ID: 955636488

View in Genome Browser
Species Human (GRCh38)
Location 3:61035813-61035835
Sequence GGACTAACTAGAGTAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955636488_955636489 -4 Left 955636488 3:61035813-61035835 CCTGCTTTTACTCTAGTTAGTCC 0: 1
1: 0
2: 1
3: 3
4: 80
Right 955636489 3:61035832-61035854 GTCCCTCCACCTCACTCTTCTGG 0: 1
1: 0
2: 2
3: 48
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955636488 Original CRISPR GGACTAACTAGAGTAAAAGC AGG (reversed) Intronic
904875815 1:33653711-33653733 GGACTGGATAGAGTAAGAGCTGG + Intronic
906684803 1:47756472-47756494 GGACTACCTGGCGCAAAAGCAGG + Intergenic
912207685 1:107526340-107526362 TGACCAAGTAGAGTAAATGCTGG + Intergenic
1064144123 10:12814167-12814189 AGACAAAATGGAGTAAAAGCTGG - Intronic
1064664817 10:17639874-17639896 GACCTAAATAGAGTAAGAGCAGG + Intergenic
1068056043 10:52013979-52014001 GGAGTAACTAAGGAAAAAGCAGG - Intronic
1068680214 10:59811100-59811122 GGACTCACTAGGCTAAAATCAGG - Intronic
1074381486 10:112984386-112984408 GGACAAATTAGAGTAAAGGAGGG - Intronic
1074673322 10:115820626-115820648 GGACTAAATAGAGAAAACACTGG - Intronic
1078803513 11:14671607-14671629 GGAATAGCTAGAGTGGAAGCAGG + Intronic
1079762679 11:24350690-24350712 GCAATAACTAGAGCAAAAGAAGG + Intergenic
1079790235 11:24728409-24728431 GGCCTAACTAGAGCAGAAGCAGG - Intronic
1091724082 12:2833704-2833726 AGACTAAATGGAGTAATAGCTGG + Intronic
1091847232 12:3666760-3666782 GGACAAAGGAGAGAAAAAGCAGG - Intronic
1093449014 12:19294307-19294329 GCAGTAACAAGATTAAAAGCTGG - Intronic
1095234160 12:39777237-39777259 GGACTAAACTGAGTAAAGGCAGG + Intronic
1100346477 12:93736456-93736478 GAAATAACTAGAGGAAAAGTTGG - Intronic
1107515327 13:41123580-41123602 GTACTAACTAGTGTAAAATATGG + Intergenic
1108514301 13:51184029-51184051 AGACTAAACAGCGTAAAAGCCGG - Intergenic
1109648327 13:65291116-65291138 TGACTTATTAGAGTAAAAGAGGG + Intergenic
1116396056 14:44449786-44449808 GGAGTAACTTGGGTCAAAGCAGG + Intergenic
1119688207 14:76650065-76650087 GCAATAACTAGAGTAATAGTAGG - Intergenic
1120562262 14:86009837-86009859 GGCCTGACTAGAGCAAAAGGTGG - Intergenic
1120833955 14:89023797-89023819 GGACTATCTCACGTAAAAGCAGG + Intergenic
1126795865 15:52260117-52260139 GGAGTAACCAGAGTGGAAGCTGG - Intronic
1126981865 15:54253536-54253558 GAACTAATTAAAGAAAAAGCAGG - Intronic
1127552145 15:60051087-60051109 GGAAGAAGTAGAGTCAAAGCAGG - Intronic
1140827673 16:78722633-78722655 AGACTAACAAGAGTAGAAGAGGG + Intronic
1146100889 17:29980594-29980616 GGACTAAATAGAGAAACAGAAGG - Intronic
1148565201 17:48628393-48628415 GGACTCACCAGCGAAAAAGCTGG + Intronic
1149114817 17:53080457-53080479 GAACTAAGTAAAGTAAAGGCAGG + Intergenic
1157126129 18:44957863-44957885 GGAATAAAGAGAGTAAAACCTGG + Intronic
1157881955 18:51329094-51329116 TGACTAAAGAGAGTTAAAGCGGG - Intergenic
1168701585 19:58442943-58442965 GGGCCAAATAGAATAAAAGCTGG - Intergenic
925734792 2:6953978-6954000 AGCCTAACTAGAGAAAAAGAAGG - Intronic
931043108 2:58319472-58319494 GAATTAACAAGAGAAAAAGCAGG + Intergenic
933033770 2:77366328-77366350 GGAATAACTAGAGAAAAATAGGG - Intronic
935255355 2:101305452-101305474 GGATTAAACAGAGCAAAAGCTGG - Intronic
939940962 2:148350621-148350643 GGATAAGCTAGAGTAAAATCAGG + Intronic
