ID: 955644001

View in Genome Browser
Species Human (GRCh38)
Location 3:61117148-61117170
Sequence AGATTAATACAAATAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1083
Summary {0: 1, 1: 1, 2: 5, 3: 95, 4: 981}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955643999_955644001 21 Left 955643999 3:61117104-61117126 CCAATAATTTTATTTAGTTAAGG 0: 1
1: 0
2: 4
3: 37
4: 383
Right 955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG 0: 1
1: 1
2: 5
3: 95
4: 981
955643998_955644001 25 Left 955643998 3:61117100-61117122 CCTTCCAATAATTTTATTTAGTT 0: 1
1: 1
2: 6
3: 68
4: 726
Right 955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG 0: 1
1: 1
2: 5
3: 95
4: 981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955644001 Original CRISPR AGATTAATACAAATAGAAAA TGG Intronic
903013219 1:20344679-20344701 ATATAAATATAAATAGAGAACGG + Intronic
903061720 1:20673235-20673257 AGATAAATAAAAATAAAAGAAGG + Intronic
903534675 1:24059085-24059107 AAAATAATGAAAATAGAAAAAGG - Intronic
904131019 1:28275085-28275107 AGAAAAAAACAAAAAGAAAATGG - Intronic
905506421 1:38483518-38483540 AGATTAAAAAAAAAAAAAAAAGG + Intergenic
906827824 1:49000494-49000516 TGATTAATACATATACAAATAGG + Intronic
906958379 1:50396949-50396971 AGATTAATGCCATTATAAAAGGG - Intergenic
906974452 1:50554643-50554665 AGATTATTACAAACTGGAAAGGG + Intronic
906979271 1:50611331-50611353 ATATTAACACAAAAAGAAAAAGG + Intronic
908084265 1:60613743-60613765 AGATTAATACATTTAAAAAGTGG - Intergenic
908410721 1:63861932-63861954 AGATTTATTAAAATAAAAAATGG + Intronic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
909762276 1:79305338-79305360 ATTTTAATACAATTAGTAAATGG - Intergenic
909994037 1:82257409-82257431 AGAATCATACAGCTAGAAAATGG - Intergenic
910019060 1:82563431-82563453 AAATAAAAAAAAATAGAAAATGG - Intergenic
910176257 1:84434044-84434066 AGTTTAAAACAAAATGAAAAGGG + Intergenic
910266163 1:85340091-85340113 AGATGAAAATAAATGGAAAAGGG + Intronic
910348058 1:86263711-86263733 AAACTAATTCAAATATAAAACGG + Intergenic
910723957 1:90318074-90318096 AAATAAATTCAAATAGAAAATGG - Intergenic
911282477 1:95947907-95947929 AGATTAATACACATTGCACATGG + Intergenic
911366418 1:96944406-96944428 TTATTAAAACAAAGAGAAAAAGG - Intergenic
911463831 1:98225454-98225476 AAATTAAGATATATAGAAAATGG - Intergenic
911685316 1:100769177-100769199 ATTTTAATACAAGTAGAAAATGG + Intergenic
911787292 1:101967049-101967071 AGTTTAATATAAATAGCAACTGG - Intronic
911927051 1:103846533-103846555 AGAGTGATATAAATAAAAAATGG + Intergenic
912043713 1:105426082-105426104 AATTTTGTACAAATAGAAAATGG - Intergenic
912193810 1:107374804-107374826 ATATTCATAAAAATACAAAAAGG - Intronic
912622965 1:111183757-111183779 AGATTAATGCAAAAAATAAAAGG - Intronic
912663130 1:111552618-111552640 TGATTAAGAAAAATAGATAAAGG - Intronic
912917473 1:113830092-113830114 AAAATTATACAAAGAGAAAAGGG - Intronic
913468484 1:119168065-119168087 AGATGAATAGATAAAGAAAATGG - Intergenic
913490321 1:119373873-119373895 AGAATAAAACAAACAAAAAAAGG + Intronic
914406790 1:147382868-147382890 GAATTAATACCAATGGAAAAAGG - Intergenic
914819491 1:151089794-151089816 AGGTTAAAACAAACAAAAAAAGG - Intronic
915704340 1:157829547-157829569 GGAGTAATAGAAATAGAAATAGG + Intergenic
915964220 1:160292455-160292477 AGATGAAAGCAAAGAGAAAAGGG + Intronic
916032100 1:160885807-160885829 CAATTCATAGAAATAGAAAAAGG + Intergenic
916639787 1:166715268-166715290 AGATTAATAACAATATTAAAAGG + Intergenic
917409076 1:174739279-174739301 AGCTAATTACTAATAGAAAATGG + Intronic
918505544 1:185249922-185249944 GAAGTAATACAAAAAGAAAAAGG - Intronic
918783117 1:188729592-188729614 AGATGAAGACAAATATAGAACGG - Intergenic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
919140826 1:193569441-193569463 AGTTTTATACAAATATAAAAAGG + Intergenic
919217987 1:194585406-194585428 AGATTAATAGAAGTAAAAATTGG - Intergenic
919263013 1:195222148-195222170 AAATAAATAAAAATAGAATATGG + Intergenic
919987363 1:202685245-202685267 AGGTTAAGAGAAATAGAAGAGGG + Intronic
920427975 1:205893670-205893692 AAATTAGTTCAATTAGAAAATGG + Intergenic
920616989 1:207503321-207503343 AAATTAATACAAAAAGAGAATGG - Intronic
920913775 1:210241513-210241535 AGAAAAAAACAAACAGAAAAAGG - Intronic
920970277 1:210737485-210737507 AAATGAATACAGATAGACAAGGG - Intronic
922599737 1:226840823-226840845 AGATTAATACAGCTTGAAATTGG - Intergenic
923321775 1:232841584-232841606 GGACTAATACAAAATGAAAATGG - Intergenic
923590352 1:235312670-235312692 AGATTAAAAAAAACAGAAATGGG + Intronic
923640341 1:235752425-235752447 AGATTACTATAAATAGTAAATGG + Intronic
923939525 1:238805945-238805967 AGATTAACAAAAATAAAAATAGG + Intergenic
923964119 1:239117304-239117326 AGGCTAAAACACATAGAAAATGG + Intergenic
924114271 1:240729905-240729927 AGTTTAATACCAATAGGAAGCGG - Intergenic
924557256 1:245128810-245128832 ACATTAATAAAAATAGGAACGGG - Intergenic
1063302840 10:4867417-4867439 AGCTGAATGCAATTAGAAAATGG - Intergenic
1063863708 10:10341204-10341226 AGATCAAAACAAAAAGAAAAAGG + Intergenic
1064356188 10:14620377-14620399 AAAGTAATACAAATAAGAAAGGG - Intronic
1064381468 10:14845580-14845602 AAAATAATAATAATAGAAAAGGG - Intronic
1064391780 10:14948561-14948583 AAAGTAAAACAAATATAAAAGGG + Intronic
1064581845 10:16801277-16801299 AGATTATCAGAAATAAAAAAGGG + Intronic
1064857592 10:19787521-19787543 AGATGAACACATTTAGAAAAAGG - Intronic
1065604324 10:27401428-27401450 AGATTTTTAAAAATAGAAAAAGG - Intronic
1066337761 10:34496508-34496530 ATATTATTACAAATTGAAATCGG + Intronic
1066665980 10:37782941-37782963 AAACTAATACAAATGGCAAAGGG + Intronic
1066966623 10:42272769-42272791 ATAAAAATAAAAATAGAAAAAGG - Intergenic
1067512634 10:46908545-46908567 AGATTAATGCTATTAGAAGAGGG + Intergenic
1067649610 10:48143277-48143299 AGATTAATGCTATTAGAAGAGGG - Intergenic
1068070100 10:52184508-52184530 AGATTACAAAAAATAGTAAAAGG - Intronic
1068086652 10:52381813-52381835 AGATTAAAAAAAAAAAAAAAAGG + Intergenic
1068170019 10:53381244-53381266 GCATTAACACAAAAAGAAAAAGG + Intergenic
1068382113 10:56269132-56269154 AGAGAAATAAAAATAGAGAAGGG + Intergenic
1068447718 10:57144390-57144412 AGATTAATCCAACTTGTAAAGGG - Intergenic
1068479638 10:57574319-57574341 AAATGGAAACAAATAGAAAAAGG + Intergenic
1069271295 10:66531207-66531229 AGACTAATAAAAATAGAATTTGG + Intronic
1069396415 10:67994420-67994442 AAATAAATAAAAATAAAAAAAGG - Intronic
1070263735 10:74882223-74882245 AGATTAATACTAATAGCAAGAGG - Intronic
1070578130 10:77696001-77696023 GGCTTAATTGAAATAGAAAATGG + Intergenic
1071052760 10:81471855-81471877 AAATTACTAAAAATATAAAAAGG + Intergenic
1071187810 10:83063369-83063391 AAATTAATACAAATAAAAGTGGG - Intergenic
1071206083 10:83280230-83280252 ATAATAATACATATATAAAATGG + Intergenic
1071221168 10:83466075-83466097 ATATTAAAAGAAATAGGAAAGGG + Intergenic
1071306293 10:84301980-84302002 AGAGTAATACAAACATGAAAAGG - Intergenic
1071441118 10:85696300-85696322 ACATTAAAAAAAATAGAGAAAGG + Intronic
1071780373 10:88838149-88838171 AAATGAATAAAAATATAAAATGG + Intronic
1071989141 10:91082853-91082875 AGACTAATACAAACTGGAAATGG + Intergenic
1072028432 10:91490553-91490575 TAATAAATACAAATATAAAATGG - Intronic
1072317550 10:94217477-94217499 CAATTAATACAATTACAAAAGGG + Intronic
1072566179 10:96618516-96618538 CAATTAATACAAATATAAATAGG - Intronic
1073171547 10:101513701-101513723 ATATTAATAAAAATCCAAAATGG - Intronic
1073263210 10:102206271-102206293 AAATTAATACAGACAGAAAGTGG + Intergenic
1073877872 10:107946755-107946777 AGAGAAATACAAATAAAAGAGGG + Intergenic
1074071062 10:110069985-110070007 AGATTACAACTAATACAAAAGGG - Intronic
1074599040 10:114895224-114895246 AGATTTAATAAAATAGAAAAAGG + Intronic
1074606134 10:114969447-114969469 AGATAAATAAAAATAAAATATGG + Intronic
1074809882 10:117093208-117093230 AGATACATACAATTAGAAATTGG + Intronic
1075217326 10:120547647-120547669 CGATAAATACAGATGGAAAAAGG - Intronic
1075749936 10:124759163-124759185 ATATTACCACAAATACAAAATGG + Intronic
1075814045 10:125250696-125250718 AGTATAATACAAAAAAAAAAAGG - Intergenic
1076082159 10:127591945-127591967 AGTCTACTACAAAAAGAAAAAGG + Intergenic
1076490085 10:130853626-130853648 AGATAAATTAAAAGAGAAAAGGG - Intergenic
1077346800 11:2063144-2063166 AGAATATGGCAAATAGAAAATGG - Intergenic
1077523302 11:3049084-3049106 AAATAAATAAAAATAAAAAAGGG - Intronic
1078044668 11:7902864-7902886 CTATTAATACACATATAAAATGG - Intergenic
1078632600 11:13016917-13016939 CGATTAACACAGATAGAAATCGG + Intergenic
1078738125 11:14040496-14040518 AGATAAAAAGTAATAGAAAATGG + Intronic
1078847756 11:15136008-15136030 GAATTAATACCATTAGAAAAAGG - Intronic
1079373853 11:19874265-19874287 ATACTAATTCAAATAGAAATTGG + Intronic
1079453260 11:20616016-20616038 AAAATAATTCAAATAGAACATGG + Intronic
1079474763 11:20818479-20818501 AAAGTCATACAGATAGAAAATGG + Intronic
1079503340 11:21127217-21127239 AGTTTAATACAATTATAAAAAGG + Intronic
1079610082 11:22421887-22421909 TAAGTCATACAAATAGAAAATGG + Intergenic
1079619981 11:22542145-22542167 AGATTAATAATAAGAGAAACTGG - Intergenic
1079661102 11:23037537-23037559 AAATGAATCCAGATAGAAAAGGG + Intergenic
1079746722 11:24141368-24141390 ACATTGATAAAAATACAAAATGG - Intergenic
1079781253 11:24608983-24609005 AGATTATTAAAAATACAAAGTGG + Intronic
1079873416 11:25828771-25828793 AGATTAATGCCATTATAAAAGGG - Intergenic
1079873644 11:25830825-25830847 AGATTCATACAAATTATAAAAGG - Intergenic
1079874909 11:25844451-25844473 AGACTAATACACATGGTAAATGG + Intergenic
1079900402 11:26176085-26176107 AGATTAATGAAATTAGAATAAGG + Intergenic
1079993126 11:27267271-27267293 GTATTAATACATTTAGAAAATGG + Intergenic
1080029133 11:27642582-27642604 AGATTAATGCCACTATAAAAGGG + Intergenic
