ID: 955655465

View in Genome Browser
Species Human (GRCh38)
Location 3:61240495-61240517
Sequence TTGTTTCTATAGCCAGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955655465_955655468 -9 Left 955655465 3:61240495-61240517 CCTCCAACTGGCTATAGAAACAA 0: 1
1: 0
2: 0
3: 5
4: 182
Right 955655468 3:61240509-61240531 TAGAAACAATTCCAAGTGGTAGG 0: 1
1: 0
2: 1
3: 23
4: 193
955655465_955655469 -2 Left 955655465 3:61240495-61240517 CCTCCAACTGGCTATAGAAACAA 0: 1
1: 0
2: 0
3: 5
4: 182
Right 955655469 3:61240516-61240538 AATTCCAAGTGGTAGGCATATGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955655465 Original CRISPR TTGTTTCTATAGCCAGTTGG AGG (reversed) Intronic
903547068 1:24132038-24132060 TTGTTTCTTTCGGTAGTTGGGGG - Intronic
904415876 1:30360829-30360851 GTGTTTGTACAACCAGTTGGTGG + Intergenic
911593262 1:99771919-99771941 TTCATTATAAAGCCAGTTGGAGG + Intergenic
911858241 1:102910267-102910289 TTGTTTCTTTAGCCATTCAGTGG - Intronic
915870685 1:159556847-159556869 TTGTTTCCACAGCCCGTTAGAGG + Intergenic
920498094 1:206469646-206469668 ATGTTTCTATAGAATGTTGGAGG - Intergenic
921941850 1:220849388-220849410 TTCCTTCTATACCCAGTTTGTGG + Intergenic
922818451 1:228468027-228468049 TAGTTTCTATGGCCAGTCTGGGG + Intergenic
922972797 1:229757405-229757427 TGGTTTCTCTATCCAGCTGGAGG + Intergenic
923022623 1:230176622-230176644 TACTTTGTAAAGCCAGTTGGTGG + Intronic
923073174 1:230584228-230584250 TTGTTTCTGCAGACAGTTTGGGG - Intergenic
1064652257 10:17521346-17521368 TTCTTTCTAAATCCATTTGGAGG + Intergenic
1067548747 10:47218226-47218248 CTGTTTCTTAAGCCAGGTGGTGG + Intergenic
1071354618 10:84782013-84782035 ATGTGTCTTTAGCCAGTAGGTGG + Intergenic
1072508756 10:96096889-96096911 TAGTTTCCATATCCAGTTTGTGG + Intergenic
1072779497 10:98237223-98237245 ATGTTTCTATAGTCTGTAGGAGG - Intronic
1074363761 10:112842003-112842025 TTGTTTCTGTATCCAATTGTTGG - Intergenic
1074981959 10:118627034-118627056 TTCTTGCTATAGCCAGGGGGAGG - Intergenic
1077448135 11:2612324-2612346 ATTTTTCCACAGCCAGTTGGGGG - Intronic
1078798899 11:14623220-14623242 TTGTTCCTATGGCCATATGGGGG + Intronic
1080004523 11:27392508-27392530 TTTTTTCTCTAGACAATTGGCGG - Exonic
1082116688 11:48336913-48336935 TTGATTCTTTTCCCAGTTGGAGG + Intergenic
1086325495 11:85694553-85694575 TTGTACCTATGGCCAGTGGGTGG + Exonic
1088599144 11:111460174-111460196 TGGTTTCTAAAGCCAGTGGTGGG + Intergenic
1089927265 11:122271490-122271512 TTATTTCTATAGTCTGGTGGGGG + Intergenic
1090787822 11:130065790-130065812 TTGTTTCTTTAGTGAGATGGTGG + Intergenic
1093131078 12:15392323-15392345 ATATGGCTATAGCCAGTTGGTGG - Intronic
1093310297 12:17573717-17573739 TTGGTTATATAGCCAGTAGTAGG - Intergenic
1093766138 12:22965191-22965213 TTGTTTAAATAGGCAGTAGGAGG + Intergenic
1093773496 12:23045233-23045255 TTGGTGCTTTAGACAGTTGGTGG - Intergenic
