ID: 955656375

View in Genome Browser
Species Human (GRCh38)
Location 3:61249436-61249458
Sequence ATCTAAGTACAGAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955656375 Original CRISPR ATCTAAGTACAGAGGCAGCA TGG Intronic
901539968 1:9909679-9909701 ATCAAACTACAGAGGGAGGAAGG + Intronic
901668250 1:10838582-10838604 TTCTAGGAACAAAGGCAGCACGG + Intergenic
902184069 1:14711982-14712004 TTCTGAGTACAGAAGGAGCATGG + Intronic
902991364 1:20189557-20189579 ATCCAAATACAGAGGCCCCAGGG + Intronic
903348738 1:22704780-22704802 CTCTGAGCACAGAGGCTGCAGGG - Intergenic
905581076 1:39082758-39082780 ATCTGAGCCTAGAGGCAGCAAGG - Intronic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
907536023 1:55158100-55158122 ATGCAGGTAGAGAGGCAGCAAGG + Intronic
908100838 1:60789377-60789399 ATGCAAGTACAGAGGATGCAAGG - Intergenic
908490127 1:64635145-64635167 ATCTAAATAAAGGGGCAGGAAGG - Intronic
914813431 1:151046383-151046405 ATATAAGTGCAGAGGCAATAAGG + Intronic
918281769 1:183013089-183013111 ATCCAAGTCCAGAGACAGGATGG - Intergenic
921870650 1:220135966-220135988 AGCAAACTACAGAGACAGCAAGG - Intronic
922724257 1:227915165-227915187 AACTAAGAAGACAGGCAGCATGG + Intergenic
922828502 1:228538208-228538230 ATCTAATTACAGAGACACCTGGG - Intergenic
923648423 1:235847497-235847519 ACAAAAGTACAGAGGCAACAAGG + Intronic
923891496 1:238220180-238220202 ATCTAAGTTCAGTTGAAGCAGGG - Intergenic
924028730 1:239865873-239865895 CTCTGAGCACAGAGGCTGCAAGG - Intronic
924257537 1:242197197-242197219 AACTAAGTCCAGTGGCAGTAAGG - Intronic
924834835 1:247637810-247637832 ATACAATTTCAGAGGCAGCATGG + Intergenic
1066103012 10:32134445-32134467 ATCCAAGTACAGAGTGACCAAGG + Intergenic
1067844979 10:49712448-49712470 ACCTCAGTCCAGAGGCAGCATGG + Intergenic
1067845111 10:49713413-49713435 ACCTGAGTCCAGAGGCAGCGTGG - Intergenic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1070816016 10:79323836-79323858 ACCTAACTACAAAGGTAGCAGGG + Intergenic
1073143443 10:101263827-101263849 AGCTGAGTATAGAGGCAGGAGGG + Intergenic
1077598272 11:3553522-3553544 TTCTGAGGACACAGGCAGCAAGG - Intergenic
1078734344 11:14006410-14006432 AGATAAGAACAGAGGCAGGAAGG + Intronic
1080698564 11:34624346-34624368 ATCTGAAGACAGAGGCAGGAGGG + Intronic
1082640809 11:55658248-55658270 ACCAAAGTCCAGAGGCAGCAGGG + Intergenic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1084254350 11:67929388-67929410 TTCTGAGGACACAGGCAGCAAGG - Intergenic
1084818522 11:71666495-71666517 TTCTGAGGACACAGGCAGCAAGG + Intergenic
1084874778 11:72123271-72123293 ATCTAAGTACTGAGGGAGAGAGG + Intronic
1087153496 11:94879447-94879469 ATAAAAGTACAGAAGCAACATGG - Intergenic
1088299037 11:108335622-108335644 ATCTAATTACAGAAGTAGCGAGG + Intronic
1089863916 11:121615338-121615360 AGCCAAGTACAGAGGCAAGAGGG - Intronic
1091143948 11:133260852-133260874 ATCTATGTACTAAGGCATCAAGG - Intronic
1093187337 12:16035760-16035782 ATCAAAGGACAGAATCAGCAAGG - Intronic
1095928540 12:47603653-47603675 CACCAAGTACAGATGCAGCAAGG + Intergenic
1097385778 12:58948758-58948780 ACAAAAGTACACAGGCAGCAAGG - Intergenic
1097985197 12:65775641-65775663 ATCTAAGTACAGAGGTTTGAGGG - Intergenic
