ID: 955653915

View in Genome Browser
Species Human (GRCh38)
Location 3:61223660-61223682
Sequence ATACACCATCTGGCAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955653915_955653921 12 Left 955653915 3:61223660-61223682 CCACATTTTGCCAGATGGTGTAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 955653921 3:61223695-61223717 CCAATCCCTGACTCGAGTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 54
955653915_955653919 11 Left 955653915 3:61223660-61223682 CCACATTTTGCCAGATGGTGTAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 955653919 3:61223694-61223716 CCCAATCCCTGACTCGAGTGAGG 0: 1
1: 0
2: 1
3: 4
4: 71
955653915_955653922 13 Left 955653915 3:61223660-61223682 CCACATTTTGCCAGATGGTGTAT 0: 1
1: 0
2: 0
3: 17
4: 138
Right 955653922 3:61223696-61223718 CAATCCCTGACTCGAGTGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955653915 Original CRISPR ATACACCATCTGGCAAAATG TGG (reversed) Intronic
904984878 1:34537155-34537177 AGACACCATCTGGAAACATCTGG - Intergenic
906934104 1:50196610-50196632 ATGCTCCATCTGGCTACATGAGG + Intronic
908706752 1:66965605-66965627 ATACACCATTTGCCATGATGTGG - Intronic
908980994 1:69958801-69958823 ATACTTCCTCTGACAAAATGTGG - Intronic
909907029 1:81209486-81209508 AAACAGCATCAGGTAAAATGGGG + Intergenic
921613924 1:217244513-217244535 ATACAGCACCTGGAAAATTGTGG - Intergenic
922995908 1:229961296-229961318 TTACAGCATCTGGCAAAATTGGG - Intergenic
1064953819 10:20884362-20884384 CCACAGCATCTGGCCAAATGTGG + Intronic
1067162713 10:43841102-43841124 ATAGACCATTTAGCAAAATGTGG - Intergenic
1067229332 10:44395807-44395829 ATCCACCATCTGGCAACCTAGGG - Intergenic
1068313577 10:55311605-55311627 ATAGACCTTTTGGAAAAATGAGG + Intronic
1069294599 10:66828582-66828604 ATATACCATTGGCCAAAATGTGG - Intronic
1072318463 10:94225758-94225780 ATTCTCGATCTGGAAAAATGGGG + Intronic
1074855816 10:117472677-117472699 ATGATCCATCTGCCAAAATGCGG - Intergenic
1080939852 11:36903186-36903208 ATACACTATGTGCCAGAATGGGG - Intergenic
1087972101 11:104497018-104497040 ATACACCATTTCTCAAAGTGTGG - Intergenic
1088823660 11:113476219-113476241 ACACAGAATCTGGCAAACTGAGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092612557 12:10187769-10187791 GAACACCAGCTGGCAAAATGTGG + Intronic
1094729732 12:33161115-33161137 ATAAAGAGTCTGGCAAAATGGGG + Intergenic
1096879562 12:54656633-54656655 ATACACAATTAGTCAAAATGGGG - Intergenic
1104334936 12:127885471-127885493 ATACACTATGTGGAAGAATGGGG - Intergenic
1104491727 12:129200239-129200261 ATCCATCATGTGGCAAAAGGTGG - Intronic
1106166703 13:27253319-27253341 ATACACCATCACGGAAAATTTGG + Intronic
1109957617 13:69589300-69589322 ATACATCTTCTGATAAAATGTGG + Intergenic
1110716486 13:78710640-78710662 ATACACCATCTTGCAACATTTGG - Intergenic
1112925426 13:104668315-104668337 ATGAACCATCTAGCAAAAAGTGG + Intergenic
1113166707 13:107450943-107450965 ACACCCCATCTGGGAAAATCAGG - Intronic
1116706081 14:48303082-48303104 TTATACCAAATGGCAAAATGTGG + Intergenic
