ID: 955655465

View in Genome Browser
Species Human (GRCh38)
Location 3:61240495-61240517
Sequence TTGTTTCTATAGCCAGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955655465_955655469 -2 Left 955655465 3:61240495-61240517 CCTCCAACTGGCTATAGAAACAA 0: 1
1: 0
2: 0
3: 5
4: 182
Right 955655469 3:61240516-61240538 AATTCCAAGTGGTAGGCATATGG 0: 1
1: 0
2: 0
3: 15
4: 120
955655465_955655468 -9 Left 955655465 3:61240495-61240517 CCTCCAACTGGCTATAGAAACAA 0: 1
1: 0
2: 0
3: 5
4: 182
Right 955655468 3:61240509-61240531 TAGAAACAATTCCAAGTGGTAGG 0: 1
1: 0
2: 1
3: 23
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955655465 Original CRISPR TTGTTTCTATAGCCAGTTGG AGG (reversed) Intronic