1094404172 12:30097160-30097182 TGGTTTCTATTGCCATCTGGGGG - Intergenic
1095083085 12:38029989-38030011 TGGTTTCAATATCCACTTGGTGG + Intergenic
1097642321 12:62197171-62197193 TTTTTTCAATGGACAGTTGGTGG - Intronic
1098226489 12:68330335-68330357 TTATTTCTATAACCAGTTACGGG + Intronic
1098813219 12:75122566-75122588 TTGATTCTAAAGCCATGTGGAGG - Intronic
1102608764 12:114092192-114092214 TTGTTTTTATGGCCAGTTTTGGG - Intergenic
1102785145 12:115598847-115598869 TTGTTTCTGGAGCCAGTTCTGGG - Intergenic
1102826504 12:115951627-115951649 TTGTTCCCATAGCCATTTTGAGG + Intergenic
1107064787 13:36201419-36201441 TTGTTTTTATTTCCAGTTTGTGG - Intronic
1107593448 13:41934550-41934572 TTGTTTCTATATCCACATGTTGG - Intronic
1109187310 13:59285504-59285526 TTGTATCTATTGCCAGTTAAAGG + Intergenic
1111236364 13:85413980-85414002 TTGTTTCTAAATCCAGATAGAGG - Intergenic
1111812945 13:93115060-93115082 TTTTGTTTATGGCCAGTTGGGGG - Intergenic
1112258256 13:97854285-97854307 TTGTATATATAGCCAGTAGTGGG - Intergenic
1115826027 14:37277829-37277851 TTGTTTATATAGCCAATAGTTGG + Intronic
1116553932 14:46279112-46279134 TTGGTTATATAGCCAGATAGGGG + Intergenic
1118254296 14:64191752-64191774 TTCTCTCCACAGCCAGTTGGGGG + Intronic
1121346330 14:93138400-93138422 TTGATTCTAGCTCCAGTTGGTGG + Intergenic
1124132268 15:27001388-27001410 ATGTGTCTACAGACAGTTGGAGG - Intronic
1126226206 15:46273004-46273026 TTGTTTCTATATATAGGTGGTGG + Intergenic
1126904917 15:53354294-53354316 TTGTTTATATACCCAGTAGTGGG + Intergenic
1127393733 15:58527207-58527229 TTGCTTTTTTAGCCAGTTGTGGG + Intronic
1128648535 15:69394344-69394366 GTGCTGCTATAGCCAGTTAGGGG + Intronic
1128947662 15:71840502-71840524 TTGTTTCAATACCCACTAGGAGG - Intronic
1129078909 15:73022526-73022548 CTGCTTTTATAGGCAGTTGGAGG + Intergenic
1130446525 15:84007269-84007291 TTTTTTCTTAAGCCAGTTCGAGG - Intronic
1131131157 15:89901344-89901366 TTGTTTGTAGAGGCAGGTGGTGG - Exonic
1132751838 16:1461241-1461263 TGGTTTCTAGAGACAGTGGGAGG - Intronic
1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG + Intronic
1134000565 16:10779667-10779689 TTATTTCTGTAGCCAGTTACAGG + Intronic
1134318575 16:13142115-13142137 TTGAATCCATAGCCAGTTCGAGG + Intronic
1135703184 16:24651167-24651189 TTTTTGCCATACCCAGTTGGTGG - Intergenic
1137857670 16:51812018-51812040 TTTTTTCTATTGTCTGTTGGTGG + Intergenic
1137912281 16:52390074-52390096 TTGTATATATACCCAGTTGTGGG - Intergenic
1139400797 16:66679883-66679905 TTGTTTCTGTAACCATTAGGCGG - Intronic
1142964534 17:3572394-3572416 TTGTTTCTGTAGCCTGGCGGGGG + Intronic
1144123264 17:12177586-12177608 CTGTTTCTTAAGCCAGATGGTGG + Intergenic
1147795304 17:43037886-43037908 TTGTTCCTAGAGCCTGGTGGCGG - Intergenic
1149209305 17:54286095-54286117 TTATTTCTGTAGCCATTTGCAGG + Intergenic