1117437434 14:55730135-55730157 ATTCTACAGCTGGCAAAATGGGG + Intergenic
1120649011 14:87108714-87108736 ATGCACCATCTTGCAGAAAGAGG + Intergenic
1122004899 14:98694789-98694811 ATACACCATCTGAAAAAAAAGGG - Intergenic
1123268527 15:17769460-17769482 TTCCACCATATGGCGAAATGGGG - Intergenic
1123299179 15:18307691-18307713 ATCCACCATAGGGCGAAATGGGG - Intergenic
1124228393 15:27917589-27917611 ATGCAGCCTCTGGCATAATGGGG - Intronic
1127128724 15:55839685-55839707 ATACACCATTTGGCCAGGTGCGG + Intronic
1127760250 15:62132561-62132583 ATACAGCGTCTGGCAAACTACGG - Intergenic
1132300624 15:100773469-100773491 ATACACCATCTGGAAAATTCAGG - Intergenic
1133883453 16:9804586-9804608 AGACACCATCTGACACACTGGGG + Intronic
1136084272 16:27873554-27873576 ATGCAACATCTGGCAAAGAGGGG - Intronic
1137622381 16:49884394-49884416 CCACACCCTCTGGCAAAATCGGG + Intergenic
1138969645 16:62129384-62129406 ATACACCATTTGTCAAAGGGGGG - Intergenic
1147349379 17:39828223-39828245 TTACCCCATCTGGCAAAATTGGG + Intronic
1148340634 17:46871508-46871530 GTAAAGCATCTTGCAAAATGAGG + Intronic
1154066484 18:11111429-11111451 TTATACCATCTGGCAAAACTAGG + Intronic
1156358922 18:36366844-36366866 TTTCACCATCTGGCAAAAGTAGG - Intronic
1156744925 18:40378438-40378460 ATATAACATTTGGCCAAATGGGG + Intergenic
1156904994 18:42341801-42341823 ATTCACCATCTGGTAGAAGGTGG + Intergenic
1158576143 18:58640005-58640027 TTACACAATCTGGTGAAATGTGG - Intergenic
1162848354 19:13411628-13411650 ATACACCATGTCAAAAAATGTGG + Intronic
1166586611 19:43954591-43954613 TCACCCCATCTGGCAAAATTGGG - Intronic
1166987601 19:46670877-46670899 ATAAACCATGTGGCTAATTGTGG + Intergenic
1167401882 19:49278259-49278281 AAAAGCCATTTGGCAAAATGCGG + Intergenic
1167716682 19:51146742-51146764 ATCCATCCTCAGGCAAAATGAGG + Exonic
1167768079 19:51497435-51497457 ATCCATCCTCAGGCAAAATGAGG - Exonic
926428581 2:12763196-12763218 AGACACCATCAGGCAAAGTGTGG + Intergenic
929894959 2:45951604-45951626 ATGCAGCATCTCACAAAATGAGG + Intronic
934516117 2:94987793-94987815 AGACACTGGCTGGCAAAATGGGG + Intergenic
936873712 2:117163383-117163405 ATAGGCCATCTGACAAGATGAGG + Intergenic
937398421 2:121559444-121559466 ATCCAACAACTGACAAAATGTGG + Intronic
938176393 2:129135158-129135180 AAACACCACCTGCCAAAATGAGG + Intergenic
939174354 2:138732188-138732210 ATACACAATGTGTCAAAAGGAGG + Intronic
939342820 2:140922148-140922170 ACACATCATCTGGCATAAAGCGG + Intronic
939418959 2:141941333-141941355 ATACACCATCAAGCAAAGAGTGG - Intronic
940617803 2:156072490-156072512 ATACACCGTCTGACACAATCAGG - Intergenic
940838960 2:158557587-158557609 ATACAGGATCTGGCAAAACTTGG - Intronic
941137774 2:161738947-161738969 TCACCCCATCTGGCAAAATTGGG - Intronic
946096331 2:217277544-217277566 ATACACCATGTGGGAAAAGCTGG - Intergenic
946994613 2:225377150-225377172 ATAAACCATCTGAGAAAAGGGGG - Intergenic
1171374325 20:24681934-24681956 AGACACCAACTGGCAAGATCAGG - Intergenic
1172163051 20:32881816-32881838 TCATCCCATCTGGCAAAATGGGG - Intronic