940877939 2:158916833-158916855 GGAATAACTTGAGCAAAGGCTGG + Intergenic
945670809 2:212800722-212800744 GAACTAACTAAAGTAACAACTGG - Intergenic
1179649458 21:42797721-42797743 GGACTACTCAGAGCAAAAGCAGG - Intergenic
1182835464 22:33337987-33338009 GGACTACCTAGAGCAGAGGCAGG - Intronic
951222324 3:20081684-20081706 AGACTATTTAAAGTAAAAGCAGG + Intronic
955636488 3:61035813-61035835 GGACTAACTAGAGTAAAAGCAGG - Intronic
957128353 3:76192069-76192091 GCACTAACTAGGGAAATAGCGGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
960690311 3:120340309-120340331 TAACTAACTAGACTAAAAGGTGG - Intronic
966308287 3:178562831-178562853 GGACCAAGTTGAGTGAAAGCGGG + Intronic
970318896 4:14856259-14856281 GGAATAATTCTAGTAAAAGCAGG - Intergenic
972392372 4:38625970-38625992 GGAATAGCTAGAGAAAAAGGAGG + Intergenic
975738659 4:77406828-77406850 GGAATAAATAAAGTCAAAGCTGG - Intronic
976152503 4:82106196-82106218 GGATTAACTAAAGACAAAGCAGG + Intergenic
987685317 5:21191509-21191531 GGATTAATAAGAGTAAAAGTGGG + Intergenic
989768136 5:45110516-45110538 TGACTAACTTAAGCAAAAGCAGG - Intergenic
989814109 5:45714556-45714578 GGACCAACTAGAGTGAAATTGGG - Intergenic
990061862 5:51660239-51660261 GAAATGACTAGAGGAAAAGCAGG - Intergenic
990369755 5:55105327-55105349 GGTCTACATAGAGTAAAAGCAGG + Intronic
992699792 5:79330356-79330378 GGAGTTACTTGAGGAAAAGCAGG - Intergenic
993017095 5:82546345-82546367 GGATTAAAGATAGTAAAAGCAGG - Intergenic
995845875 5:116493372-116493394 TCACTAGCTAGAGTAAATGCTGG + Intronic
996585266 5:125080529-125080551 TGACTAACTTGATTAAAAGATGG + Intergenic
1002516173 5:179760652-179760674 AGACTATGTAGAGTAAAAGGGGG + Intronic
1009401176 6:63257978-63258000 GGAATACCAAGAGCAAAAGCAGG + Intergenic
1011839529 6:91479236-91479258 GGAGTAACTAAAGTAAATGCAGG - Intergenic
1012931678 6:105323803-105323825 GGACTCACTAGATTCAAAGGGGG + Intronic
1013867686 6:114718846-114718868 GAACTATCTAGTGCAAAAGCTGG - Intergenic
1014066483 6:117132837-117132859 AGCATGACTAGAGTAAAAGCAGG - Intergenic
1016025133 6:139279073-139279095 TGACCAACTAGAGGAAAAACAGG + Intronic
1016128494 6:140435643-140435665 GATGTAACTAGAGTAAAAGAAGG - Intergenic
1023675032 7:42620101-42620123 GGAATAATGAGAGTAAAAGGAGG - Intergenic
1024031076 7:45460255-45460277 GAAGTAACTAGGGTAAAATCAGG - Intergenic
1030535697 7:110763687-110763709 GGAGTAACTTGATTTAAAGCAGG + Intronic
1037319286 8:17628796-17628818 GGACTAACTAGAATCTAGGCAGG - Intronic
1037490406 8:19392129-19392151 GGACTAACTGGGGAAAAGGCTGG + Intronic
1040720420 8:50314446-50314468 GGAATGCCTAGAGTAAAAGAGGG - Intronic
1042659896 8:71142760-71142782 GAACTATCTGGAGTAACAGCCGG + Intergenic
1048600594 8:135915389-135915411 GGACAGACAAGAGTAAAACCTGG + Intergenic
1053371813 9:37567879-37567901 GGACTAAATAGAGTAGAAGCGGG - Intronic
1057966239 9:99506150-99506172 GGAGTAACCAGAGTGAAGGCAGG - Intergenic
1058895645 9:109398463-109398485 GGAGTAAGTAAAGTAAAAACAGG + Intronic
1062079687 9:134617301-134617323 GGACTAACAGGAGCACAAGCCGG - Intergenic
1192815482 X:74586258-74586280 GCACTAAATAGAGTTAAGGCTGG + Exonic
1195012574 X:100747499-100747521 GGACTAGGAAGAGTAAAAACTGG + Intergenic
1196631460 X:117944861-117944883 GTAATAACTAAAATAAAAGCAGG - Intronic