1149906849 17:60534382-60534404 TTGTTTATATAGACAGATTGGGG + Intergenic
1150300336 17:64042543-64042565 TACTTTCTCCAGCCAGTTGGGGG - Exonic
1150510056 17:65742173-65742195 CTTTTTCTATAGCCTGTTGCAGG - Intronic
1153237112 18:2998868-2998890 TTGTTTCTAAAGTCATTTGAAGG - Intronic
1154182709 18:12150406-12150428 TTGATTCTCTAGCAAGTTTGGGG - Intergenic
1158637499 18:59174336-59174358 TTGCTTCCATAGCAATTTGGTGG - Intergenic
1159727756 18:71983617-71983639 TAGTTTCTATAGGCAGGAGGAGG - Intergenic
1160327571 18:77965196-77965218 TAGTTTCTATACCCAGATGAGGG + Intergenic
1164299308 19:23947143-23947165 TTGCTTCAATACCCACTTGGCGG - Intergenic
1164483582 19:28635335-28635357 ATGTGTCTTTAGCCAGTAGGTGG - Intergenic
1164856336 19:31527540-31527562 TTCCTTCTACAGCCATTTGGTGG - Intergenic
1168026336 19:53646407-53646429 TTTTCTCTATACCCAGTTAGCGG - Intergenic
926782608 2:16487919-16487941 TTTTTTGTGTGGCCAGTTGGGGG - Intergenic
927325767 2:21803260-21803282 TTTTTTCTCTAGCTAGTTTGTGG - Intergenic
927465608 2:23334213-23334235 TTGTTTCTGGATGCAGTTGGTGG - Intergenic
928276350 2:29903848-29903870 TTATTTCTATAAACAGTTGCAGG - Intronic
928651528 2:33408915-33408937 TTGATTCTATAGATAGTTTGGGG + Intergenic
928858041 2:35823725-35823747 TTCTTTCTGTACCCAATTGGAGG + Intergenic
930793382 2:55358613-55358635 TTGTTTCTTTGGCAAATTGGAGG - Intronic
932099064 2:68879986-68880008 TTGTTTCATCAGCCACTTGGAGG - Intergenic
932246327 2:70199715-70199737 TTGATTCTAGAGACAGTTGCAGG - Intronic
939080623 2:137656935-137656957 GTGTTTCTAGAACCTGTTGGGGG - Exonic
941531166 2:166673260-166673282 TTGTTTCTTCAGTCAGTTGTGGG + Intergenic
942754844 2:179328518-179328540 TTGTTTCCATGGCAAGTTGAAGG - Intergenic
943198710 2:184791059-184791081 ATGTATCTTTAGCCAGTAGGTGG + Intronic
943813775 2:192224741-192224763 CTGCTTCTAAAGCAAGTTGGGGG + Intergenic
945434394 2:209801755-209801777 CTGATTCTAGTGCCAGTTGGAGG - Intronic
945640357 2:212419160-212419182 GTTTTTCTATAGCAATTTGGGGG - Intronic
946480813 2:220054923-220054945 TTGGTTCTAAAGCCGGGTGGGGG + Intergenic
948239089 2:236413880-236413902 TTGTTTCTAAAGCCAATGTGAGG + Intronic
948284938 2:236776723-236776745 GTGTTTCTAGAGCCAGTGGCTGG - Intergenic
1168816415 20:740614-740636 TGGTTTCAATAGCCAGTGAGTGG + Intergenic
1170949911 20:20927009-20927031 CTGTTCCTACAGCCAGTGGGAGG + Intergenic
1171157131 20:22885850-22885872 TTGTTTCTAGTTCCAGCTGGTGG - Intergenic
1173060918 20:39660330-39660352 TTGTTTCCATTGGCATTTGGGGG - Intergenic
1178347893 21:31847753-31847775 TGGTTTCCTTACCCAGTTGGTGG - Intergenic
1183337430 22:37258261-37258283 TGGTTTGTTTAGTCAGTTGGAGG - Intergenic
1185290860 22:50026804-50026826 ATGTTTTTCTAGCCATTTGGTGG - Intronic
949242692 3:1890766-1890788 TTGGTTTTATTGGCAGTTGGTGG - Intergenic
