ID: 955641617

View in Genome Browser
Species Human (GRCh38)
Location 3:61091777-61091799
Sequence GTCTCTACAAAAATTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3100
Summary {0: 2, 1: 117, 2: 621, 3: 1053, 4: 1307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955641608_955641617 19 Left 955641608 3:61091735-61091757 CCCAGGAGTTTGAGACGAGCCTG 0: 60
1: 11184
2: 21386
3: 30857
4: 27221
Right 955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG 0: 2
1: 117
2: 621
3: 1053
4: 1307
955641612_955641617 0 Left 955641612 3:61091754-61091776 CCTGGACACCATGGCAAAACCCA 0: 1
1: 38
2: 1525
3: 21946
4: 54944
Right 955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG 0: 2
1: 117
2: 621
3: 1053
4: 1307
955641613_955641617 -8 Left 955641613 3:61091762-61091784 CCATGGCAAAACCCAGTCTCTAC 0: 2
1: 67
2: 250
3: 1226
4: 2826
Right 955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG 0: 2
1: 117
2: 621
3: 1053
4: 1307
955641609_955641617 18 Left 955641609 3:61091736-61091758 CCAGGAGTTTGAGACGAGCCTGG 0: 94
1: 21104
2: 42120
3: 59502
4: 51917
Right 955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG 0: 2
1: 117
2: 621
3: 1053
4: 1307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955641617 Original CRISPR GTCTCTACAAAAATTTAGCT GGG Intronic
Too many off-targets to display for this crispr