1080353572 11:31414494-31414516 TGACTAACACAAATAGAAATAGG - Intronic
1080793814 11:35544644-35544666 AGATTAATACACATGGATAAGGG + Intergenic
1081052558 11:38362610-38362632 AGATTTATAGAGATAGAAAATGG - Intergenic
1081170073 11:39857238-39857260 ACATTAGTAAAAATAGAAACTGG - Intergenic
1081292419 11:41343026-41343048 AGAGAAATACATAGAGAAAAGGG - Intronic
1081435097 11:43018893-43018915 AGAATAAGACAAATAAAAGATGG - Intergenic
1081510333 11:43765790-43765812 ATTTTAATACAGAGAGAAAAAGG - Intronic
1082190176 11:49233602-49233624 TCATTAAAACAAATAAAAAATGG - Intergenic
1082223952 11:49678323-49678345 AGAGAAATACAAATATCAAATGG - Intergenic
1082301793 11:50514719-50514741 AGATTAATGCACATATCAAAAGG + Intergenic
1082638467 11:55625988-55626010 AAATTAATTAAAATAAAAAAAGG - Intergenic
1083036678 11:59644536-59644558 AGATAAATAACAAGAGAAAAGGG - Intronic
1083057047 11:59832484-59832506 AGTTTAAAAAAAAGAGAAAATGG + Intronic
1083825289 11:65199134-65199156 ATAAAAATACAAATACAAAAAGG - Intronic
1084757165 11:71246880-71246902 AGATTTTTAGAAATGGAAAAGGG - Intronic
1085007157 11:73102659-73102681 AGATTAATGCCATTATAAAAGGG + Intronic
1085272699 11:75279654-75279676 AAATTAATAAAAATTTAAAAAGG - Intronic
1085440408 11:76556917-76556939 ACATTAATAAAAACAGAAAAGGG - Intergenic
1085725087 11:78948069-78948091 AGATTTTTCAAAATAGAAAATGG - Intronic
1086023811 11:82265769-82265791 AAGATAATAGAAATAGAAAATGG - Intergenic
1086625087 11:88940841-88940863 AGAGAAATACAAATATCAAATGG + Intronic
1086764882 11:90683678-90683700 AGATTAATAAAAATGAGAAATGG - Intergenic
1086831429 11:91570073-91570095 AGATTAGAACAAATGGAAAATGG - Intergenic
1086892654 11:92276183-92276205 ATATTAATACAAATAAAAAAGGG - Intergenic
1087392271 11:97552172-97552194 ACTTTAAAACAAATAGAAAATGG - Intergenic
1087535609 11:99441309-99441331 AGATTAAAAGCAATACAAAAGGG - Intronic
1087757575 11:102071514-102071536 AGATAAACAAAAATAGAAAAAGG - Intronic
1087825297 11:102758038-102758060 ACACTAATGCAAACAGAAAAGGG + Intergenic
1087968831 11:104454018-104454040 CTATTAAAACTAATAGAAAAAGG + Intergenic
1088048515 11:105481744-105481766 AGTTAAATACATTTAGAAAATGG - Intergenic
1088079127 11:105888587-105888609 AGTGTCATAAAAATAGAAAAAGG - Intronic
1088227858 11:107641481-107641503 CAATTAATACAAATATAAACAGG + Intronic
1089714327 11:120342433-120342455 AGAATCATACAAACATAAAATGG - Intronic
1089915538 11:122152116-122152138 AGAGTGATAAAAATGGAAAAGGG - Intergenic
1090047946 11:123352357-123352379 AGGTTAACACAGGTAGAAAATGG - Intergenic
1090217008 11:124977446-124977468 AAATTACTACAAATATAAATAGG - Intronic
1091809390 12:3382557-3382579 ACATTAAAAAAATTAGAAAACGG - Intronic
1092510238 12:9147399-9147421 AGCATAATACAATTAGAAAGAGG - Intergenic
1092873301 12:12826450-12826472 AGACAAATACAAAAAAAAAAAGG - Intronic
1093132236 12:15405513-15405535 TGGTTAATACAAATGGGAAAAGG + Intronic
1093155593 12:15680932-15680954 ACATTATTACAAGTAGTAAATGG + Intronic
1093172916 12:15879178-15879200 ATATTAAAATAAATGGAAAATGG - Intronic
1093881571 12:24409829-24409851 AGAGAAATCCAATTAGAAAATGG - Intergenic
1094071321 12:26417295-26417317 AGGAAAATACAATTAGAAAATGG + Intronic
1095171922 12:39046228-39046250 AGATAAATAAAAATAAAATAAGG + Intergenic
1095316627 12:40769910-40769932 ACATTATTAAAAATAAAAAACGG + Intronic
1095414492 12:41961544-41961566 AGAACAATACAAATAGTAACAGG + Intergenic
1095874281 12:47063561-47063583 AAATTAAGACAAAAAGAAATAGG + Intergenic
1095881987 12:47147631-47147653 ATATCAATAGAAATAGAACATGG - Intronic
1095961569 12:47838157-47838179 AGGGTCATACAAATAGCAAATGG + Intergenic
1096016117 12:48276950-48276972 AAATTAAAAAGAATAGAAAAAGG - Intergenic
1097427539 12:59465974-59465996 AAAATAATGCAAAAAGAAAAAGG + Intergenic
1097466430 12:59930331-59930353 AGTTTCATACAAGTAGAAAGAGG + Intergenic
1097705223 12:62861469-62861491 ATATTTAAACAAATAGAAAAGGG - Intronic
1098135998 12:67402375-67402397 AGATTAAAACAATTTGATAAAGG + Intergenic
1098271289 12:68772793-68772815 AGAGTAAGACAAACAGGAAAAGG - Exonic
1098566502 12:71943168-71943190 AGGTTAATAAAAACAGAAATAGG + Intronic
1098624707 12:72649699-72649721 ATATTAATCCAATTACAAAAAGG + Intronic
1098681633 12:73363352-73363374 AGCTTAATACATATGAAAAAAGG + Intergenic
1098723511 12:73931732-73931754 ATATTCAAACAAATAGAAAATGG - Intergenic
1098879211 12:75899568-75899590 AGATTAATTGGAAAAGAAAATGG - Intergenic
1098885103 12:75953055-75953077 AGATTAAGACAAATTTAAAAGGG - Intergenic
1099130266 12:78820155-78820177 ATTTTAGTACAAATTGAAAAAGG - Intergenic
1099141761 12:78986266-78986288 AGAGATATACAAAAAGAAAATGG - Intronic
1099307016 12:80970265-80970287 AGATTTAAACAATTATAAAAAGG - Intronic
1099360410 12:81693708-81693730 AGAAGAATACAAAGAGATAAGGG + Intronic
1099386961 12:82025984-82026006 AGTTAAAGACAAATAGGAAATGG + Intergenic
1099658967 12:85530773-85530795 ACAATAAAATAAATAGAAAAAGG - Intergenic
1099695010 12:86007323-86007345 AGATTGAAATAATTAGAAAATGG - Intronic
1100094774 12:91019919-91019941 ATATTAAAACAAATAGTGAAGGG - Intergenic
1100519030 12:95355986-95356008 AGATTAATACCAATTCAATAAGG - Intergenic
1100575212 12:95885026-95885048 AAATTTATATAAAAAGAAAAAGG + Intronic
1100802581 12:98248953-98248975 ATAGTCATACAAATAGAAGAGGG - Intergenic
1100915543 12:99416678-99416700 AAAATAATCCAATTAGAAAATGG - Intronic
1101072078 12:101086468-101086490 TAATTAAAAAAAATAGAAAAAGG + Intronic
1101227512 12:102704483-102704505 AGAAAAATAAAAATAGGAAATGG - Intergenic
1102096539 12:110245842-110245864 AGATTAATACAATCATGAAAAGG - Intergenic
1103237744 12:119387579-119387601 ACATTCATACCTATAGAAAAAGG - Intronic
1103572403 12:121853947-121853969 AGAATAAAAAAAAAAGAAAAAGG + Intronic
1103642411 12:122362307-122362329 AGAGAAATATAAATACAAAATGG + Intronic
1103861073 12:124014397-124014419 AAATTAAAACAAACAAAAAAAGG - Exonic
1104551595 12:129762061-129762083 AGACTAGGACAATTAGAAAAGGG + Intronic
1104753299 12:131253402-131253424 AGATTTATCCAAAAAGGAAAAGG + Intergenic
1105519624 13:21120527-21120549 AGATTAATCCAAATGAAAAATGG - Intergenic
1105531034 13:21220697-21220719 TAATTAATACAAAAATAAAATGG + Intergenic
1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG + Intronic
1106035185 13:26037741-26037763 AGATGAATAGAAATAGTGAATGG - Intergenic
1106601491 13:31191287-31191309 AAACTAGTAGAAATAGAAAAGGG - Intergenic
1106715714 13:32385882-32385904 AAAGCAATAAAAATAGAAAAAGG + Intronic
1106854878 13:33840499-33840521 AAATTAATGCACATACAAAAAGG - Intronic
1107195021 13:37641176-37641198 ATTTTAATACAAATATAAAAAGG + Intronic
1107616761 13:42176935-42176957 AGTTTGAGTCAAATAGAAAAGGG + Intronic
1107616804 13:42177657-42177679 AAATGAAAACAACTAGAAAATGG - Intronic
1107700009 13:43037592-43037614 AGGTTATTAAAAAAAGAAAAAGG - Intronic
1107743951 13:43485574-43485596 GGATTATTACACAAAGAAAAAGG + Intronic
1107900468 13:45008062-45008084 AGATTAACACAATTAGTAAGTGG - Intronic
1107915615 13:45146660-45146682 TGATTAATACAAATTAAGAAAGG + Intronic
1108019392 13:46111281-46111303 AGATTAATATAAAAAGGCAAAGG - Intergenic
1108277760 13:48828287-48828309 GAATTAAGACAAATAGGAAAAGG + Intergenic
1108557619 13:51610513-51610535 AGAGTAATACAACTTAAAAATGG - Intronic
1108672221 13:52703130-52703152 AGATAAAAACACACAGAAAAAGG - Intergenic
1108995337 13:56725698-56725720 AGACTAATAAAAATAAAACAAGG + Intergenic
1109056120 13:57551613-57551635 AGATTAACACAAAGTAAAAAAGG + Intergenic
1109160930 13:58973134-58973156 ACATTAATACAAATCAAAACAGG - Intergenic
1109313808 13:60726503-60726525 AGATGAATACAATTACTAAAAGG - Intergenic
1109396996 13:61772535-61772557 AGATCAATACATTTAGTAAAAGG + Intergenic
1109547426 13:63846760-63846782 GGATTAATACAACTATAAGATGG - Intergenic
1109555770 13:63973537-63973559 AGAATAATGCAAAAGGAAAATGG + Intergenic
1109559475 13:64028059-64028081 AGATTATTAAAAATAGTAAGTGG + Intergenic
1109592059 13:64498398-64498420 AGATTAAAATAAATAGGATAGGG + Intergenic
1109625701 13:64970919-64970941 AGATTAATCAAAACAAAAAAAGG - Intergenic
1109760216 13:66818290-66818312 ACAGCAATACAAATATAAAATGG - Intronic
1110057185 13:70987417-70987439 AGAGTAATACAAGAAAAAAAAGG - Intergenic
1110079721 13:71294975-71294997 AGATTAAAACAAAAAGGGAATGG + Intergenic
1110081963 13:71325094-71325116 ATATTAATTCAAATTGATAAAGG + Intergenic
1110084053 13:71355054-71355076 AAATTAATACTGCTAGAAAATGG + Intergenic
1110281540 13:73699419-73699441 AAATTAAAAAAAATTGAAAAAGG + Intronic
1110310443 13:74043003-74043025 ATATTAATACAAAAAAGAAAGGG + Intronic
1110517898 13:76437969-76437991 AAAATAAAATAAATAGAAAAAGG + Intergenic
1110560560 13:76907249-76907271 AGTCAAATACAAATAGAGAAAGG + Intergenic
1110596147 13:77322686-77322708 AATTTAACACAAGTAGAAAAAGG + Intronic
1110702902 13:78570428-78570450 GGATTATTATAAATGGAAAATGG + Intergenic
1110770178 13:79333690-79333712 AGATTAAAAAAAAAGGAAAATGG - Intronic
1110837021 13:80094539-80094561 TGATTAAAATAAATGGAAAAAGG - Intergenic
1110841147 13:80145057-80145079 TCAATAAAACAAATAGAAAAAGG + Intergenic
1110995396 13:82101650-82101672 AGAATTAAAAAAATAGAAAATGG - Intergenic
1111000215 13:82168906-82168928 AGATTAATAAAAATGGAATTTGG + Intergenic
1111439085 13:88255104-88255126 AAATAAATACAAAGACAAAAAGG - Intergenic
1112217173 13:97444847-97444869 AGACTAAGACATATACAAAAAGG - Intronic
1112652092 13:101410710-101410732 ACAATAAAACAACTAGAAAAGGG + Intronic
1112684411 13:101807042-101807064 AGATTATAAGAAAAAGAAAAGGG + Intronic
1112725344 13:102297588-102297610 GGTTTATTACAAATAAAAAAGGG + Intronic
1112958704 13:105093906-105093928 AGATTAATAAAGAAAGAAAAAGG - Intergenic
1113032308 13:106007757-106007779 ACATTAACAAAAAAAGAAAAAGG - Intergenic
1113380562 13:109801492-109801514 AAATTAAAACAAAATGAAAAAGG - Intergenic
