ID: 955638547

View in Genome Browser
Species Human (GRCh38)
Location 3:61056684-61056706
Sequence GACCCACACCTTTTTCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955638542_955638547 19 Left 955638542 3:61056642-61056664 CCAACAGAGAACAGCAATCCTCT 0: 1
1: 0
2: 0
3: 24
4: 209
Right 955638547 3:61056684-61056706 GACCCACACCTTTTTCAAACTGG 0: 1
1: 0
2: 1
3: 6
4: 89
955638546_955638547 -4 Left 955638546 3:61056665-61056687 CCACAGAGGAAGGACAGATGACC 0: 1
1: 0
2: 1
3: 33
4: 431
Right 955638547 3:61056684-61056706 GACCCACACCTTTTTCAAACTGG 0: 1
1: 0
2: 1
3: 6
4: 89
955638545_955638547 1 Left 955638545 3:61056660-61056682 CCTCTCCACAGAGGAAGGACAGA 0: 1
1: 0
2: 4
3: 31
4: 335
Right 955638547 3:61056684-61056706 GACCCACACCTTTTTCAAACTGG 0: 1
1: 0
2: 1
3: 6
4: 89
955638541_955638547 20 Left 955638541 3:61056641-61056663 CCCAACAGAGAACAGCAATCCTC 0: 1
1: 0
2: 1
3: 16
4: 153
Right 955638547 3:61056684-61056706 GACCCACACCTTTTTCAAACTGG 0: 1
1: 0
2: 1
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955638547 Original CRISPR GACCCACACCTTTTTCAAAC TGG Intronic
902256753 1:15194198-15194220 TAACCACACCTTTTTTAAAAAGG + Intronic
904823708 1:33261204-33261226 TTCCCACACCTTTGTCAAAAGGG + Intronic
914389161 1:147202986-147203008 CTCCCACACCATTTTCAAAATGG + Intronic
1064151889 10:12872256-12872278 GGCCCTCTCCTTTTTCACACAGG - Intergenic
1069542515 10:69306016-69306038 GACCCACACTTTTTCCAAAGAGG + Intronic
1074926979 10:118083516-118083538 GACCCACTCCTTTTACAAATGGG + Intergenic
1076270671 10:129149697-129149719 GACCCACACTTATTTAAGACAGG + Intergenic
1076986059 11:236607-236629 CGCTCACACCTTTTTCAACCCGG + Intronic
1077007969 11:368074-368096 GCCCCACCCCTTTTTGAGACAGG - Intergenic
1082149300 11:48713953-48713975 GAACCACTCCTTTTTAGAACCGG - Intergenic
1082598489 11:55115925-55115947 GAACCACTCCTTTTTAGAACTGG - Intergenic
1083850869 11:65366065-65366087 CAACTACACATTTTTCAAACAGG - Intergenic
1093734479 12:22605105-22605127 GGCCCACCCATTTTTCAATCAGG - Intergenic
1094372616 12:29754298-29754320 GAGCCAGGCCTTTTTCAAAAGGG - Intronic
1101586053 12:106087058-106087080 GACACACACCATTTTCCACCTGG - Intronic
1102517542 12:113459916-113459938 GACTCACCCCTTCCTCAAACAGG - Intergenic
1105203405 13:18198602-18198624 GTACCACACTTTTTGCAAACCGG + Intergenic
1110486919 13:76056730-76056752 GACCCACAGCTATATCATACTGG + Intergenic
1117610788 14:57480958-57480980 GAGCCATACCTTTTTGAGACTGG - Intronic
1120798939 14:88668045-88668067 CAGCCACACCATTTCCAAACAGG + Intronic
1120846945 14:89134463-89134485 GACCCACAGCCTTTGCAAAGAGG + Intronic
1125295073 15:38193758-38193780 TACTCACACATTTTTAAAACTGG - Intergenic
1131416597 15:92265054-92265076 GACCCACACATTTATGAAATTGG + Intergenic
1134759432 16:16700883-16700905 GACAGACTCCTCTTTCAAACAGG - Intergenic
1134986638 16:18658311-18658333 GACAGACTCCTCTTTCAAACAGG + Intergenic
1140154913 16:72414193-72414215 GTGAAACACCTTTTTCAAACTGG + Intergenic
1142894736 17:2966569-2966591 GACCCCCACCTTTCCCAAAGTGG - Intronic
1143780701 17:9227749-9227771 GACTCACACATTTATCATACAGG + Intronic
1145118009 17:20229825-20229847 TGCCCACAGCTTTTTAAAACTGG - Intronic
1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG + Intergenic
1155105618 18:22662742-22662764 GACTAACACCTTCATCAAACTGG + Intergenic
1155580315 18:27297623-27297645 GACCAACACCCTTTTCCAAATGG - Intergenic
1161751608 19:6101684-6101706 GACCCAATCCTTTTTCACATGGG + Intronic
1162806711 19:13140934-13140956 AACCCACACCTCTTTCACGCAGG + Exonic
1163908435 19:20167958-20167980 GACCCAAACTTTTTCCAAATAGG - Intronic
1163977043 19:20862545-20862567 GACCCAAACTTTTTCCAAATAGG + Intronic
1167264111 19:48474900-48474922 GACCCACACCTTCTTCAACCCGG + Exonic
926501002 2:13651834-13651856 GTCTCACACCTTTTTGAAAAGGG + Intergenic
928376538 2:30778970-30778992 GCCCTACACCATTTTAAAACTGG - Intronic
932030245 2:68176581-68176603 GTCCCAAATCTTTTTCAAAAAGG - Intronic