1177037118 21:16058047-16058069 CTTCACCATCTGGAAGAATGTGG + Intergenic
1177548336 21:22588845-22588867 ATACATCTTCTGGCCAGATGGGG + Intergenic
1183710109 22:39498374-39498396 CAACACCACCTGGCACAATGTGG + Intergenic
949691170 3:6641350-6641372 ATTCACACTCTGGAAAAATGTGG - Intergenic
955653915 3:61223660-61223682 ATACACCATCTGGCAAAATGTGG - Intronic
957742825 3:84295219-84295241 ATAAATAATCTGGAAAAATGTGG + Intergenic
959302093 3:104615679-104615701 AAACACCAGCTCTCAAAATGTGG - Intergenic
960198610 3:114802942-114802964 ATTCAACATCTGGCAAATTGAGG - Intronic
960718487 3:120601871-120601893 AAACACTTTCTGGGAAAATGTGG - Intronic
962121014 3:132559985-132560007 ATACACAATGTGGCAAAACTGGG + Intronic
962989375 3:140564619-140564641 ATACAGTATCTGGCATAATGGGG - Intronic
965621014 3:170642311-170642333 ATAGACCATGTGGCAGACTGGGG - Intronic
966669817 3:182514594-182514616 ATACAAAATCTGGCAAACTATGG - Intergenic
971315733 4:25566343-25566365 AGACACCATCTCCCAAAAAGGGG + Intergenic
972470704 4:39401230-39401252 AAACACAATATGGCAAAATGTGG + Intergenic
972554774 4:40170859-40170881 ATACATCATTGAGCAAAATGAGG - Intergenic
972723573 4:41725440-41725462 CTCCACCTTCTGGCAAAACGTGG - Intergenic
974094303 4:57345817-57345839 ATTCTCCATCTGGCAACATGTGG - Intergenic
976212794 4:82688623-82688645 CCACACCACCTGGCAAATTGTGG + Intronic
977411087 4:96664954-96664976 ATACAACATGTGTCAAAATTAGG - Intergenic
980836992 4:138207123-138207145 ATATTCCCTGTGGCAAAATGAGG - Intronic
985262109 4:188124422-188124444 ATACATTATCTGGCAGAGTGGGG - Intergenic
986940735 5:12946012-12946034 ATATATCACCTGGCAAAATCAGG - Intergenic
988404699 5:30809287-30809309 ATACATCATCTCTCAAAATCTGG + Intergenic
989073491 5:37536975-37536997 ATCCACCTTCTGGAGAAATGGGG - Intronic
990335940 5:54772838-54772860 AAACACCATCTGCCAAAGTTGGG + Intergenic
992360026 5:76028048-76028070 ATACTCTATCCTGCAAAATGTGG + Intergenic
993190518 5:84673851-84673873 TTACCCCATCTAGCAAAATTGGG + Intergenic
993810468 5:92470156-92470178 AAACAACATCTGGAAAAGTGAGG - Intergenic
993842986 5:92903500-92903522 AGACAACATATGGAAAAATGAGG + Intergenic
995498067 5:112769931-112769953 AAACACCATCTTGAAAAATAAGG + Intronic
995963959 5:117881603-117881625 CTGCACCGTCTGGCAACATGTGG + Intergenic
997097046 5:130924509-130924531 AGACTCCATCTGAAAAAATGGGG + Intergenic
997287921 5:132696895-132696917 CTTCACTATCTGGCATAATGGGG - Intronic
998091799 5:139375374-139375396 ATATACCATCTGGCTAAATCTGG - Intronic
999762506 5:154713278-154713300 ATTCCCCATCTGGGAAAATGAGG + Intronic
1000759702 5:165207081-165207103 ACACATCATTTGGCAAATTGGGG + Intergenic
1003148558 6:3529453-3529475 ATAAAGGATCTGGCAAACTGTGG - Intergenic
1004387345 6:15184469-15184491 ATCCACCACCAGGTAAAATGTGG - Intergenic
1006244938 6:32724647-32724669 ATTCACCAACTGGCTGAATGTGG + Intergenic
1006599812 6:35217836-35217858 CTCCACCTTCTGGAAAAATGGGG - Intronic
1010977933 6:82337541-82337563 ATACACACTTTGCCAAAATGTGG - Intergenic
1012102295 6:95105122-95105144 ATAGCCCCTCTGGCAAAATGTGG - Intergenic