1113500285 13:110768038-110768060 AAATTTATATAAATAGAAAATGG - Intergenic
1114780019 14:25528739-25528761 AGACTAATACAAAGAGAAATTGG - Intergenic
1114904528 14:27109630-27109652 AAATTAATATAAATACAATATGG - Intergenic
1115042331 14:28946828-28946850 AGATGAATAGATAAAGAAAATGG - Intergenic
1115048881 14:29031333-29031355 TGATTAATACAATTACAATAGGG - Intergenic
1115745544 14:36433190-36433212 AGATAAGTACAAATAAGAAAAGG - Intergenic
1115793446 14:36905875-36905897 AGTTATATACAAATGGAAAAAGG + Intronic
1115856693 14:37637465-37637487 AGAAAAATCCAATTAGAAAATGG + Intronic
1116275638 14:42827855-42827877 ATATAAAAACAAATAAAAAATGG - Intergenic
1116294222 14:43085364-43085386 AAATAAATACAAGTAGAAACGGG + Intergenic
1116327754 14:43553605-43553627 AAATTAATAAAAATAAAAACAGG + Intergenic
1116365836 14:44061874-44061896 AGAGTAACAGAAAGAGAAAAAGG + Intergenic
1116500780 14:45618418-45618440 AGATTAATGTAACTATAAAAAGG - Intergenic
1116563636 14:46416559-46416581 AGACTTATACAAGCAGAAAAAGG + Intergenic
1116790789 14:49337650-49337672 AGAGAAATTCAAATAGAAAGTGG + Intergenic
1116910098 14:50452813-50452835 AGATGACTACAAAAAGAAGAGGG + Intronic
1116940036 14:50782540-50782562 ATATTTATACAATTAGACAAAGG + Intronic
1117365025 14:55018450-55018472 AAATTAATACAATTAAAAATAGG - Intronic
1117941192 14:60966843-60966865 ATAAAAATATAAATAGAAAAAGG - Intronic
1118475588 14:66113805-66113827 AGATCAATTCAATTAAAAAACGG + Intergenic
1119175335 14:72564444-72564466 AGGTTTATACAAAGAGAAAGAGG - Intronic
1119216176 14:72870901-72870923 GGACTAATACAAATAGAGACAGG - Intronic
1119277310 14:73370192-73370214 GGATTAACACCAATATAAAAGGG + Intronic
1120059703 14:79967899-79967921 AGATTAAAAAAAAAAAAAAAAGG - Intergenic
1120205065 14:81579137-81579159 AGAATAATAAAAAGAGATAATGG - Intergenic
1120600852 14:86506380-86506402 TTATTAACACAAATAAAAAAAGG + Intergenic
1121057040 14:90864751-90864773 TGACTAATAAAAATATAAAAAGG + Exonic
1121141268 14:91544626-91544648 AGATTAATCCAAATGGATAATGG + Intergenic
1121203634 14:92141875-92141897 ATCATAATACACATAGAAAATGG - Intronic
1121465573 14:94113519-94113541 ATATTAATAGAAGTAGGAAAAGG + Intronic
1122144411 14:99680971-99680993 AGATTAATACCAAAAAAGAATGG - Intergenic
1122678403 14:103436567-103436589 AAATTAATACAAATAGGAGATGG + Intronic
1123192463 14:106584519-106584541 TGTTTAATATAATTAGAAAATGG - Intergenic
1123912485 15:24982187-24982209 ATATCTATACAAATAAAAAAGGG - Intergenic
1124021162 15:25925191-25925213 AAATTAAAACAAAAATAAAAAGG - Intergenic
1124185254 15:27519510-27519532 AAATAAATAAAAATATAAAATGG + Intronic
1124185901 15:27528958-27528980 AAAATAATACACATAGAGAAAGG - Intronic
1124927770 15:34088466-34088488 AGATTAAAAAAAAAAAAAAAGGG - Intronic
1125129441 15:36264968-36264990 AGTTAAAAACAAATAGAGAATGG - Intergenic
1125147215 15:36485772-36485794 AGATTAAAAAAAAAAGAAAAAGG + Intergenic
1125637283 15:41199388-41199410 AAATTAATACAAGAAAAAAAAGG - Intronic
1125765075 15:42130112-42130134 AAATTTATTTAAATAGAAAATGG + Intergenic
1125808059 15:42511687-42511709 AGACTAATAGATATAGAAAGAGG + Intronic
1125972242 15:43921313-43921335 AGATTAAAAGAAATAAACAAAGG + Intronic
1126387027 15:48104022-48104044 AGAGTTACACAAACAGAAAATGG - Intergenic
1126535731 15:49761487-49761509 ACATTAAAAGAAATACAAAAGGG + Intergenic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127230054 15:56981436-56981458 AGATTAACACCACTATAAAAAGG - Intronic
1127335784 15:57982041-57982063 AGATTAATGCCATTATAAAAGGG - Intronic
1127454986 15:59148815-59148837 AGATTAATCCAACTAGAAGTTGG - Intronic
1128113731 15:65092773-65092795 AAATTAAAACAAATAAATAATGG - Exonic
1128196847 15:65765588-65765610 AGATGAATACAAATAAAACTGGG - Intronic
1128446758 15:67769487-67769509 AGATGAATACAATGAGAATAAGG - Intronic
1128952193 15:71897331-71897353 ATATTTTTACAAAGAGAAAATGG + Intronic
1129494529 15:75965351-75965373 GGGTTTATGCAAATAGAAAAAGG + Intronic
1129962059 15:79696344-79696366 AGAGAAATATAAATACAAAATGG + Intergenic
1129975792 15:79820524-79820546 AAATTCATAGAAACAGAAAATGG + Intergenic
1130429985 15:83837828-83837850 ATAAAAATATAAATAGAAAAGGG + Intronic
1130646008 15:85727790-85727812 AGATTAAAACAAGGAGAGAAAGG + Intronic
1131185368 15:90269318-90269340 AAAATAATAAAAATAAAAAAAGG - Intronic
1131448786 15:92521602-92521624 AGAGTAATACAAAATGACAAAGG + Intergenic
1131610552 15:93956745-93956767 AGATAAATAAAATTAGAAAGTGG + Intergenic
1132205849 15:99985688-99985710 ACAGTCATACAACTAGAAAATGG - Intronic
1132436926 15:101814123-101814145 AAAATAATACAAAGAGCAAATGG - Intronic
1132460470 16:51438-51460 AGGTTTCTAAAAATAGAAAATGG - Intronic
1133314845 16:4876405-4876427 AGATTAATAAATATAAATAAAGG + Intronic
1133565106 16:6986173-6986195 AAATAAATAAAAATAGAAATTGG - Intronic
1134117093 16:11557172-11557194 AAATTATCACAAATAGCAAAGGG + Intronic
1134599218 16:15520283-15520305 AGAGTAAGGCAAAGAGAAAAGGG - Intronic
1135021081 16:18963689-18963711 AAATAAATACAAATAAATAAAGG - Intergenic
1135377929 16:21965826-21965848 AGATACATACACACAGAAAACGG - Intronic
1135431910 16:22391726-22391748 AGATTAAAAAAAAAAAAAAAAGG - Intronic
1135779371 16:25286315-25286337 ATAATAATTCAATTAGAAAATGG - Intergenic
1135877739 16:26218928-26218950 AAATTAAAAAAAAAAGAAAATGG + Intergenic
1136038361 16:27558439-27558461 AGATTAAAACAAAAAGAAACTGG - Intronic
1136118329 16:28110506-28110528 GGCTTAATACAAGAAGAAAAAGG - Intronic
1136644085 16:31593919-31593941 AAATTAATTCAAACAGACAAGGG - Intergenic
1136665416 16:31807466-31807488 AGATTAATTCAAAACAAAAAAGG + Intergenic
1136732696 16:32432141-32432163 ATAAAAATAAAAATAGAAAAAGG - Intergenic
1137479013 16:48835815-48835837 AGATTAATACCCTTATAAAAGGG + Intergenic
1137813989 16:51380774-51380796 AGATTCACACAAACAGAAAATGG - Intergenic
1137989093 16:53133683-53133705 ATATGAATACAGATAGAAAACGG + Intronic
1138036544 16:53612944-53612966 AGATTCATACAGACAAAAAATGG - Intronic
1138395252 16:56699017-56699039 AGAGGAATAAAAAAAGAAAAAGG + Intronic
1139344516 16:66293888-66293910 AGTTTAAAAGAAAAAGAAAAAGG + Intergenic
1139843174 16:69898644-69898666 ATATAAAGACAAATAAAAAATGG - Intronic
1140024771 16:71276349-71276371 ACAGTAACAGAAATAGAAAAAGG + Intergenic
1140476880 16:75243453-75243475 AAGTTAAAACAAATAGCAAATGG + Intronic
1140604126 16:76514113-76514135 AGGTTACTTCAAATAGAATAAGG + Intronic
1140647643 16:77050343-77050365 TGATTTATACAAATATAAAATGG - Intergenic
1140649111 16:77067156-77067178 AGATTAATACAAGGTGATAATGG - Intergenic
1140792390 16:78404506-78404528 TTATTCATACAAATAGAAGAAGG - Intronic
1140815767 16:78619378-78619400 AGTGTAATGCAAGTAGAAAAGGG + Intronic
1140933786 16:79652308-79652330 AGATGAATAAACATAGAAAAGGG - Intergenic
1141232205 16:82179167-82179189 AGATTAAGATGAATGGAAAATGG - Intergenic
1141801682 16:86314023-86314045 ACATATATACAAAAAGAAAAAGG - Intergenic
1203020386 16_KI270728v1_random:397461-397483 ATAAAAATAAAAATAGAAAAAGG + Intergenic
1203038721 16_KI270728v1_random:670619-670641 ATAAAAATAAAAATAGAAAAAGG + Intergenic
1142829422 17:2536745-2536767 ATATAAATACAAATTTAAAAGGG - Intergenic
1142838849 17:2611167-2611189 ACATTAAGAAATATAGAAAAGGG + Intronic
1142935036 17:3322223-3322245 AGATGAATAAAAATGAAAAAGGG - Intergenic
1143360383 17:6364532-6364554 AGCTTAATTAAAACAGAAAAAGG + Intergenic
1145806274 17:27734471-27734493 TGATTCATGTAAATAGAAAATGG + Intergenic
1146154039 17:30504561-30504583 TGATTCATGTAAATAGAAAATGG + Intronic
1146531661 17:33612386-33612408 AGATTAAAAAAAATGGCAAAAGG + Intronic
1146547729 17:33753609-33753631 AGATTCATACACACAAAAAAGGG + Intronic
1146916853 17:36683440-36683462 AAATAAATAAAAATAGAAAAGGG - Intergenic
1147549728 17:41431752-41431774 AGATAAATACAAAAAGAAATTGG + Intergenic
1149041107 17:52189299-52189321 AAATTAAAAAAAAAAGAAAAAGG - Intergenic
1149707580 17:58709073-58709095 AAAGTAATTCAAAAAGAAAAAGG - Intronic
1151005192 17:70427557-70427579 AGATTAATAAATAAATAAAATGG + Intergenic
1151558227 17:74857955-74857977 ACATTAAAACAAATAGAAACAGG - Intronic
1151558249 17:74858116-74858138 AGAGAAATACATTTAGAAAAAGG - Intronic
1151753755 17:76058559-76058581 AATTTAAAACAAATAGAAATTGG - Intronic
1153237435 18:3001490-3001512 ATATTAAGAAAATTAGAAAATGG + Intronic
1153433340 18:5042103-5042125 AGACTAATACAAATATATAAAGG + Intergenic
1153478751 18:5525407-5525429 ATATTAGTGCATATAGAAAATGG - Intronic
1153623440 18:7001574-7001596 AGATTCAGACAAATATTAAAAGG + Intronic
1153718795 18:7880336-7880358 AAATTAATACAACTAACAAATGG + Intronic
1154050152 18:10946971-10946993 ATCTTAAAACAAATAAAAAATGG + Intronic
1155468357 18:26164287-26164309 AGATAAATAATAAAAGAAAAGGG + Intronic
1155654720 18:28178652-28178674 GTAGTAATAGAAATAGAAAACGG - Intergenic
1155810693 18:30230259-30230281 CGCTCAATACAAATATAAAAAGG - Intergenic
1155831738 18:30524493-30524515 ATATTAAGAAAAAAAGAAAAAGG + Intergenic
1156101392 18:33599988-33600010 AGCTTGATCCAAATAGAATATGG - Intronic
1156688977 18:39683617-39683639 AGTTTAAGAAAAATAAAAAATGG + Intergenic
1156689374 18:39687662-39687684 GAATTAATACAAACAGTAAAAGG + Intergenic
1156707626 18:39902065-39902087 AGGTGGATACAAATAAAAAATGG + Intergenic
1156761858 18:40601657-40601679 AGAAAAATAAAAAAAGAAAAAGG - Intergenic
1156933579 18:42675428-42675450 AGACAAATACAAAGAGAAAATGG - Intergenic
1156937503 18:42728292-42728314 ACATTATTAAAAAGAGAAAATGG - Intergenic
1157145915 18:45162182-45162204 AAATCAAAACAAACAGAAAAAGG - Intergenic
1157369119 18:47094084-47094106 AGATTAATGCCATTATAAAAAGG + Intronic
1157837568 18:50920623-50920645 AGATTTTTACAAATAAAAAATGG - Intronic
1157953821 18:52072043-52072065 AGATGAATAGACAAAGAAAATGG - Intergenic
1158021481 18:52847196-52847218 AGATTAATACAAGAAGAAAATGG - Intronic