1100173386 12:92002791-92002813 AGTGAAGTACAGAGGCACCAAGG + Intronic
1104415827 12:128596072-128596094 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104415944 12:128596655-128596677 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104690569 12:130822930-130822952 ATCCAGCTACAGAAGCAGCAAGG + Intronic
1105660783 13:22492165-22492187 ATCCAAGTCCAGAAGCAACATGG + Intergenic
1112798441 13:103083591-103083613 ATCTAAGTCCAGAAGTAGCGGGG - Intergenic
1113556503 13:111239771-111239793 ATCTTAGTCCAGATACAGCAAGG - Intronic
1114396109 14:22363143-22363165 ATCTAAGTACAGAAGGACCATGG + Intergenic
1116324927 14:43520528-43520550 ATCTAAGAACTGAGGTTGCAGGG + Intergenic
1117096812 14:52306876-52306898 ATATATTTACTGAGGCAGCATGG - Intergenic
1118724936 14:68622241-68622263 CTCTAAGTACAGGGGCATCATGG + Intronic
1119934853 14:78582615-78582637 ATCTCATGACAGAGGCAGAAGGG - Intronic
1120341866 14:83231069-83231091 ATCTAAGTACACATGTAGAATGG - Intergenic
1122369936 14:101224007-101224029 ACCGAAGAACAGAGGCAGGAAGG + Intergenic
1124852692 15:33356118-33356140 ATCTAAGTGAAGGAGCAGCATGG + Intronic
1130240135 15:82180217-82180239 ATCTGAGTAGAGAGACAGTAAGG - Intronic
1131730140 15:95270800-95270822 ATCTTAGCTCAAAGGCAGCAAGG - Intergenic
1132230968 15:100183998-100184020 TTCTGGGTACAGAGACAGCAGGG + Intronic
1133604939 16:7377762-7377784 ATTTAAGTTCTGAGACAGCAGGG - Intronic
1134300594 16:12987178-12987200 ATCTACGGACAGAGGCACAAAGG - Intronic
1135661142 16:24297700-24297722 ATCTAAGAACAGAAGCATAAGGG + Intronic
1137048198 16:35687424-35687446 ATCTAATTACAGAGATACCATGG - Intergenic
1137052316 16:35724640-35724662 ATCTAATGATAGAGGCAGCTTGG - Intergenic
1137740494 16:50766954-50766976 AACTTAGTAAAGAAGCAGCAGGG + Intronic
1137984085 16:53093072-53093094 ATTAAAGTGCAGATGCAGCAGGG - Intronic
1138000473 16:53273864-53273886 TTTTGAGTACAGAGACAGCATGG + Intronic
1139952066 16:70677388-70677410 GTCTGAGTGCAGTGGCAGCAGGG + Intronic
1141205167 16:81927919-81927941 AACTCAGTACAGAGGAAGCAAGG - Intronic
1142404356 16:89879064-89879086 ATCTGTGTACACAGACAGCACGG - Intronic
1143163724 17:4887120-4887142 ATATGAGTACAGCGGCAGCGAGG + Exonic
1148522511 17:48293731-48293753 AGCTAAGTAAAGAGGGAACATGG + Intronic
1154499140 18:14986050-14986072 ATCTGAGTATAGAAGCAACAAGG + Intergenic
1157213308 18:45762017-45762039 ATCTAAGTACACAGACATCCAGG + Intergenic
1163115377 19:15185703-15185725 ATCTCAGAACAAAGTCAGCAGGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1166167916 19:41005354-41005376 ATGTAAATGCAGAGGCTGCATGG + Intronic
926514377 2:13823172-13823194 ATCTAATTACAAAGACAACATGG + Intergenic
926924124 2:17969363-17969385 ATCACGATACAGAGGCAGCAGGG + Intronic
926937973 2:18105023-18105045 TTCTCAGCACAGAGGCAGCCTGG + Intronic
929306119 2:40364024-40364046 ATATGAGTACAGAGGTAACATGG - Intronic
931085104 2:58821338-58821360 TTCTAAGTACACAGGGACCAGGG + Intergenic
932176527 2:69607904-69607926 ATCTGAGTACAATGGCAACAGGG + Intronic
934092354 2:88563311-88563333 CTATAAGTACAGAGGCAGGCAGG - Intronic
934298230 2:91760354-91760376 ACCTAAATACAGAAGCAGTAAGG + Intergenic