941713250 2:168736939-168736961 GATCCACACATTTATCAGACAGG - Intronic
942229093 2:173843001-173843023 GAACCACAGATTTTTCAAGCTGG + Intergenic
1169891880 20:10462317-10462339 CACTCACAGCTCTTTCAAACAGG - Intronic
1183124239 22:35760125-35760147 GAACCACACCTTTTTGGAAAAGG + Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
951107796 3:18765736-18765758 GACTTGCACCCTTTTCAAACTGG - Intergenic
952947531 3:38489043-38489065 GACCCACAAGTTTTTCAGGCAGG + Exonic
953142929 3:40246242-40246264 GGCTCACACTTTTTCCAAACAGG + Intronic
954284570 3:49609726-49609748 AAGCCAGGCCTTTTTCAAACAGG + Intronic
954357855 3:50097645-50097667 GACCAACTCCTTTTTCCAAAAGG - Intronic
955431426 3:58849162-58849184 GACCCACACCTTCTTCCAGTTGG + Intronic
955638547 3:61056684-61056706 GACCCACACCTTTTTCAAACTGG + Intronic
958016995 3:87949838-87949860 GACCAAGACATTGTTCAAACTGG - Intergenic
958195198 3:90235219-90235241 GAGCCCCACCCCTTTCAAACTGG + Intergenic
961094790 3:124144990-124145012 CACCCTCACCTTTTTCAAGCAGG - Intronic
963142798 3:141961674-141961696 TACCCATAACTTTTTGAAACTGG + Intronic
964170891 3:153768430-153768452 AAGCCACACCTTTTTCAACCAGG - Intergenic
965358311 3:167706016-167706038 GACTCAGACCTTTTTAAAAGAGG - Intronic
965472444 3:169111147-169111169 GACTCTCTCATTTTTCAAACAGG + Intronic
967692720 3:192495670-192495692 AGCCCTCACCTTTTTGAAACAGG + Intronic
972716971 4:41656136-41656158 GACCTAGAGCTTTTTCAAAATGG - Intronic
976314024 4:83640284-83640306 GACAGAAACCTATTTCAAACTGG + Intergenic
976634496 4:87274260-87274282 GACCTACACATTTTCCAAATTGG + Intergenic
979491762 4:121336291-121336313 TCCCCACACCTTTGTCAGACAGG - Intronic
980178723 4:129378438-129378460 GACAGACTCCTTTTTCAAAGTGG - Intergenic
982164941 4:152605633-152605655 GAGCCACTCCATTTTCAAATGGG + Intergenic
984823333 4:183903783-183903805 GCCCCCAACCTTTTTCACACTGG + Intronic
990542707 5:56790394-56790416 GCCCCACCCCTTTTTAAAACAGG - Intergenic
990803321 5:59630423-59630445 GACCCTCACCTTCATCAAAGAGG + Intronic
992128377 5:73666236-73666258 GTCCCACACCTTTGGCACACTGG + Intronic
994450407 5:99934296-99934318 GACCCACACATTTTCCTATCTGG + Intergenic
998397719 5:141829766-141829788 GACCCACACCCTGTGCAGACTGG + Intergenic
1001566213 5:172701077-172701099 GACTCACACCTGTTGCACACAGG + Intergenic
1002991399 6:2242391-2242413 GACACACTCCTTTTCCAAAGTGG - Intronic
1005230795 6:23699640-23699662 GACCAACACTTTTTACAAAATGG + Intergenic
1006703610 6:35997432-35997454 GTCCCCAACCTTTTTGAAACCGG - Intronic
1009878184 6:69532506-69532528 GTTCCACACCTTTTCCAAAGTGG - Intergenic
1011583340 6:88896916-88896938 GACCCTCATCTTTGTCCAACTGG + Intronic
1015190543 6:130467317-130467339 GCCCCACACCTTTCTCAAGCAGG + Intergenic
1016238322 6:141895144-141895166 TACCCACACCTTTCTCACTCAGG - Intergenic
1018264261 6:162004758-162004780 GAGCAACAGCTTTTGCAAACTGG + Intronic
1026850534 7:73720508-73720530 GACCCACCCCTTTTTCCTGCAGG + Intergenic
1029259166 7:99289935-99289957 GAAACACACCTTTGTCATACAGG + Intergenic
1030737163 7:113062958-113062980 GACCCACAGTTCTTTCAAAACGG + Intergenic
1032524704 7:132571236-132571258 CACCCACACCTTTTTGCATCAGG + Intronic
1034107127 7:148499915-148499937 GATCCATACCTTTTCAAAACTGG - Intergenic
1034515846 7:151578748-151578770 GAAACACACCTTTATCAAAAAGG + Intronic
1035899899 8:3448278-3448300 GACACACATCTTTCTGAAACTGG + Intronic
1038693165 8:29781536-29781558 GACCCTCACCTTGTTCAACTGGG + Intergenic
1041239369 8:55836127-55836149 GAGCCACAGTTGTTTCAAACTGG - Intergenic
1048485735 8:134845670-134845692 GACCCTCAAAGTTTTCAAACAGG - Intergenic
1052118816 9:24682797-24682819 AACCCACACTATTTTCTAACAGG + Intergenic
1052840840 9:33289799-33289821 CACCCACACCTCTTTCACGCAGG + Intergenic
1058575748 9:106399326-106399348 GAACCACACTTTGTTCAATCTGG + Intergenic
1059125288 9:111678778-111678800 CAACCACACCTTCTTCAAAGAGG + Intergenic
1062719413 9:138028873-138028895 AACCCACACCTTTTTAACTCTGG - Intronic
1196551029 X:117025425-117025447 GAACCATACCTTCTGCAAACAGG + Intergenic