1158087862 18:53674539-53674561 ATAATAATACAATTATAAAATGG - Intergenic
1158130767 18:54150269-54150291 AGATAAAAACAAATATTAAAAGG + Intergenic
1158996973 18:62931592-62931614 AGATTAACAAAAAAAAAAAAGGG + Intronic
1159398044 18:67890373-67890395 AGATTAATACATAGAGCACATGG - Intergenic
1159489840 18:69117738-69117760 AAATTAATACAAATATAAAGTGG + Intergenic
1159653218 18:71001683-71001705 ATGTTTATCCAAATAGAAAATGG + Intergenic
1159751632 18:72310161-72310183 AGATTAAGACAAATGCAAAATGG + Intergenic
1160474827 18:79173164-79173186 AAATAAATCCAATTAGAAAATGG - Intronic
1160591932 18:79949978-79950000 AGCCTAATACAAATACAAAGAGG + Intronic
1160605434 18:80046378-80046400 AGATTCTCACAAAAAGAAAATGG + Exonic
1161113762 19:2485247-2485269 AGAAAAATAAAAATAAAAAATGG - Intergenic
1161157623 19:2741031-2741053 TGATTCTAACAAATAGAAAATGG + Intergenic
1161695879 19:5767763-5767785 ATAATAAAACAAATAAAAAAGGG - Intronic
1162681027 19:12341538-12341560 ATAGTAATCCAAATAGAACAGGG + Intergenic
1163615440 19:18324681-18324703 AGAGTAATACAGCTATAAAAAGG + Intergenic
1164516121 19:28937072-28937094 AAATTAATACAGACAGCAAACGG + Intergenic
1165021978 19:32932412-32932434 AGTTTTATATAAATAGAAAAAGG + Intronic
1165200265 19:34137918-34137940 AAATTAAAAAAAATAGAGAAGGG - Intergenic
1165577912 19:36837604-36837626 GAATTAAAAAAAATAGAAAAGGG - Intronic
1166262712 19:41652476-41652498 AGATGAATACAAATTCAAGAAGG + Intronic
1167207806 19:48114213-48114235 AAATTAATAAAAATGTAAAAGGG - Intergenic
1167781883 19:51603745-51603767 AAATAAATACAAATAGATCATGG + Intergenic
1167851820 19:52207984-52208006 AGGTTATAAGAAATAGAAAATGG + Intronic
1168011125 19:53533929-53533951 AGATTAACACAAATATAGAATGG + Intronic
1168376194 19:55881867-55881889 AAATTTATACAAATAAAAAAAGG - Intergenic
1168537794 19:57185872-57185894 AGATTAAAAAAAATAGAGATGGG - Intergenic
925070279 2:961055-961077 AGATTTATATCAACAGAAAATGG - Intronic
925071203 2:968323-968345 AGAGTATTACAAATGGAAAAGGG - Intronic
925480192 2:4261907-4261929 AAAGTAATAAAAATAGAAGAGGG + Intergenic
926033536 2:9614643-9614665 AGACTACTAAAGATAGAAAATGG + Intronic
926793865 2:16602781-16602803 CCATTAATACAAAGAGTAAATGG + Intronic
926831945 2:16972820-16972842 AGATTTAAAGAAAAAGAAAAGGG + Intergenic
926897080 2:17704259-17704281 AGATAAAAAGAAATACAAAAAGG + Intronic
927228685 2:20797720-20797742 AGACTAATGCAAATGAAAAAAGG + Intronic
928375944 2:30773508-30773530 AGATGAACAAAAATAGAACAGGG + Intronic
928470035 2:31566285-31566307 ACCTTAATAAAAATAGAAAAAGG + Intronic
928613462 2:33013496-33013518 ACATTAATTAAAATAGCAAAAGG - Intronic
928893266 2:36231675-36231697 ACAATAATTCAATTAGAAAATGG + Intergenic
928986693 2:37189190-37189212 AGAGTAACACAACTAGTAAATGG - Intronic
929185029 2:39085034-39085056 AAATAAATACAAATAAAAATAGG - Intronic
929231618 2:39566010-39566032 AGATTAAGACAAAATGGAAAGGG - Intergenic
929742151 2:44614014-44614036 AGATAAATACAAATGTAGAAGGG + Intronic
929840466 2:45456226-45456248 AGAATGAAACAATTAGAAAACGG + Intronic
930338935 2:50086543-50086565 AGTTTAAGGAAAATAGAAAATGG - Intronic
930398885 2:50857814-50857836 AGATTAAAAAAAACAGACAATGG + Intronic
930558654 2:52931152-52931174 TGATTTTTAAAAATAGAAAAAGG + Intergenic
930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG + Intergenic
931129309 2:59315825-59315847 AAAATAAGACAAAAAGAAAATGG - Intergenic
931251514 2:60535238-60535260 AGATTCATCCAAAAAGCAAAGGG + Intronic
931470020 2:62530206-62530228 AGATAGATACAGATAGACAATGG - Intergenic
931523597 2:63127728-63127750 GGAGTAATACATATAGAATAGGG - Intronic
931550589 2:63441429-63441451 AGATAAAAATAAATAGAAAAGGG - Intronic
931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG + Intergenic
932204264 2:69864436-69864458 AAATCAATATTAATAGAAAATGG - Intronic
932378137 2:71256352-71256374 ATATTAATAAAAAAAGAAAGTGG + Intergenic
932517221 2:72364471-72364493 AGGTTATTACAAATACCAAATGG + Intronic
933078820 2:77963093-77963115 AGTTTAATATAAACAAAAAAGGG + Intergenic
933254158 2:80061406-80061428 TGTTTAAAACAAACAGAAAACGG - Intronic
933444502 2:82362076-82362098 AAATGAATACAAAGAGAAAAAGG - Intergenic
933485058 2:82910496-82910518 AAAGAAATAGAAATAGAAAAAGG - Intergenic
933679047 2:85082530-85082552 ATATAAATAGAAATAGAAAGGGG - Intergenic
933898475 2:86832802-86832824 AGGTTAATAAAAATAAAAAGAGG + Intronic
933950970 2:87329447-87329469 TGATTAAACTAAATAGAAAATGG - Intergenic
934162121 2:89259557-89259579 AGATTAAAAAAAAAAAAAAAAGG + Intergenic
934166697 2:89300395-89300417 AGATTAATGCTACTATAAAAAGG + Intergenic
934200584 2:89882062-89882084 AGATTAATGCTACTATAAAAAGG - Intergenic
934464393 2:94246624-94246646 AAATAAATACAATTAAAAAATGG - Intergenic
935457765 2:103289916-103289938 AGATTCCTACAAATCCAAAAGGG + Intergenic
935478292 2:103553116-103553138 AGAAAAATAAAAATAAAAAAAGG - Intergenic
935953025 2:108348125-108348147 AAATGAAAACAAAAAGAAAATGG + Intergenic
935999179 2:108808689-108808711 ATAATAATCCAAATAAAAAATGG - Intronic
936287891 2:111195173-111195195 AAATAAATACAAACAAAAAAAGG + Intergenic
936651550 2:114433077-114433099 CAAGTAAAACAAATAGAAAAAGG - Intergenic
936752508 2:115662500-115662522 AGAAACATACAAATAGCAAACGG + Intronic
936766787 2:115859625-115859647 AGATTTAAACAAATTAAAAATGG - Intergenic
937381598 2:121382354-121382376 AGAGAAATACAAAAAGCAAAGGG + Intronic
937597240 2:123686820-123686842 ATAATAATACCAATAAAAAATGG + Intergenic
937952535 2:127399588-127399610 AGAATAATACAACTAGTAAATGG + Intergenic
938872364 2:135493163-135493185 ATATATATATAAATAGAAAAAGG + Intronic
939097356 2:137849113-137849135 AGATTTAAAAGAATAGAAAATGG + Intergenic
939349849 2:141021564-141021586 AGACTATAATAAATAGAAAAGGG - Intronic
939536135 2:143431654-143431676 AGATAAATAACAATAGAAAATGG - Intronic
939697632 2:145346236-145346258 AGGTAAATACAAATGGGAAATGG + Intergenic
939903402 2:147879361-147879383 AGATTAATGCCATTATAAAAAGG - Intronic
939943308 2:148377954-148377976 AAATTAATGCAAAGACAAAATGG - Intronic
940131793 2:150390001-150390023 AGTATAATACAACTAGATAATGG + Intergenic
940403941 2:153279322-153279344 AAAGGAATCCAAATAGAAAAAGG - Intergenic
940555959 2:155228837-155228859 AGAAAAATACAAAAATAAAAGGG - Intergenic
941404080 2:165067712-165067734 AGACAAACACAAATAGAAATAGG - Intergenic
941673132 2:168316562-168316584 AGACTAATACAATTACAAAATGG - Intergenic
941754958 2:169175037-169175059 AACTTCATAAAAATAGAAAAAGG + Intronic
942735666 2:179109352-179109374 TTATCAATACAAATAGGAAAAGG + Exonic
942747354 2:179250181-179250203 AAAAAAATCCAAATAGAAAATGG + Intronic
942821956 2:180125070-180125092 AGGTTAATCCAAATAGGATAAGG - Intergenic
943107188 2:183560299-183560321 AGACTAATACAATTTGAGAAAGG - Intergenic
943184774 2:184593952-184593974 AAATTGATACAAATGTAAAAAGG - Intergenic
943224378 2:185150364-185150386 AGATTAAAACAAATGAAAATAGG + Intergenic
943235615 2:185315045-185315067 AAAATAAAACAAACAGAAAAAGG - Intergenic
943497776 2:188645557-188645579 AGTTTTGTACAAATAAAAAAAGG - Intergenic
943749733 2:191498863-191498885 AGATGAATACAACTGGAACAAGG + Intergenic
943863423 2:192896295-192896317 AGATTAATAAAAGGAGAAAATGG + Intergenic
944099510 2:196007880-196007902 AGATTAACACAGATACCAAAAGG + Intronic
944247932 2:197551434-197551456 CAATTAATACAAATATAAATAGG - Exonic
944517277 2:200524850-200524872 AAACCAAAACAAATAGAAAAGGG - Intronic
944950200 2:204739937-204739959 AAACTAATACAAAAAAAAAAGGG - Intronic
944969735 2:204978420-204978442 GTCTGAATACAAATAGAAAAGGG - Intronic
944995535 2:205289535-205289557 AGAGTAACACAAATAGTATATGG + Intronic
945108686 2:206342421-206342443 AGAATAAAACAAAATGAAAAGGG + Intergenic
945206626 2:207339893-207339915 AAAGTATTACATATAGAAAAGGG + Intergenic
945398083 2:209346158-209346180 AAATAAATAAAAATAAAAAATGG + Intergenic
947346899 2:229201091-229201113 ATAATAAAAGAAATAGAAAAAGG - Intronic
948573547 2:238934724-238934746 AAATCAATTCAAATAGAAAATGG + Intergenic
1168916821 20:1495742-1495764 ACATAAAAACACATAGAAAAAGG - Intergenic
1169754957 20:9034061-9034083 AGATAAATCAAAACAGAAAATGG + Intergenic
1170010715 20:11719597-11719619 AGATTCATTCAAAGAGAAAATGG + Intergenic
1170238879 20:14140472-14140494 TGATTCATACAACTAGAAAGGGG + Intronic
1170295309 20:14818435-14818457 AGATGCATTCATATAGAAAAGGG + Intronic
1170688084 20:18587589-18587611 AGAGGAATACAATTAGAAATAGG + Intronic
1170784822 20:19458567-19458589 AAATTCATACACACAGAAAATGG - Intronic
1171089987 20:22275910-22275932 ACACTAATACAAATAGATCATGG + Intergenic
1171126604 20:22607563-22607585 AGATTCATACAAGCAGAAGAAGG - Intergenic
1172289586 20:33766495-33766517 AGATGATTACAATTAGAAGAGGG + Intronic
1172454319 20:35055430-35055452 AGTTTAATACAAACATGAAAAGG - Intronic
1173115364 20:40236644-40236666 AGAGCAAAACAAATAGGAAAAGG - Intergenic
1173118489 20:40268989-40269011 ATATTAGTAGAAATAGAAAAGGG - Intergenic
1173133103 20:40412686-40412708 ACATTGGCACAAATAGAAAATGG + Intergenic
1173276865 20:41592574-41592596 ATATTCATACAAATAGAAACTGG + Intronic
1173496396 20:43521854-43521876 AGTTTACTATAAATAAAAAAGGG - Intronic
1173979239 20:47210469-47210491 AAGTTAATACAAATATAAAAAGG + Exonic
1174688377 20:52477862-52477884 ATATTAATAATAATAGGAAACGG - Intergenic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1175002666 20:55646107-55646129 AAAATAATACAAGTAGGAAAAGG - Intergenic
1175253892 20:57627153-57627175 AGATTTTTAAAAATAGAACAAGG + Intergenic
1176774414 21:13118148-13118170 AGCTGATTATAAATAGAAAATGG + Intergenic
1176991217 21:15498517-15498539 ATTTGAATACAAATAGAAATTGG - Intergenic
1177400685 21:20600782-20600804 AAAAAAATAAAAATAGAAAAAGG + Intergenic
1177499472 21:21933681-21933703 AGACTAATACAAAGAGATATAGG + Intergenic
1177766081 21:25459048-25459070 AGATTTATCAAAATATAAAAAGG + Intergenic