935546195 2:104402176-104402198 ATCTAAGTACTCTGGCAGCAAGG - Intergenic
937627953 2:124064950-124064972 ATGTAAGTACAGAGGGGTCACGG - Intronic
937784068 2:125874616-125874638 ATCTAATAACAGAGGCATAATGG + Intergenic
938498110 2:131814159-131814181 ATCTGAGTATAGAAGCAGCGAGG + Intergenic
941103521 2:161325127-161325149 AACTAAGGACATATGCAGCAGGG + Intronic
942608582 2:177717614-177717636 ATCTAAGTAAAGAGTCAGCCAGG + Intronic
944399718 2:199311434-199311456 AGCTAATTACTGAGGCAGCTGGG - Intronic
945709704 2:213280095-213280117 ATCTAAGAATTGAGTCAGCATGG - Intergenic
945712414 2:213315303-213315325 ACCTGAGGCCAGAGGCAGCAGGG - Intronic
947112847 2:226738098-226738120 ATCTAATTATAGAGACAACAAGG + Intronic
1169829060 20:9803008-9803030 AGCTAAGTACAGAGCCACTAAGG + Intronic
1170485174 20:16808182-16808204 ATCCAAGAACAGAAGCAGGATGG - Intergenic
1173420314 20:42895310-42895332 ATCAGAGTACACAGGCACCAAGG - Intronic
1173645901 20:44632982-44633004 ATCTAAGAACAGAGCGTGCATGG - Intronic
1174537694 20:51265251-51265273 AACTAAGTACAGAAGAAGCCAGG + Intergenic
1176211971 20:63929037-63929059 ATCTAAGTTCAGCGGCACCAAGG - Intronic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1177174250 21:17687571-17687593 ACCAAAGTACACAGGCAACAAGG - Intergenic
1185065902 22:48631568-48631590 ATCTGGGTAATGAGGCAGCAGGG - Intronic
949127752 3:466822-466844 ATGGAAATACAGAGCCAGCAAGG - Intergenic
950752177 3:15138344-15138366 TTCTGAGGACACAGGCAGCAAGG + Intergenic
953093107 3:39749255-39749277 ATCTATGAACAGTGGAAGCATGG - Intergenic
955408762 3:58642539-58642561 TTCTAAGAACAGAGGCAGAGAGG + Intronic
955441994 3:58966259-58966281 TTCTAAGAACAGAGGCAGAGAGG + Intronic
955519253 3:59759094-59759116 ATTTAAGTAAAGGGGCAGGAAGG + Intronic
955656375 3:61249436-61249458 ATCTAAGTACAGAGGCAGCATGG + Intronic
959965154 3:112345710-112345732 ATCTAAGGACAGAGCCAGATTGG + Intronic
960200246 3:114825526-114825548 GTCTGAGTAAAGAGGCTGCATGG - Intronic
962422978 3:135244229-135244251 ATCTAATTAAAGAGGCAGGGAGG - Intronic
963017702 3:140841346-140841368 ATCTAAGAAAAGAAGCAGCCAGG - Intergenic
963868987 3:150393434-150393456 TTATAATTACAGAGGCAGCAAGG + Intergenic
966912417 3:184566807-184566829 AACTAAAGACAGAAGCAGCAAGG - Intronic
967299710 3:188000767-188000789 GTCAAAGTGCAGAGGCAGTAGGG + Intergenic
971994986 4:33954519-33954541 ATTTCAGTACAGACACAGCAGGG + Intergenic
973330283 4:48905767-48905789 ATGTGATTACAGGGGCAGCACGG + Intronic
975860227 4:78669299-78669321 ATCTAAGAGATGAGGCAGCATGG + Intergenic
976771165 4:88653907-88653929 ATCCAAGTACAGATGCAGGCAGG + Intronic
978004080 4:103595441-103595463 ATCTAACTACGTAGGCAGGATGG + Intronic
978925902 4:114243724-114243746 AACTAAGAACAGAGACAGAAAGG - Intergenic
978949053 4:114535115-114535137 ATCAAAGAACAGAAGCAACATGG - Intergenic
981216885 4:142180018-142180040 ATCAAAGTACAGAGTAAGAAAGG + Intronic
982956472 4:161774313-161774335 TTCCAAGTTCAGAGGAAGCATGG + Intronic
985267130 4:188160652-188160674 ATCTCACTGCAGAGGCAGCCAGG + Intergenic
985617998 5:936214-936236 CTCTAAGCCCAGAGGCAGCCTGG + Intergenic
986828845 5:11552061-11552083 AAATAAAGACAGAGGCAGCAGGG - Intronic