950564246 3:13756799-13756821 TTGGATCTATAGACAGTTTGTGG + Intergenic
955655465 3:61240495-61240517 TTGTTTCTATAGCCAGTTGGAGG - Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
960890192 3:122439819-122439841 TAGTTTGTATAGCAAGTTGCTGG - Intronic
963916116 3:150860324-150860346 TTGCTTCAATATCCACTTGGCGG - Intergenic
963942111 3:151105613-151105635 TTGATTTAATAGCCAGTTAGAGG - Intronic
964171174 3:153770925-153770947 TTGTGTCTTTAGCCATTAGGGGG - Intergenic
966494580 3:180565584-180565606 TTGTTTAAATAGACAGATGGTGG - Intergenic
966497450 3:180597006-180597028 TTGTTGCTTAAGCCAGATGGAGG - Intergenic
967277919 3:187794915-187794937 TTGTAGCCAAAGCCAGTTGGGGG - Intergenic
971953992 4:33392492-33392514 TTATTTTTATAGCTAGTTGAAGG - Intergenic
973186870 4:47340265-47340287 TAGTCTCTATAACAAGTTGGAGG + Intronic
973310608 4:48705704-48705726 TTAATTGTATATCCAGTTGGTGG + Intronic
976351344 4:84063324-84063346 TGGTCTCTCTAGCCAGTTGGTGG + Intergenic
977654700 4:99507245-99507267 TTGTTTCTATAGGGAGATGAGGG + Intergenic
978646653 4:110940840-110940862 TTGTTGCTATTGACAGTTTGTGG + Intergenic
978883000 4:113730688-113730710 TCTTTTCTATAGCCAGGTGAAGG - Intronic
981504410 4:145482886-145482908 TTGTTTCTGTAGGAAGGTGGGGG + Exonic
983039891 4:162913286-162913308 TGCTTACTATAGCAAGTTGGAGG - Intergenic
985208177 4:187563417-187563439 TTCTTTCTTTAACTAGTTGGTGG + Intergenic
986438429 5:7757956-7757978 TTATTTCTGTAGCCTGTTGAGGG - Intronic
986453926 5:7895903-7895925 TTGTTTCTTTAGTCATTTTGAGG + Intronic
986821902 5:11476469-11476491 GTGATTCTATGGCCAGGTGGAGG + Intronic
987647272 5:20690188-20690210 TTGTTTCCACAGATAGTTGGGGG - Intergenic
988137017 5:27186954-27186976 ATGTTTCTTTATCCAGTTGAAGG - Intergenic
989529613 5:42492468-42492490 GTTTTTCTATAGGCAGCTGGTGG + Intronic
991550180 5:67826842-67826864 TAGTTCCTTTAGCCAGTTGCTGG + Intergenic
993689126 5:90977377-90977399 TTGTTGCTATAGTCAGTTTGAGG + Intronic
993845981 5:92944195-92944217 TTATTTCTATAGACAGTGGTAGG + Intergenic
994305887 5:98203768-98203790 TTTTGTTTATAGCCAGTTTGGGG - Intergenic
995629358 5:114116757-114116779 TTGATTCTCTAGCAAGTTGTGGG + Intergenic
996452232 5:123638346-123638368 TTGTTTATATACCCAGTAGTAGG - Intergenic
996858802 5:128041373-128041395 TTGTCTCTTTAGTCAGTTGGTGG - Intergenic
997005551 5:129812640-129812662 TTGTTTATATACACAGTGGGTGG - Intergenic
997687582 5:135799408-135799430 TTGTTTCTAATGCCCGGTGGGGG + Intergenic
999667501 5:153928427-153928449 TTCCTTCTATAACCAGTTGAGGG - Intergenic
1003736465 6:8883325-8883347 TTGCTTATATACCCAGTTGTGGG + Intergenic
1005138928 6:22604186-22604208 TTGTTTTTATTTCCAGTTTGGGG + Intergenic
1009394015 6:63176486-63176508 TTGTTTCCATAGCCGCTTTGAGG + Intergenic
1009953365 6:70422118-70422140 TAGTTTTTATAACTAGTTGGTGG + Intronic