1177847147 21:26303168-26303190 AGAATAAAACAAATAATAAATGG - Intergenic
1178018738 21:28384140-28384162 AGAAAAGTAAAAATAGAAAAGGG - Intergenic
1178227911 21:30745634-30745656 AGACAAAAAAAAATAGAAAAAGG + Intergenic
1178536669 21:33415543-33415565 ATATAAATACATATAGAAAGAGG + Intronic
1178557820 21:33609160-33609182 AGAAAAAAACAATTAGAAAAGGG - Intronic
1178572635 21:33754242-33754264 AAATTCATAAAAATTGAAAAAGG + Intronic
1178972998 21:37197675-37197697 AGATGAACAGAAAAAGAAAAAGG + Exonic
1180168639 21:46044596-46044618 AGATTAAAAAAAATAGAGACAGG - Intergenic
1180539752 22:16432976-16432998 ATAAAAATAAAAATAGAAAAAGG + Intergenic
1182155252 22:28065717-28065739 ACTTTAATTCTAATAGAAAATGG + Intronic
1182562016 22:31167502-31167524 AAATTCATACAGATAGAAAGTGG - Intronic
1182735016 22:32527158-32527180 AGAGTAAGAAAGATAGAAAAAGG - Intronic
1182943110 22:34297083-34297105 AGATTAATGCCACTATAAAAAGG + Intergenic
1182961382 22:34478495-34478517 GGACTAATACAAATACAAACAGG + Intergenic
1185144905 22:49127355-49127377 AAAATAAAACAAAAAGAAAAAGG + Intergenic
949324147 3:2844594-2844616 AGACCAATACAGATAGATAAGGG - Intronic
949352874 3:3143180-3143202 AGACTTAAAAAAATAGAAAAAGG - Intronic
949529623 3:4941476-4941498 ACATTAATAAAAATAAAAAGAGG + Intergenic
949719024 3:6967174-6967196 AAATAAATAAAAATAAAAAAAGG - Intronic
949769442 3:7563413-7563435 AGATTAAACAAAATAGATAATGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950825933 3:15821232-15821254 AGCTTACTACAAAAAGCAAAAGG + Intronic
950881064 3:16323006-16323028 AGATTAAGACACAAAGAAACTGG + Intronic
950974949 3:17230599-17230621 AGATTATTTTAAATATAAAAAGG - Intronic
951485770 3:23208022-23208044 AAATTAATAAAAAAATAAAATGG - Intronic
951801900 3:26605168-26605190 AGGTTAATAAAAACTGAAAAGGG + Intergenic
951903923 3:27684951-27684973 AAATTTATACGAAGAGAAAAGGG + Intergenic
952068980 3:29609753-29609775 AGTTTAATACAAATTTTAAAAGG - Intronic
952625417 3:35397011-35397033 AAATAAATAAAAATAAAAAATGG - Intergenic
953185406 3:40632693-40632715 AGAATAAAACAAGTAGAAGAAGG + Intergenic
954784013 3:53080125-53080147 AGATTAAGACAGAAAGAAAATGG - Intronic
955006075 3:54970157-54970179 AGATTAAGGCATGTAGAAAAAGG - Intronic
955613473 3:60781479-60781501 ATTTTAAAAAAAATAGAAAAGGG + Intronic
955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG + Intronic
955759794 3:62267055-62267077 CCATTAATACAAATATAAAAGGG - Intronic
955852433 3:63235062-63235084 AGATGAGTACAAATAAAAACAGG - Intronic
955990872 3:64626022-64626044 AAGGTGATACAAATAGAAAATGG - Intronic
956083611 3:65586329-65586351 AAATTATTAGGAATAGAAAATGG + Intronic
956136614 3:66105410-66105432 AGATTAAAACTAATAAAAGAAGG - Intergenic
956156212 3:66300475-66300497 TGTTTAAGACAAATAGGAAAAGG - Intronic
956348061 3:68302520-68302542 AGATTAACAAGAAAAGAAAAGGG - Intronic
956921323 3:73932720-73932742 GGATTAACACAAATAAGAAACGG + Intergenic
957187510 3:76961800-76961822 TCATTAATACCAATAAAAAAAGG - Intronic
957587558 3:82151886-82151908 ACACTAATACAAACAGAAAATGG + Intergenic
957699646 3:83692271-83692293 AAATAAATAAAAATATAAAAAGG + Intergenic
957760936 3:84555681-84555703 AAATTAAGAAAAACAGAAAAAGG - Intergenic
957894436 3:86403151-86403173 AAATTAAAAAAAAAAGAAAATGG - Intergenic
958091678 3:88884932-88884954 AGAGTAAAAGAAATAGAAATAGG - Intergenic
958111665 3:89155331-89155353 TTATTAATATAACTAGAAAAAGG - Intronic
958142018 3:89573462-89573484 AGATAAATACAAATTAAAACCGG + Intergenic
958168503 3:89908630-89908652 ATATAAATGCTAATAGAAAAGGG + Intergenic
958267539 3:91457145-91457167 AGTTTAATAAAAATAGCCAAAGG + Intergenic
958555436 3:95669195-95669217 TGATAAATATAAATATAAAATGG - Intergenic
959118747 3:102208315-102208337 AGAATATTAAAAATAGAGAAAGG - Intronic
959205543 3:103302074-103302096 AGATTAATACAAAAGAAGAAAGG - Intergenic
959287191 3:104429802-104429824 AGATAAATACAGATATAAATAGG - Intergenic
959392946 3:105799100-105799122 AGAATAATAAAAATAGAAATGGG + Intronic
959540795 3:107535752-107535774 ACATTAATACAAAAAGTAGACGG - Intronic
959783284 3:110262478-110262500 AAATGAATATAAATAAAAAATGG + Intergenic
959905257 3:111704130-111704152 AAATTTATAAAAATGGAAAATGG + Intronic
960134098 3:114088540-114088562 AGATTAATAAAGATAGATAAGGG - Intergenic
960211792 3:114977008-114977030 AAATTAAAAAAAAAAGAAAAAGG + Intronic
960816716 3:121680806-121680828 AAATTAACCCAATTAGAAAACGG + Intronic
960856258 3:122105199-122105221 ACATTAAAACAAATACAACATGG - Intronic
960923704 3:122775303-122775325 AGACAAAAACAATTAGAAAATGG + Intronic
961232615 3:125331025-125331047 ATATGAATATAAAAAGAAAAGGG + Intronic
962028105 3:131570296-131570318 AAATAAATAAAAAGAGAAAATGG - Intronic
962072058 3:132043995-132044017 AGATTAATATAGACATAAAAAGG - Intronic
962424684 3:135259333-135259355 ATAATAATAAAAATATAAAAAGG + Exonic
962459300 3:135594102-135594124 AGATGAATACTAAATGAAAATGG - Intergenic
963012890 3:140790285-140790307 AAATAAATCCAAATAGAAAATGG + Intergenic
963203761 3:142611832-142611854 TAATTAAAACAAATAGCAAAAGG - Intronic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
964337235 3:155668551-155668573 AGATTACAACAAATAGGAGAGGG + Intronic
964469043 3:157031964-157031986 AGGTCAATAAAAAGAGAAAATGG + Intronic
965095752 3:164222995-164223017 AGGCTAAAACAGATAGAAAAAGG - Intergenic
965461709 3:168973666-168973688 AGATTAATATCAATAAAAGATGG - Intergenic
965743684 3:171903075-171903097 AGAATAATAATAAAAGAAAATGG - Intronic
965911704 3:173785969-173785991 AAAATCCTACAAATAGAAAAAGG + Intronic
966022697 3:175235514-175235536 ATATTAATAAAAATAGAGGAAGG + Intronic
966366898 3:179198163-179198185 GAATCAATACAAAAAGAAAAAGG + Intronic
966547391 3:181165823-181165845 AGATTAATACCCTTATAAAAGGG - Intergenic
967526490 3:190500765-190500787 AAATTCATACAGACAGAAAATGG - Intergenic
967547309 3:190746467-190746489 ACAATAATAAATATAGAAAATGG + Intergenic
968072631 3:195795895-195795917 AGATTATTAGAAACAAAAAAGGG + Intronic
969253559 4:5987696-5987718 AGAGAAATAGAGATAGAAAATGG + Intronic
970144311 4:13018273-13018295 AAATTAACCCAATTAGAAAATGG + Intergenic
970241808 4:14016892-14016914 AAATTAATACAAAGATTAAATGG - Intergenic
970691204 4:18622894-18622916 AAATTAATATAAATAGGAGAAGG + Intergenic
970727893 4:19068874-19068896 AGACTAATACAAACAGATATGGG - Intergenic
970906778 4:21225291-21225313 AGTATAATACAAACATAAAAAGG + Intronic
970911160 4:21277341-21277363 AGATCAAAACAAATAGTATAAGG + Intronic
971149231 4:24013437-24013459 CGATGAATACAAAGAGAAGAAGG - Intergenic
971467768 4:26982866-26982888 AGTGAAGTACAAATAGAAAAAGG - Intronic
971521113 4:27551560-27551582 AGATTAAAAAAGATAGTAAATGG + Intergenic
971740208 4:30509633-30509655 TGACTAATACATATGGAAAAGGG + Intergenic
971820290 4:31544392-31544414 AGATAAACACATATATAAAAAGG - Intergenic
971891307 4:32527056-32527078 ATATTAATAAAAATAGATAATGG - Intergenic
971914319 4:32848773-32848795 ATATAAATAGAAATAGCAAAAGG - Intergenic
971981694 4:33759343-33759365 AAATTTATACAAATAGAAAAAGG - Intergenic
972387515 4:38581562-38581584 AGAGTAATACTTATAGAAAGGGG + Intergenic
972622522 4:40762039-40762061 AGATTAATGCTATTATAAAAAGG + Intronic
972833808 4:42844294-42844316 AGATTAATAAAAATGGACACTGG - Intergenic
972858524 4:43137828-43137850 AGACTAATACAAATGGATAAAGG - Intergenic
972920701 4:43937862-43937884 AGATTAATAAAGATAAGAAAGGG + Intergenic
972988471 4:44794340-44794362 GGATTAATACCATTATAAAAGGG - Intergenic
973242561 4:47972246-47972268 AAAGAAATAAAAATAGAAAAGGG - Intronic
973829645 4:54745789-54745811 AGATAAATAAAAATACAAGAAGG + Intergenic
973956342 4:56067157-56067179 AGAATATTAGGAATAGAAAATGG + Intergenic
974001936 4:56520456-56520478 AGATTCATAGAAATAGAAAGTGG + Intronic
974282238 4:59811807-59811829 ATATGAATACATATAAAAAAAGG - Intergenic
974350579 4:60739578-60739600 AAACTAATAGAAAAAGAAAAGGG + Intergenic
974624990 4:64414269-64414291 AGAAAGATACATATAGAAAATGG + Intergenic
974728245 4:65825043-65825065 AGATTCTTACAAACAGTAAAGGG + Intergenic
974737623 4:65958490-65958512 TGAGTAAGACACATAGAAAATGG + Intergenic
974925286 4:68291279-68291301 AGACTAACACAATTATAAAAAGG - Intergenic
975068582 4:70101884-70101906 AAAAGAATCCAAATAGAAAAGGG + Intergenic
975523281 4:75322971-75322993 ATATTAAGACAAATACAATATGG - Intergenic
975655800 4:76640085-76640107 AGATTATTACAAGCAGATAAAGG + Intronic
975917572 4:79342890-79342912 AAAGTAATAAAAAGAGAAAATGG + Intergenic
976143087 4:82013375-82013397 AGATTAATGCCATTATAAAAAGG + Intronic
976429908 4:84950408-84950430 AGTTTAATAAAAAAAAAAAAAGG + Intronic
976839039 4:89409393-89409415 AAATGAAAACAAAAAGAAAATGG + Intergenic
976843775 4:89463343-89463365 AGATAGATACAAAGAGAAAAAGG + Intergenic
977350413 4:95877966-95877988 AAAATAATAAAAATAAAAAAAGG + Intergenic
977432468 4:96948212-96948234 AGGTTAATATTAATAGATAAGGG - Intergenic
977449237 4:97174047-97174069 AGATGAGTACAAATGGATAAGGG + Intergenic
977739452 4:100460363-100460385 AGACTAATACACCTATAAAATGG - Intronic
977817279 4:101429554-101429576 TAATTAATACAATTAGAAAGGGG + Intronic
977833621 4:101621296-101621318 AGATTAATTCAAATGGGAAAAGG + Intronic
977842530 4:101725890-101725912 AGATTGATACAACTGGAAGAGGG + Intronic
977861586 4:101967472-101967494 AGATTTAAACAAATTGAGAAAGG + Intronic
978351996 4:107829717-107829739 ATAATAATATAAATAGTAAATGG - Intronic
978619907 4:110627763-110627785 AGAGCAAAAGAAATAGAAAAGGG - Intronic
978823091 4:112988472-112988494 AAATTAATAGAAAGAAAAAAGGG + Intronic
978880611 4:113697799-113697821 AGTTTAATTCAAGGAGAAAATGG - Intronic
978972849 4:114831665-114831687 AGCTTAATACAATCAGAGAAAGG + Intronic
979059505 4:116039413-116039435 ACATTGATCCAAATAGAACAAGG - Intergenic
979122035 4:116915434-116915456 AGATTAATAAGAAAAAAAAATGG + Intergenic