987188695 5:15451207-15451229 AGCTAGGTCCAGAGGCAGGATGG - Intergenic
988835529 5:35028725-35028747 ATTTAAGTTCAGAGACTGCATGG - Intronic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
993304565 5:86259330-86259352 AACAAAATACAGAGGCAGAATGG + Intergenic
994745922 5:103678186-103678208 AGCTCAGGACAGAGGAAGCAAGG + Intergenic
995525668 5:113048987-113049009 ATACAAGAACTGAGGCAGCAGGG + Intronic
996409204 5:123138798-123138820 GTCTAAGGAGAGAAGCAGCAGGG + Intronic
999798640 5:155011627-155011649 ATGCAATTACAGAGTCAGCAGGG - Intergenic
1000863117 5:166480004-166480026 TTCTAGGTACAGAGGAAGAACGG + Intergenic
1001332410 5:170771708-170771730 ACCAAAGTTCAGAGGCATCAGGG + Intronic
1003492683 6:6637393-6637415 GTCAAAGTACAGTTGCAGCATGG - Intronic
1003601942 6:7525880-7525902 ACCAAAGCACAGAGGCAGGAAGG + Intergenic
1003644449 6:7903119-7903141 TTCAAAGTTCAGGGGCAGCAGGG - Intronic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1011228843 6:85137462-85137484 ATCTAAGTAAGGAGGGAGGATGG - Intergenic
1012671126 6:102049243-102049265 ATGTAAGTTCAAAGGCAGAAAGG + Intronic
1018085005 6:160293913-160293935 ATTTCAGAACAGAGGCAGAAGGG + Intergenic
1021662238 7:22931194-22931216 ATCTAATGACAGAGACAGAATGG + Intergenic
1024472493 7:49777361-49777383 ATATAAGTACAAAGCCAGGAAGG + Intronic
1025048566 7:55714300-55714322 AGTTAAACACAGAGGCAGCATGG + Intergenic
1025225746 7:57161117-57161139 ATTTAAATTCAGAGGCAGCCTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1031528499 7:122850024-122850046 ATCAAACTGCAGATGCAGCAGGG - Intronic
1033427091 7:141254216-141254238 ACCAAAGTACAGAGGCAGCATGG + Intronic
1035367060 7:158355903-158355925 AGATAAGCAGAGAGGCAGCAGGG - Intronic
1036246288 8:7119846-7119868 TTCTGAGGACAGAGGCAGCAAGG + Intergenic
1044498745 8:92926236-92926258 ATTTAAGTACAGAGACATCATGG - Intronic
1050014259 9:1217113-1217135 ATCTTAGAACAGACGAAGCAAGG - Intergenic
1051062805 9:13064668-13064690 ATTTAAGTACAGAGGACTCAGGG - Intergenic
1052789944 9:32866009-32866031 ATGCAAGTACACAGGCAGTAGGG + Intergenic
1054990058 9:71314884-71314906 ATCAACGTTCAGAGGCAGCGTGG + Intronic
1056857155 9:90141493-90141515 AGGTCAGGACAGAGGCAGCAGGG + Intergenic
1057306585 9:93916006-93916028 AATTAAGTGGAGAGGCAGCAAGG + Intergenic
1057971342 9:99561238-99561260 ATCAAAGTAAAGAGGTAGGAGGG + Intergenic
1058647817 9:107146728-107146750 ATCTCACTGCACAGGCAGCAGGG - Intergenic
1058684589 9:107469051-107469073 TGCTGAGTACAGAGACAGCATGG + Intergenic
1059773335 9:117448688-117448710 TTCTAAGTTAGGAGGCAGCATGG - Intergenic
1060861065 9:126955219-126955241 ATATAAGTTCCGTGGCAGCAGGG + Intronic
1186018735 X:5229295-5229317 ATATATGTACATATGCAGCAGGG + Intergenic
1186722054 X:12315499-12315521 AGCAAAGAACAGAGGCAGCCTGG + Intronic
1188954692 X:36420048-36420070 ATCTAAGATCAGTGTCAGCAGGG - Intergenic
1193453306 X:81698316-81698338 ATGTTAGTAAAGAGGCAGAATGG + Intergenic
1195993884 X:110712008-110712030 TTCCAAGTACAGATGCAGTAGGG - Intronic
1198078534 X:133217122-133217144 ATCTCAGTACAGTGGCTCCAGGG - Exonic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1198301361 X:135336737-135336759 TTCTGAGTACTGAGCCAGCATGG - Intronic