1013458418 6:110353504-110353526 AAAAACCATATGGCAAAATTTGG - Intronic
1017743240 6:157425764-157425786 ATGCAGCATCTGGCCAGATGAGG - Intronic
1018082233 6:160268804-160268826 TCACCCCATCTGGCAAACTGGGG + Intronic
1018886046 6:167938469-167938491 AGACAAATTCTGGCAAAATGAGG - Intronic
1020688125 7:11320770-11320792 AGACACCAACTGTAAAAATGTGG + Intergenic
1021605475 7:22405334-22405356 CTGCACCATCTGAAAAAATGTGG - Intergenic
1021959002 7:25853696-25853718 ATCCACCTTCTTGTAAAATGAGG + Intergenic
1022583700 7:31584277-31584299 AAACAGCATTTAGCAAAATGAGG - Intronic
1027877424 7:83788349-83788371 AAACGCCATCAGGTAAAATGAGG - Intergenic
1030461187 7:109839115-109839137 TTCCTCCATCTGGAAAAATGTGG - Intergenic
1031636678 7:124109363-124109385 ATACACCAGATGGCTAAATCTGG + Intergenic
1031801528 7:126252763-126252785 ACATACCATCTGGAAAAATAGGG - Intergenic
1032154603 7:129457843-129457865 ATACACCAGCTGGCTGACTGAGG - Intronic
1034695240 7:153047754-153047776 AATTACCATCTGTCAAAATGCGG + Intergenic
1034822340 7:154227829-154227851 ATGGATCATCAGGCAAAATGAGG + Intronic
1039137818 8:34346417-34346439 ATACACAAACAGGCAAACTGGGG - Intergenic
1042119986 8:65476383-65476405 ACACACCAGATGGCAAAAAGAGG - Intergenic
1042148621 8:65758221-65758243 TCACCCCATCTGGCAAAATTGGG - Intronic
1043557584 8:81450397-81450419 ATACACCATCTTCCATGATGTGG - Intergenic
1043763881 8:84104760-84104782 ATACAACATATGGCCAGATGTGG + Intergenic
1043983505 8:86667544-86667566 ATACTCCTTCTGGCAGGATGTGG - Intronic
1044558067 8:93586076-93586098 TTACACCATCTGGGAAAATTGGG - Intergenic
1045792574 8:106001563-106001585 ATGCTCCCTCTGGCAAACTGGGG + Intergenic
1047196736 8:122728502-122728524 AAACACCATCTGGGGACATGAGG - Intergenic
1047601356 8:126429003-126429025 ACACAACTTCTAGCAAAATGTGG + Intergenic
1049380199 8:142309275-142309297 ATACAACTTCTGGCACAATGGGG + Intronic
1051139478 9:13963220-13963242 AAACACCAACTTGCAATATGAGG - Intergenic
1051498890 9:17755691-17755713 CTACAGCATCTGGTATAATGTGG + Intronic
1052280503 9:26727654-26727676 TTTCACCACCTGTCAAAATGAGG - Intergenic
1052450252 9:28620582-28620604 ATAGCCCATCTAGCAAACTGAGG - Intronic
1053503936 9:38624055-38624077 AGACACAATCTAGCAAAATATGG - Intergenic
1059618593 9:115978081-115978103 ATTCACCATCTTTCAAATTGTGG + Intergenic
1203396309 Un_KI270519v1:16087-16109 TTCCACCATATGGCGAAATGGGG - Intergenic
1189516344 X:41716743-41716765 TTATCCCATCTGGCAAAATTGGG + Intronic
1190451613 X:50587305-50587327 ATACACTATTTTCCAAAATGGGG - Intergenic
1193446358 X:81608945-81608967 ATAAACCATTTGTTAAAATGAGG + Intergenic
1194947290 X:100084190-100084212 ATAAACCCTCTGGGAAACTGAGG - Intergenic
1196633517 X:117972663-117972685 ATCTACCTTGTGGCAAAATGGGG - Intronic
1197504800 X:127288448-127288470 ATCCAGCAACTGGCAGAATGAGG - Intergenic
1198657850 X:138934225-138934247 TTATACCATGAGGCAAAATGTGG + Intronic
1201781492 Y:17728007-17728029 ATAAAAGATCTGGCAAAGTGTGG + Intergenic
1201820061 Y:18177983-18178005 ATAAAAGATCTGGCAAAGTGTGG - Intergenic