979588277 4:122446491-122446513 AGATTAAAAGAAAAAGGAAAAGG - Intergenic
979593400 4:122506133-122506155 AGATTGATACCATTATAAAAGGG - Intergenic
979760461 4:124396360-124396382 AAATTAACTCAAATAGATAATGG + Intergenic
979792324 4:124800659-124800681 AGAGGAATACAAAAAAAAAATGG - Intergenic
979922049 4:126510135-126510157 AGATGAATAAATAAAGAAAATGG + Intergenic
979922664 4:126520464-126520486 AGATACAATCAAATAGAAAAAGG + Intergenic
979940478 4:126756383-126756405 ATATCAATACCAATAGAAACTGG - Intergenic
980057446 4:128092206-128092228 AAATTAACATAAATAAAAAATGG + Intronic
980093884 4:128469991-128470013 AGAATAATAATAATAAAAAAAGG + Intergenic
980200317 4:129648798-129648820 AGATGAAGATAAACAGAAAATGG + Intergenic
980251289 4:130319003-130319025 AGAATAATAAAAATTGTAAAGGG + Intergenic
980316367 4:131206897-131206919 AGAGAAAGAGAAATAGAAAAGGG - Intergenic
980497278 4:133602867-133602889 TGTTTAATAGAAATAGAAATAGG - Intergenic
980547725 4:134290462-134290484 AGATTAATTAAAATATAATAAGG - Intergenic
980759202 4:137206584-137206606 ATATTAATATAAATAGCACATGG - Intergenic
980867651 4:138572365-138572387 AGAATCACACAAATAGAAAGTGG + Intergenic
980938700 4:139251811-139251833 AAATTAATATTAATAGAAAATGG - Intergenic
981056729 4:140370728-140370750 ACATTAAAACAATTAGATAAAGG - Intronic
981501145 4:145453208-145453230 ACATTAATACAAATACACAGGGG + Intergenic
981690620 4:147505031-147505053 TGAATAATCCAAATAGAAAATGG + Intronic
981847491 4:149186058-149186080 AAATTAACATAAAAAGAAAAAGG - Intergenic
981993284 4:150950113-150950135 AGATAAATGCAAATTTAAAAAGG - Intronic
982272401 4:153604692-153604714 AAATAAATAAAATTAGAAAAAGG - Intronic
982335114 4:154227607-154227629 ACAGTAAGAGAAATAGAAAATGG - Intergenic
982335216 4:154228956-154228978 AAATCTATATAAATAGAAAATGG - Intergenic
982372042 4:154644356-154644378 AGATGTATACAAATAACAAAGGG - Intronic
982421654 4:155206281-155206303 CGATTAATCCAAATTGAAATAGG - Intergenic
982529676 4:156523437-156523459 AGAACCAGACAAATAGAAAAGGG + Intergenic
982762618 4:159304691-159304713 AAATTTATACAAATAAAAAAAGG - Intronic
983286285 4:165743349-165743371 AAATTAATAAAAATAAAAAAAGG + Intergenic
983459487 4:168010351-168010373 ATATACATAGAAATAGAAAATGG + Intergenic
983763126 4:171439539-171439561 AAATTAATAGAAACAGAAAGTGG - Intergenic
984019861 4:174471952-174471974 AGATTGAAACAAAAAGAGAAAGG - Intergenic
984123128 4:175770913-175770935 AGATTAATACCAGTAAATAAGGG - Intronic
984168874 4:176337116-176337138 TCAATAAGACAAATAGAAAATGG - Intergenic
984197093 4:176671231-176671253 AGATGAATAAAAATAGTATATGG + Intergenic
984219854 4:176960632-176960654 AGATCAAAAGAAATAGAGAAAGG + Intergenic
984377041 4:178945188-178945210 AGATAGATACAAAAATAAAAAGG - Intergenic
985105271 4:186493392-186493414 AAATCAATACAAATAAAAATAGG - Intronic
985756533 5:1722802-1722824 ATCTTAATTCAAAAAGAAAATGG - Intergenic
985930705 5:3055156-3055178 AGATTAATATAAAGAAAATATGG + Intergenic
986487846 5:8258138-8258160 AGATTCAAACAAATAAAGAAAGG - Intergenic
986562531 5:9076613-9076635 AAATTTGTACAAATAAAAAATGG + Intronic
986792423 5:11175180-11175202 AGATTAATTATAATATAAAATGG - Intronic
986914113 5:12595540-12595562 AGATTGAACCAAATAGCAAATGG + Intergenic
987214913 5:15725127-15725149 AGATTAAAACAGAGATAAAATGG - Intronic
987474924 5:18379395-18379417 AAAATAAAAGAAATAGAAAATGG + Intergenic
987497109 5:18660275-18660297 AGAGATATACAGATAGAAAATGG - Intergenic
987551637 5:19389800-19389822 AGCTTAATCCTAATAGACAAAGG - Intergenic
987555531 5:19442017-19442039 ACATTCAAACAATTAGAAAATGG + Intergenic
987580091 5:19778880-19778902 AGCATAATACATGTAGAAAAAGG - Intronic
987674323 5:21054573-21054595 ATATAAATACAACAAGAAAAAGG - Intergenic
988212349 5:28220772-28220794 ACATTAATAGATATTGAAAAAGG + Intergenic
988273245 5:29045421-29045443 AGTTTAAGATAAATAGAATATGG - Intergenic
988286041 5:29217612-29217634 ACATTAATTCAATTAAAAAATGG - Intergenic
988388307 5:30595086-30595108 AGACAAATACAAACAGACAAAGG - Intergenic
988422332 5:31021917-31021939 AGTATAATAAAAAAAGAAAATGG - Intergenic
988576866 5:32434606-32434628 AGACTAATATAATTGGAAAATGG - Intronic
988715230 5:33819936-33819958 AGATAATCACAAATACAAAATGG - Intronic
988818559 5:34858653-34858675 ATAGTAATAAAAATAGAAAAAGG + Intronic
988831965 5:34996644-34996666 TGAAGAATACAAATAGAATAGGG - Intergenic
988886563 5:35564311-35564333 AGACTAATACAAGCAGAACAGGG + Intergenic
988898653 5:35707366-35707388 GAATTAAGACAAGTAGAAAAGGG - Intronic
988903291 5:35756852-35756874 ATAGAAATAGAAATAGAAAAAGG - Intronic
988933358 5:36059007-36059029 AGATAGAAACAAATAGAAATAGG + Intronic
988933500 5:36060235-36060257 AAATTAATTCAAAAACAAAAAGG + Intronic
989018531 5:36970850-36970872 AAATTAATAAGAATAAAAAAAGG - Intronic
989039620 5:37214063-37214085 ATATCAATAAAAAAAGAAAAAGG + Intronic
989377386 5:40778577-40778599 ATATTAAAACATATAGAAATTGG + Intronic
990111190 5:52327391-52327413 AGAGTAATACAAAGAGACCAGGG - Intergenic
990125621 5:52513832-52513854 AGATTAAGAAAAATAAGAAAAGG + Intergenic
990181802 5:53169009-53169031 AGAATAAGACAAATAGGAAATGG + Intergenic
990854247 5:60245539-60245561 AGATTAATGGATAAAGAAAACGG + Intronic
990954499 5:61329931-61329953 AGATTAATTCACATTGAACAGGG - Intergenic
991113685 5:62929430-62929452 AGTCTAATACAAATATAATATGG - Intergenic
991463826 5:66888548-66888570 ACCTTAATACCAAAAGAAAAAGG - Intronic
992082574 5:73248914-73248936 AGATTAATACAGTTAGACTAGGG + Intergenic
992437752 5:76771553-76771575 ATATTAAAAAAAAAAGAAAAAGG + Intergenic
992468407 5:77030058-77030080 AGGTTAATAAATTTAGAAAAGGG - Intronic
992561927 5:77960854-77960876 AGGTTAATATTAATTGAAAAAGG - Intergenic
992647482 5:78825452-78825474 ATATGATTACAATTAGAAAAAGG + Intronic
992885866 5:81159786-81159808 AGAATAATATGAGTAGAAAATGG - Intronic
992964932 5:81989888-81989910 AGATGAATAAAAATTGAAACAGG - Intronic
993000422 5:82375299-82375321 AGATTATTCCAAAAAGAATAGGG + Intronic
993255161 5:85581561-85581583 AGATTAATACAAATAGGCATAGG - Intergenic
993264772 5:85710805-85710827 ATATTAATACAAATATGAATAGG - Intergenic
993323319 5:86503033-86503055 AAATTAATATAAATAGAAGCTGG + Intergenic
993385822 5:87261979-87262001 AGAGTAAGATAAATATAAAATGG + Intergenic
993493763 5:88584710-88584732 AGACTAATAAGAAGAGAAAATGG - Intergenic
993510051 5:88759495-88759517 AGATAAATAAAAATAAAAATTGG + Intronic
993787370 5:92159890-92159912 GGACTAATACAAATAGCAAGGGG - Intergenic
993926538 5:93873052-93873074 AGATTTATACAAATAGGCAAAGG + Intronic
993935235 5:93991577-93991599 AGATTTAAAAAAATAAAAAATGG + Intronic
994109306 5:95982290-95982312 AATTGAATACAAGTAGAAAATGG - Intergenic
994138118 5:96310875-96310897 AGATCAACACAAATAGAAGTTGG - Intergenic
994243738 5:97454685-97454707 AGAATAATACAAATATAAGCAGG + Intergenic
994362884 5:98874997-98875019 ATGTTAATACAAATAAATAAAGG + Intronic
994677504 5:102843669-102843691 AAATCAATCCAAATAGAAAATGG + Intronic
995378140 5:111501500-111501522 GAATTAATAAAAATAGAAACAGG + Intronic
995405921 5:111795579-111795601 ATATTAATAAGAATAGTAAAAGG - Intronic
995462292 5:112417428-112417450 AGATAGAAACAATTAGAAAAAGG - Intronic
995496331 5:112748282-112748304 AGAGAAAGAGAAATAGAAAAGGG + Intronic
995554139 5:113310219-113310241 AGATTAATACCCTTACAAAAGGG + Intronic
995627877 5:114098796-114098818 AAATTTATACAAATAAAAGAGGG - Intergenic
995961848 5:117851348-117851370 AGTATAATAATAATAGAAAAAGG - Intergenic
996425166 5:123306022-123306044 AGATTCATAGAGATAGAAAGCGG - Intergenic
996712977 5:126562187-126562209 AAATTAATAAAAATAAAAAAAGG - Intronic
996864114 5:128099666-128099688 AAATTTTTAAAAATAGAAAAAGG - Intronic
996881904 5:128307555-128307577 AGAGAAGTACAAATTGAAAAAGG + Intronic
997152757 5:131516667-131516689 AGACTGAAATAAATAGAAAAAGG + Intronic
997314077 5:132917242-132917264 ATATTAATACAAATCAAAACAGG + Intronic
997324357 5:133007757-133007779 GGATTAATACATATAATAAATGG + Intronic
998291519 5:140919498-140919520 GAATTAAAACATATAGAAAAAGG - Intronic
998302075 5:141032082-141032104 AGTTTAAAAGACATAGAAAATGG - Intergenic
998674315 5:144390176-144390198 AAATTATCACATATAGAAAAGGG - Intronic
998983975 5:147734671-147734693 AAATAAATACAAAAACAAAAAGG - Intronic
999274193 5:150318098-150318120 AGAATAATACAATTAGCAATTGG - Intronic
999873948 5:155781770-155781792 AGATTAAGAATAATTGAAAATGG - Intergenic
999914891 5:156247685-156247707 AGTTCAATACAAATACACAACGG + Intronic
1000093575 5:157951103-157951125 ACATTCATAAATATAGAAAAAGG + Intergenic
1000500850 5:162047732-162047754 AGATTAAAAAAAAAAAAAAAAGG - Intergenic
1000505797 5:162116259-162116281 AGCTTAAGATAAATAGATAAAGG - Intronic
1000975049 5:167755476-167755498 AAATAAATATAAATATAAAATGG + Intronic
1001062210 5:168501893-168501915 TTATTAATACAAATATTAAAAGG - Intronic
1001760896 5:174207327-174207349 AAATTAATAAAAAAAGAAAATGG + Intronic
1001901971 5:175438862-175438884 AGATTAAGACAACTTGAAAGAGG - Intergenic
1002056534 5:176600934-176600956 AAATTAATAAAAATAATAAAGGG + Intronic
1002882001 6:1261414-1261436 AGAGGAATCCAAATAGAAAGAGG + Intergenic
1003391628 6:5718233-5718255 TAATTAATACAAAAATAAAATGG - Intronic
1003564273 6:7209121-7209143 ATATTTATAGAAATACAAAATGG - Intronic
1003725546 6:8758696-8758718 AAATTGACACCAATAGAAAAAGG - Intergenic
1004049952 6:12067250-12067272 ACTTCAATAAAAATAGAAAATGG - Intronic
1004278852 6:14262109-14262131 AAATTAATACAGAGAGAAACAGG + Intergenic
1004292998 6:14385361-14385383 AAATTAAGACACATAGAAAATGG - Intergenic
1004496679 6:16170627-16170649 ATATTAAGACAAAGAGAAAAAGG - Intergenic
1004805172 6:19195883-19195905 TGATAATTACAAAGAGAAAATGG + Intergenic
1004847977 6:19666795-19666817 AGACTATTTCAAATAGAGAAAGG + Intergenic
1004938559 6:20531794-20531816 AGATTAAAAAAAAAAAAAAAAGG - Intergenic