1010170279 6:72966910-72966932 TTGTTTCTGGAGGGAGTTGGAGG + Intronic
1010304400 6:74301961-74301983 TTCTTTCTGAAGCCTGTTGGTGG + Intergenic
1010421339 6:75679885-75679907 TTGATTTTATAGCCTATTGGTGG + Intronic
1010587210 6:77667622-77667644 TAGTATCTATAGCCATTTGGGGG - Intergenic
1012456123 6:99407318-99407340 TTGTCTTTTTAGGCAGTTGGGGG - Intronic
1015865131 6:137719932-137719954 TGGTTTCAATATCCACTTGGCGG + Intergenic
1018233141 6:161695205-161695227 TTCCTTTTGTAGCCAGTTGGGGG - Intronic
1019023203 6:168936365-168936387 TTATTTCTTTAGCTATTTGGGGG - Intergenic
1019998807 7:4742891-4742913 TTTTTTCCAGAGCCAGTGGGTGG + Intronic
1020801258 7:12734900-12734922 TTGTCTCTATAGCCAGTCTGAGG + Intergenic
1020812870 7:12866906-12866928 ATATTTCTGTAGCCAGTAGGGGG + Intergenic
1021790484 7:24199801-24199823 TTTTTTCTATTGCCACTTTGTGG + Intergenic
1022118169 7:27280487-27280509 TGATTTCTATAGGCACTTGGTGG + Intergenic
1028324335 7:89503822-89503844 TTTTTTCTATAGGCCCTTGGAGG + Intergenic
1028889896 7:95975265-95975287 TTGTTTAAACAGCCAGTTTGTGG - Intronic
1030238473 7:107292971-107292993 TTATTTCTGTAACCAGTTGCAGG - Intronic
1032089780 7:128905680-128905702 TTTTTTCTATGGGCAGTGGGGGG - Intronic
1032092465 7:128917851-128917873 TTTTTTCTATGGGCAGTGGGGGG + Intergenic
1033550705 7:142445181-142445203 ATGGATCTATAGCCACTTGGAGG + Intergenic
1036274563 8:7339091-7339113 TTGTTTCTTTCGTCAGTTGTTGG + Intergenic
1036346789 8:7971255-7971277 TTGTTTCTTTCGTCAGTTGTTGG - Intergenic
1036990356 8:13585547-13585569 TTGTTTTGACATCCAGTTGGTGG - Intergenic
1043788416 8:84431892-84431914 TTGGTTATATACCCAGTGGGGGG + Intronic
1045700985 8:104865902-104865924 TTGTTGCTATATTTAGTTGGTGG + Intronic
1046408137 8:113802210-113802232 TTGTCTCTATCACCAGTTTGTGG + Intergenic
1048488045 8:134866963-134866985 TTATTACCATAGCCAGTAGGTGG + Intergenic
1048768701 8:137871366-137871388 TTGTTTCCATAGGCATTAGGTGG + Intergenic
1050459855 9:5868323-5868345 TTGTTTCTTTAGCTGGCTGGTGG - Intergenic
1052962043 9:34307054-34307076 TTTTTTCAGCAGCCAGTTGGAGG - Intronic
1056709615 9:88980161-88980183 TTATTTCTATAACCAGTTACAGG + Intergenic
1185874355 X:3690157-3690179 TTGCTGCTATAACCAGTGGGTGG + Intronic
1186760415 X:12716887-12716909 CTGTCTCTAAAGCCAGGTGGGGG - Exonic
1187111927 X:16311130-16311152 TTATTTCTACAGCCAGTTACAGG - Intergenic
1187365026 X:18659756-18659778 TTGTTTCTATGGCCAGCTTCAGG - Intronic
1191716265 X:64195794-64195816 TTATTTCTAAAGCTGGTTGGTGG + Intronic
1191760461 X:64642675-64642697 TTGATTCTCTGGCCAGTAGGTGG + Intergenic
1192528681 X:71868820-71868842 TCGTTTCAGTAGCCAGGTGGAGG - Intergenic
1193765019 X:85517444-85517466 ATGTTTCTATAGTCAGTTAAGGG + Intergenic
1195334550 X:103838177-103838199 TTGTTTCTATTACTATTTGGAGG + Intergenic
1198887297 X:141353524-141353546 TTGTTTCTATTGCCTGTTCCTGG + Intergenic