153869668-153869690 GCATGCAGCAGGTGGGCCCATGG + Intronic
1201162698 Y:11178842-11178864 ACAGGCAACAGGTGGCAGAAGGG + Intergenic