1005073937 6:21888825-21888847 AGAATAATACAAATAACAAGAGG - Intergenic
1005227898 6:23664221-23664243 AGCTTAATAATAATACAAAAAGG - Intergenic
1005985522 6:30871945-30871967 TGATTGAAACAAATAAAAAAGGG - Intergenic
1006958876 6:37905685-37905707 AGATTAACTCAAATATAAAAGGG - Intronic
1006996014 6:38261554-38261576 AGATACATATAAGTAGAAAATGG - Intronic
1008119966 6:47602049-47602071 AGATTAGAACAAAAACAAAATGG - Intronic
1008358855 6:50591059-50591081 AGATTAAATAAAGTAGAAAATGG + Intergenic
1008506272 6:52233793-52233815 AAATTCATACAAGCAGAAAATGG + Intergenic
1008728780 6:54454309-54454331 AGATAAATTCAAAAACAAAATGG - Intergenic
1008740763 6:54604883-54604905 AGAAAAAAACAAACAGAAAAGGG - Intergenic
1008764115 6:54890348-54890370 AGTTTTACAAAAATAGAAAAAGG - Intronic
1008836045 6:55831693-55831715 AGATGAAGAAAAAAAGAAAAAGG + Intronic
1008987676 6:57564445-57564467 AGTTTAATAAAAATAGCCAAAGG - Intronic
1009176280 6:60463050-60463072 AGTTTAATAAAAATAGCCAAAGG - Intergenic
1009288910 6:61859768-61859790 ATATGTATATAAATAGAAAAAGG + Intronic
1009295112 6:61937268-61937290 AGTATAATAAAAAAAGAAAAAGG - Intronic
1009305336 6:62082991-62083013 AGAGAAATACTAGTAGAAAAGGG + Intronic
1009523549 6:64714959-64714981 ATATTAACACATCTAGAAAAAGG - Intronic
1009713190 6:67351352-67351374 AGTTCAGTACAAACAGAAAAAGG + Intergenic
1011048302 6:83112212-83112234 AAATAAAAACAAGTAGAAAATGG + Intronic
1011301683 6:85881514-85881536 AGATAACTAGAGATAGAAAAGGG + Intergenic
1011323590 6:86124304-86124326 AAAATATTATAAATAGAAAAAGG + Intergenic
1011372736 6:86655735-86655757 AAATTAATACAAATAGATCATGG + Intergenic
1011837975 6:91457343-91457365 AGACTAATACAAAGATAGAAAGG + Intergenic
1011925545 6:92640315-92640337 AGTATAATAAAAAAAGAAAAAGG - Intergenic
1011983310 6:93413896-93413918 AGATAAACACAAATAGCAATAGG + Intronic
1012111512 6:95241535-95241557 AGATTAATAAAAATACTTAAAGG + Intergenic
1012323726 6:97886648-97886670 AGATGTCTACAAATAGTAAAAGG - Intergenic
1013066952 6:106693219-106693241 AGATTAATACACAAGGCAAAAGG + Intergenic
1013248889 6:108314723-108314745 AGTTTAATAATAATAAAAAAAGG + Intronic
1013446528 6:110234287-110234309 ATATTAAAACAAATAAAACATGG - Intronic
1013464105 6:110401624-110401646 ATATAAATACATATAGGAAAAGG + Intronic
1013850625 6:114509993-114510015 AAATTAATCCAATCAGAAAATGG - Intergenic
1013922419 6:115423385-115423407 AGATTAACACAATAAGAAATGGG + Intergenic
1014076014 6:117234977-117234999 ATTTTTATACAAAGAGAAAAAGG - Intergenic
1014170629 6:118275135-118275157 AGATTTATACAAATATGAAGTGG - Intronic
1014341350 6:120211550-120211572 AGATTAAAACAGAAAGAAAGAGG - Intergenic
1014344997 6:120258039-120258061 AAATTTAAACAAGTAGAAAATGG + Intergenic
1014357369 6:120429734-120429756 AGATGAATGCAAATAAGAAAGGG - Intergenic
1014369050 6:120582315-120582337 ACATTAATAATAATAGTAAAGGG - Intergenic
1014591264 6:123274432-123274454 AGACTAAAACACCTAGAAAATGG - Intronic
1014845052 6:126264950-126264972 AGATGAATACAGCTAGTAAATGG + Intergenic
1015219229 6:130785067-130785089 AGTGTCATACAAAGAGAAAAAGG - Intergenic
1015884890 6:137906973-137906995 AGAGTAATAAAAATATATAAAGG - Intergenic
1016776793 6:147913390-147913412 AGAATCATACAAATATGAAATGG + Intergenic
1017021950 6:150147125-150147147 AGATTAAAAAAAAAAAAAAAAGG - Intronic
1017868212 6:158463309-158463331 AAATAAAAACAAATAGAAAGGGG - Intronic
1017989746 6:159475979-159476001 AGTTTAAGAATAATAGAAAATGG + Intergenic
1018318583 6:162583020-162583042 GGATTAATACCATTATAAAAGGG + Intronic
1018443696 6:163835720-163835742 AAATAAATACAAACATAAAATGG + Intergenic
1018796799 6:167192067-167192089 ATATTAGGACAAAAAGAAAAAGG - Intronic
1018819522 6:167363044-167363066 ATATTAGGACAAAAAGAAAAAGG + Intronic
1019116977 6:169772971-169772993 AAATGAATACAACTAAAAAAAGG - Intronic
1019852997 7:3578040-3578062 AGATGAATACAAAAAAACAAGGG - Intronic
1020338261 7:7081760-7081782 AGATCAGGACAGATAGAAAAAGG + Intergenic
1020763920 7:12298065-12298087 AGATTAATAATAAAAAAAAAGGG - Intergenic
1020918061 7:14223520-14223542 AGAATAATATATATAAAAAAGGG + Intronic
1021142318 7:17042380-17042402 AGATTAATAGAAAAAGAAGTAGG + Intergenic
1021245340 7:18255054-18255076 AGGTTGATATAAATAAAAAAGGG - Intronic
1021421294 7:20448151-20448173 AAATTCATAAAAATAGAAAGTGG + Intergenic
1021732049 7:23605251-23605273 AGATTAGGACAAAGAGAAATGGG + Intronic
1022363683 7:29687248-29687270 AGATAAAAACAAAGAGATAATGG - Intergenic
1022586450 7:31617919-31617941 TCTTTACTACAAATAGAAAAGGG - Intronic
1022697688 7:32726479-32726501 AGATAAAAACAAAGAGATAATGG + Intergenic
1023171764 7:37396602-37396624 AAATGAATACCTATAGAAAATGG - Intronic
1023278790 7:38548361-38548383 TGTTTAATACAAAGATAAAAAGG - Intronic
1023288933 7:38649068-38649090 AGAGAAATAAAAATATAAAATGG + Intergenic
1023658879 7:42453370-42453392 AGAATAATACAAATACTAGAAGG + Intergenic
1023667524 7:42540263-42540285 AGATTAATACAAACATACAGTGG + Intergenic
1023783749 7:43684537-43684559 AGATTATGACCAATAGAATATGG - Intronic
1024132452 7:46368429-46368451 ATATTAATAGAAAGAAAAAATGG + Intergenic
1024531323 7:50394869-50394891 TGATTAATCTAATTAGAAAAGGG + Intronic
1024602175 7:50993709-50993731 AAATAAATAAAAATAAAAAATGG - Intergenic
1025621915 7:63180827-63180849 AGATCTATACAGTTAGAAAAAGG - Intergenic
1025959518 7:66207553-66207575 AGAAGAATAAAAAAAGAAAAGGG - Intronic
1026374200 7:69733865-69733887 ACATTAATACTATGAGAAAAAGG - Intronic
1027544506 7:79509943-79509965 AAATAAATAAAAATACAAAAAGG + Intergenic
1027635106 7:80662060-80662082 ATTTTAAGAAAAATAGAAAACGG + Intronic
1027696572 7:81418897-81418919 AGATTAAGACATATTGTAAATGG - Intergenic
1027832341 7:83195202-83195224 ATATTAATATAATTACAAAAAGG - Intergenic
1027838446 7:83277354-83277376 AGACTATAACAAATAGAAGAAGG - Intergenic
1027874607 7:83752736-83752758 AGATTAATACAACCATAAAAAGG + Intergenic
1027935944 7:84602906-84602928 AGATTTTTAAAAATAGAAGAAGG - Intergenic
1028479033 7:91284492-91284514 TGATTAATTCATAAAGAAAAGGG + Intergenic
1028595882 7:92546100-92546122 ATATTAATACAAAAAAAGAAGGG + Intergenic
1028631697 7:92942058-92942080 AAATTAATACAAGGACAAAATGG - Intergenic
1028640601 7:93038537-93038559 AGATTAAAATAATAAGAAAATGG + Intergenic
1028799047 7:94940338-94940360 AAATTAAAAGAAAAAGAAAAAGG - Intronic
1028917250 7:96272754-96272776 AGATTAAAAGACAAAGAAAAGGG + Intronic
1030394150 7:108964524-108964546 TGATTATTTCAAATAGAAATTGG - Intergenic
1030455220 7:109764011-109764033 AGAGAAATACAAGTAGAAGAAGG + Intergenic
1030482085 7:110117138-110117160 ATATTAATTCAAAAAGAGAAAGG - Intergenic
1030535628 7:110762902-110762924 TGATTAATAATAATAGGAAATGG - Intronic
1030744658 7:113150832-113150854 AGAATATTAAAAATAGAAACAGG + Intergenic
1031063179 7:117074868-117074890 AAAAGAATACAAATACAAAAAGG - Intronic
1031465298 7:122102594-122102616 GTATTAAAATAAATAGAAAATGG + Intronic
1031646251 7:124229882-124229904 AGATAGATACAAATACAAATTGG - Intergenic
1031661422 7:124429718-124429740 AAAATTATACAAATAGAAACAGG + Intergenic
1031705347 7:124974551-124974573 ATAATAATAAAAAAAGAAAAAGG - Intergenic
1032169034 7:129568990-129569012 AGATTTAAAAAAACAGAAAAGGG + Intergenic
1032652852 7:133897578-133897600 ATAATAATTCAAAGAGAAAAAGG + Intronic
1032969689 7:137146381-137146403 AGATTAAAAGAAATAGGCAATGG + Intergenic
1033179357 7:139160234-139160256 CCACTAATAGAAATAGAAAAGGG + Intronic
1033191079 7:139280317-139280339 ATATTTAGAGAAATAGAAAAGGG + Intronic
1033860589 7:145621364-145621386 AGATTAATCAAAATACAAATAGG - Intergenic
1035986369 8:4436620-4436642 GGATTAAAAAAAATAGAAGAAGG - Intronic
1036022998 8:4869676-4869698 AGATTAATAATCAGAGAAAATGG - Intronic
1036030712 8:4968769-4968791 AAAATAATAAAAATAAAAAAAGG + Intronic
1036059521 8:5300144-5300166 AAATTAGAATAAATAGAAAATGG + Intergenic
1036399061 8:8392280-8392302 AGACTAATACATATAGAAAAGGG - Intergenic
1036617714 8:10401856-10401878 AAATTCATAGAGATAGAAAATGG + Intronic
1037025367 8:14028996-14029018 CGAATAATCCAAATAAAAAAGGG + Intergenic
1037225884 8:16589294-16589316 AGAGTAATATCACTAGAAAATGG - Intergenic
1037797559 8:22009499-22009521 AAATTAATTCAACTGGAAAATGG + Intergenic
1038073836 8:24047468-24047490 AGATTAAAAAAAAAAAAAAAAGG + Intergenic
1038297370 8:26306831-26306853 AAATTAATACATATATAGAATGG + Intronic
1038509045 8:28113790-28113812 AGATTAATGCCATTATAAAAGGG - Intronic
1038554524 8:28498036-28498058 ACATTCATAAAAATAGAAATGGG + Intronic
1038649493 8:29389508-29389530 AAATAAATAAAAATAAAAAAAGG + Intergenic
1039090452 8:33822900-33822922 AAATTTATATAGATAGAAAAGGG + Intergenic
1039801529 8:40960872-40960894 AGATTAAGAAAAATAGAAGATGG + Intergenic
1039925170 8:41923802-41923824 AAAATAATACAAGGAGAAAATGG - Intergenic
1039980945 8:42409663-42409685 AAAGTAAAACAAATGGAAAAGGG + Intergenic
1040076842 8:43245753-43245775 AGATAAATAAAAAATGAAAATGG - Intergenic
1040640148 8:49323759-49323781 AGATTAATACAAATATAAAAGGG + Intergenic
1040730619 8:50442648-50442670 AAATTAATACAAAGAAAAAAAGG - Intronic
1040912952 8:52540319-52540341 AAATTATTATAATTAGAAAATGG - Intronic
1041123761 8:54613585-54613607 ATATTTATACAGATAGATAAGGG + Intergenic
1041193675 8:55378829-55378851 ATTTTAATACAAATATTAAATGG + Intronic
1041534088 8:58906363-58906385 ACATTTCTGCAAATAGAAAAGGG + Intronic
1041618860 8:59940734-59940756 AAATCAATGCAAATAGCAAAAGG - Intergenic
1041864604 8:62556739-62556761 AGATTAATATAAGTTCAAAATGG - Intronic
1042064122 8:64855515-64855537 ATATTAATTTAAATATAAAAAGG - Intergenic
1042567074 8:70122697-70122719 CGATTAATAAAAATGGAAAGTGG - Intronic
1042889155 8:73587907-73587929 AAAATAATACATATATAAAAAGG - Intronic
1043070762 8:75633076-75633098 AAATTAATACAAGAATAAAATGG - Intergenic
1043216584 8:77598573-77598595 AGATTAAGAAAAAAAGAAACAGG + Intergenic
1043297868 8:78688424-78688446 AGATGAATATAAATTGAAAAGGG + Intronic
1043806278 8:84675877-84675899 AGATTTGTACAAATAAAAAGGGG + Intronic
1043966867 8:86488073-86488095 CTAATAATAAAAATAGAAAAAGG + Intronic
1044129372 8:88501899-88501921 ATATTCATACAAATAGCGAAAGG - Intergenic
1044160389 8:88906470-88906492 AGACTAAAACAAAAAGAAATTGG + Intergenic
1044226517 8:89725129-89725151 AGAGTTATACAGATAGAAAGTGG + Intergenic
1044374479 8:91453221-91453243 AGATTAAAACAGAGAAAAAAAGG - Intergenic
1044671651 8:94687199-94687221 AAATCTATAGAAATAGAAAATGG - Intronic
1044724993 8:95187436-95187458 ATAAAAATAAAAATAGAAAAGGG - Intergenic
1045827425 8:106415296-106415318 CTATTAATACCAATAAAAAATGG - Intronic
1046036926 8:108853913-108853935 AGACTAACAGAAATAGAAGAGGG - Intergenic
1046099887 8:109602154-109602176 AAATGATTAAAAATAGAAAAAGG + Intronic
1046362543 8:113181734-113181756 AAAGAAATACAAATACAAAAAGG + Intronic
1046754785 8:117962217-117962239 AGAGTATTCCAAATAGATAATGG - Intronic
1046838848 8:118834784-118834806 AGATGAATAAAAATAAAATAAGG + Intergenic
1047061961 8:121237021-121237043 AGATAAAAACAATTACAAAATGG - Intergenic
1047515276 8:125548915-125548937 AGATCAGTGAAAATAGAAAATGG - Intergenic
1047618819 8:126585790-126585812 AGAGTGAGACAAATAGAAAAGGG + Intergenic
1047707921 8:127520355-127520377 CAAATAATACAATTAGAAAATGG + Intergenic
1048134617 8:131736566-131736588 AAATTTATAAAAATAGAAAATGG + Intergenic
1048639720 8:136341042-136341064 AGATTTAGAGAAATATAAAATGG + Intergenic
1049943486 9:572068-572090 AGTTTAAAACAAATTAAAAATGG + Intronic
1050402283 9:5268946-5268968 ATAATAATAATAATAGAAAATGG - Intergenic
1051013047 9:12441615-12441637 AGAATAACAAAAAGAGAAAAAGG - Intergenic
1051054038 9:12962420-12962442 GGATTAATAGAAAAAAAAAATGG + Intergenic
1051171789 9:14325144-14325166 AGATTAATATAAAAAGATACTGG - Intronic
1051189636 9:14498014-14498036 AGCTTAATACAAAAACAAAGTGG - Intergenic
1051258412 9:15236993-15237015 AGATTGAGACAAAAAAAAAAAGG + Intronic
1051436392 9:17037547-17037569 AGAGTAATGCACATAGGAAAGGG - Intergenic
1051518423 9:17957126-17957148 AGATTAATTGAATTAAAAAACGG + Intergenic
1051804077 9:20971793-20971815 AAATTCATAGAAAAAGAAAATGG - Intronic
1051850155 9:21497096-21497118 AGATTAAGACAGAGGGAAAATGG + Intergenic
1052416039 9:28178907-28178929 AGATTCAGAAAAATTGAAAATGG - Intronic
1052423701 9:28276363-28276385 AGATTAATAAGAATAGATGAGGG - Intronic
1052536195 9:29750442-29750464 AAACTAATACAAAGAGTAAAAGG + Intergenic
1052560044 9:30073922-30073944 AGAATCTTAAAAATAGAAAATGG + Intergenic
1052617496 9:30860393-30860415 AGAATAATACAAAGAAAACATGG + Intergenic
1052621257 9:30912861-30912883 ACATTAATACAGATAGACAGTGG - Intergenic
1052782258 9:32793702-32793724 AGAATAATACCATTATAAAAGGG + Intergenic
1053180769 9:35967459-35967481 ACAATAATTCAATTAGAAAATGG - Intergenic
1054916744 9:70501448-70501470 AGAATCATGCAAATAGAAAGTGG + Intergenic
1055444184 9:76366629-76366651 AGATTCAAAAAAATAGAAACGGG - Intergenic
1055527521 9:77149908-77149930 AGATTAAAAAAAAAAAAAAAAGG - Intergenic
1055614799 9:78060351-78060373 AGTATAATAAAAAAAGAAAAAGG + Intergenic
1055743008 9:79410348-79410370 AGATTAATACACTTATGAAAAGG + Intergenic
1055789392 9:79906321-79906343 AGATTTCTAAAAATAAAAAATGG + Intergenic
1056422483 9:86442809-86442831 AAATTAATAAAAAGATAAAAAGG - Intergenic
1056614524 9:88152385-88152407 ATATTAATATAAATGTAAAACGG - Intergenic
1057423926 9:94933725-94933747 AAATAAATAAAAATAAAAAAAGG - Intronic
1058008994 9:99953932-99953954 TGATTATTATTAATAGAAAAAGG + Intronic
1058097740 9:100882269-100882291 AGATTATTTCAAGGAGAAAAAGG - Intergenic
1058167107 9:101632702-101632724 AGAATAATAGAATCAGAAAAGGG + Intronic
1058257079 9:102780135-102780157 AGATTAATAGAAATGGAACTTGG - Intergenic
1058395886 9:104553644-104553666 AAATTAATAAAAATAAAAGAAGG + Intergenic
1058519779 9:105806149-105806171 ATATTAATACAAATATCGAAGGG - Intergenic
1058686110 9:107481365-107481387 AGAATAATACATAAAGTAAAAGG + Intergenic
1059024305 9:110608016-110608038 AAATTAATACATAAAGACAAAGG + Intergenic
1059222060 9:112632538-112632560 AGATTATCAAAAATACAAAAAGG - Intronic
1059313697 9:113406298-113406320 AAATAAATAAAAATAAAAAAGGG + Intergenic
1059719745 9:116948004-116948026 AGATAAACCCAAATTGAAAAGGG - Intronic
1060379794 9:123157179-123157201 AGACTAATACAAATGGAAGATGG + Intronic
1060571733 9:124647423-124647445 AGATTAAAACATAAAGAAATGGG + Intronic
1060763246 9:126274119-126274141 AGATTCAGGAAAATAGAAAAAGG - Intergenic
1062246329 9:135568714-135568736 AAATTAAAACAAAAAGTAAAAGG + Intergenic
1062465843 9:136681101-136681123 AGATTAAAAAAAAAAAAAAAAGG - Intronic
1185545971 X:946067-946089 TGATTAATACAGGTAGAAACGGG + Intergenic
1185636473 X:1555710-1555732 AGATCCATACAAATAGAAAGTGG + Intergenic
1186578611 X:10793088-10793110 ACATCAATTCAAATACAAAATGG + Intronic
1186929715 X:14375227-14375249 ATAATAATAAAAAAAGAAAATGG + Intergenic
1187017117 X:15340899-15340921 AGAGTAAAACACACAGAAAAAGG - Intergenic
1187148514 X:16659937-16659959 AGATGAATAGATAAAGAAAATGG - Intronic
1187393774 X:18903282-18903304 ATATTAATACAAATAGGATTGGG - Intronic
1187555640 X:20348792-20348814 AGATTAATGCCATTATAAAAAGG - Intergenic
1187621094 X:21055877-21055899 CAAATAATACAATTAGAAAATGG - Intergenic
1187859999 X:23672707-23672729 AGATTAGTCCTAATGGAAAAAGG - Intronic
1187928686 X:24274295-24274317 AGATTAAAATAAATAGCACATGG - Intergenic
1188409742 X:29857021-29857043 AGTTTCATAGAAACAGAAAATGG + Intronic
1188745949 X:33843890-33843912 AGACTGATACAAGCAGAAAAGGG - Intergenic
1188890014 X:35598799-35598821 ATATTAATATATATATAAAATGG + Intergenic
1188918465 X:35941603-35941625 TGATTAATACAGTCAGAAAATGG + Intronic
1189127425 X:38462923-38462945 AAATTAAAAAAAAAAGAAAAAGG + Intronic
1190074399 X:47305605-47305627 AGATTAATACTGTTAGAAAAGGG + Intergenic
1190130714 X:47746295-47746317 AAATTAAAAAAAATAGAGAAGGG - Intergenic
1191066386 X:56352564-56352586 AGAAAAATAAAAAAAGAAAAAGG - Intergenic
1191090868 X:56619227-56619249 AGTTTAATAAAATTAGAAATGGG + Intergenic
1191707349 X:64107254-64107276 AAATGAATCCAATTAGAAAACGG - Intergenic
1191847521 X:65558998-65559020 AGATGAATAACAATACAAAATGG - Intergenic
1192348646 X:70335561-70335583 AAATTTATACAAATACAAATTGG - Intronic
1192423713 X:71056964-71056986 AGAATAATAAAAAGATAAAAGGG + Intronic
1192662705 X:73058927-73058949 AGATAAATAAATAAAGAAAATGG + Intergenic
1192718903 X:73671714-73671736 AAATAAATACTAATAGAAAAAGG - Intronic
1192735129 X:73843493-73843515 ACATTAATATTAAAAGAAAAGGG + Intergenic
1192947972 X:75986204-75986226 AGCTTCAAACAAGTAGAAAATGG - Intergenic
1193507089 X:82357932-82357954 AGTATAATAAAAAAAGAAAATGG + Intergenic
1193563978 X:83054988-83055010 AGATCAAAACAAACAGAAGAAGG - Intergenic
1193577478 X:83218638-83218660 AAATAAATATTAATAGAAAATGG + Intergenic
1194029563 X:88795305-88795327 CCAATAATACAAATATAAAATGG + Intergenic
1194187071 X:90785031-90785053 AAATTAATACTAATAGAATAAGG - Intergenic
1194592877 X:95821626-95821648 AGATTAATGCTACTATAAAAAGG - Intergenic
1194687814 X:96946143-96946165 ACATTAACACAGAAAGAAAAGGG - Intronic
1194716842 X:97296353-97296375 AAATTAATACATAAAGAGAATGG - Intronic
1195302605 X:103545650-103545672 AGATAAATAAAATTAGAAATGGG + Intergenic
1195395954 X:104410838-104410860 AGATTAGAACAAAGAGAGAAAGG - Intergenic
1195894227 X:109729254-109729276 AAAAAAATCCAAATAGAAAATGG + Intronic
1195895258 X:109739702-109739724 GGATTAATACAAAAAGCCAATGG - Intergenic
1196500319 X:116373181-116373203 AAATAAATACAAATAGGTAAGGG + Intergenic
1196571575 X:117271632-117271654 AGAATAATAAAAAAAGATAAAGG + Intergenic
1196622309 X:117837766-117837788 AGAAAAGTGCAAATAGAAAAAGG + Intergenic
1196659560 X:118255591-118255613 AGATGAATAAAAATAGAACCAGG - Intergenic
1196984145 X:121249690-121249712 AGACTAAGAGAAAAAGAAAAAGG - Intergenic
1197021415 X:121694333-121694355 ATAGAAATATAAATAGAAAATGG - Intergenic
1197080830 X:122413591-122413613 AGCATAATAGAAAGAGAAAATGG + Intergenic
1197187488 X:123604330-123604352 AGATAATTACCAATATAAAATGG - Intronic
1197358032 X:125460885-125460907 AGATTAATATTTATAAAAAATGG + Intergenic
1197471597 X:126869962-126869984 AGAAGAAGACAAAAAGAAAAGGG - Intergenic
1197524028 X:127539398-127539420 AGAATAATACGAATATGAAAAGG - Intergenic
1197574245 X:128189653-128189675 ACAAAAATACAAATAAAAAAAGG + Intergenic
1197587095 X:128362067-128362089 ATAATAATACAATTAAAAAATGG - Intergenic
1198287215 X:135202952-135202974 AAATATATACAAACAGAAAATGG - Intergenic
1198949589 X:142055746-142055768 ATAATAATAAAAAAAGAAAAGGG - Intergenic
1198991921 X:142524521-142524543 AGATTAACACAGGAAGAAAAAGG + Intergenic
1199212187 X:145225787-145225809 AGAACAATACAATCAGAAAAGGG + Intergenic
1199368674 X:147019689-147019711 ACTTGAATACAAAAAGAAAAAGG - Intergenic
1199930664 X:152516429-152516451 AGAATAAAACAGAGAGAAAATGG + Intergenic
1199932580 X:152539023-152539045 TGATTAATAAAAATAGAGCAGGG - Intergenic
1200359172 X:155583944-155583966 ATATTTATACAAATAAAAAGAGG + Intronic
1200533659 Y:4367107-4367129 AAATTAATACTAATAGAATAAGG - Intergenic
1200904010 Y:8462707-8462729 AGATTTGTACAAATATACAATGG - Intergenic
1201379772 Y:13362227-13362249 AGAGTAATACAAAAAGCACAGGG + Intronic
1201447675 Y:14076026-14076048 TAAGTAAAACAAATAGAAAAAGG + Intergenic
1201534954 Y:15037158-15037180 AGAATATTTCAAATAGAAAATGG + Intergenic
1201539807 Y:15093746-15093768 AGATTACTATAGATAGATAATGG + Intergenic
1201738277 Y:17295390-17295412 AGATAAATAAAACAAGAAAATGG - Intergenic
1201933472 Y:19379336-19379358 AGACAAATATGAATAGAAAAAGG - Intergenic
1201951749 Y:19572722-19572744 ACATAAATTCAACTAGAAAATGG - Intergenic