ID: 955656790

View in Genome Browser
Species Human (GRCh38)
Location 3:61252338-61252360
Sequence TCCAGCACCCACATGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955656790 Original CRISPR TCCAGCACCCACATGGCATT TGG (reversed) Intergenic
904927762 1:34062043-34062065 GCCAGCACACTCATGACATTGGG - Intronic
905498812 1:38419508-38419530 TCCAGTTCCCACATGTCAATAGG - Intergenic
905504107 1:38463276-38463298 TCCAGCACCCAAATGAGATTAGG - Intergenic
907517932 1:55005067-55005089 TCCAGCAGGCCCATGGCCTTTGG - Exonic
907783244 1:57586544-57586566 TCAACCACCCACATGGAATGAGG - Intronic
910755309 1:90683764-90683786 TGCATCACCCCCATGGCACTTGG - Intergenic
914263506 1:146019200-146019222 ACCAGCTCCCCCATGGCGTTGGG - Exonic
915453201 1:156020990-156021012 TACAACTCCCACAAGGCATTGGG - Intergenic
922037857 1:221866770-221866792 TCCAGTGCCCACAAGGCATATGG - Intergenic
924382164 1:243474976-243474998 TCCCTGACCCACATGGCAATGGG - Intronic
1063219759 10:3956202-3956224 TTCTTTACCCACATGGCATTGGG - Intergenic
1066792568 10:39081981-39082003 TCCATCTGCCACATGGAATTTGG + Intergenic
1067848469 10:49740532-49740554 TTCACCTCCCACATGGCCTTAGG + Intronic
1074405419 10:113176920-113176942 TCCTGCACCCACCTGGCCTTAGG - Intergenic
1075400691 10:122159422-122159444 TGCAGCACCCACATGTCAACAGG - Intronic
1076418403 10:130309253-130309275 TCCTGCACACACAGGACATTCGG - Intergenic
1077101848 11:825957-825979 TCCAGCACCCTCAGGCCATGGGG - Intergenic
1077132699 11:981505-981527 TCCTCCACCCACATGGTGTTGGG - Intronic
1077171066 11:1165959-1165981 TCCAGCACCCACCCAGCATTGGG + Intronic
1077895905 11:6453130-6453152 TGCAGCACTGATATGGCATTTGG + Intronic
1078725865 11:13930414-13930436 TCCACCAACCACATGACCTTGGG - Intergenic
1078932442 11:15922634-15922656 TCCAGCACCCAGCTGGGAGTAGG + Intergenic
1080155094 11:29101063-29101085 TCCAGGACCCACAGTGCTTTTGG + Intergenic
1080807065 11:35663100-35663122 CACAGCACCCACATGGCCTCTGG + Exonic
1083320559 11:61843456-61843478 TGCAGCGCCCAGATGGCACTGGG - Intronic
1084111321 11:67015806-67015828 TCCTGCACTCACATGGCTTCTGG - Intronic
1084675880 11:70634078-70634100 CCCAGGACCCACGTGGCACTTGG - Intronic
1085056222 11:73405658-73405680 GCCAGCACCCACCTGGAATGTGG + Intronic
1085206509 11:74736496-74736518 TCGAGCACCCACAATGCATCAGG - Intergenic
1090374215 11:126277553-126277575 TCCAGCAGGCCCCTGGCATTGGG + Exonic
1090931521 11:131301910-131301932 TCCAGCTCCCCCATGATATTAGG + Intergenic
1092025242 12:5234248-5234270 TCAAGCACCCACATTGCAGCTGG - Intergenic
1092802484 12:12184210-12184232 TCAAGCACCTGCATGACATTTGG - Intronic
1101645969 12:106631326-106631348 TCCAGCACCCACATGTGGTAGGG - Intronic
1102076588 12:110064868-110064890 TCCTGCACCCACAGGCCACTGGG - Intronic
1104796983 12:131526841-131526863 TTCACCACCCACATGGCATGGGG - Intergenic
1105610965 13:21969578-21969600 TCCAGCCCCTAGATAGCATTAGG - Intergenic
1106407448 13:29486248-29486270 TACAGCAGACCCATGGCATTAGG - Intronic
1107966962 13:45605626-45605648 TCCAAAACACACATGACATTTGG - Intronic
1110336556 13:74338883-74338905 TCCAGCAGCTGCAGGGCATTAGG - Intergenic
1111927366 13:94477930-94477952 TCCAGCAGCCATATGCCCTTCGG - Intronic
1114547483 14:23513283-23513305 TCCAGCACCCGTTTGGGATTGGG - Intergenic
1118726902 14:68635065-68635087 TCCAGCACTCACCTTCCATTTGG + Intronic
1119470282 14:74892994-74893016 TCCAACTCCCACATGTCATGTGG + Intronic
1119854334 14:77888009-77888031 CCCAGCACCCACCTAGCATAGGG - Intronic
1125767139 15:42143499-42143521 ACCAGCACCCACATGGGAATGGG + Intronic
1127658363 15:61076739-61076761 TCAAGGACTCACATGCCATTAGG - Intronic
1128741442 15:70086511-70086533 TCCTGTACCCAAATTGCATTTGG + Intronic
1129062547 15:72871863-72871885 TCTGGCTCCCAAATGGCATTGGG - Intergenic
1130836338 15:87653709-87653731 ACCAGAACCCACATGTCCTTGGG + Intergenic
1133459929 16:5978578-5978600 TCCAGGTACCACATTGCATTTGG + Intergenic
1136228324 16:28873232-28873254 TCCTGCACCCTCATGCCCTTCGG + Intronic
1140364544 16:74371086-74371108 TCCAGCACCGGCATGGCTGTGGG + Intergenic
1141445809 16:84057436-84057458 TAAAGCACCCACATGGTAATGGG - Intronic
1143299440 17:5898772-5898794 TCCAGCCTCCACACAGCATTTGG - Intronic
1143682066 17:8482846-8482868 TCCAACAGCCACATCGCCTTTGG + Intronic
1144829696 17:18124352-18124374 TGCAGGACCCACCTGGCCTTGGG + Intronic
1152891475 17:82883939-82883961 CCCAGCTCCCACATGGCGTCTGG + Intronic
1153167548 18:2279834-2279856 TCCAGTGCCCTCACGGCATTCGG + Intergenic
1156472055 18:37383613-37383635 TACAGATGCCACATGGCATTTGG - Intronic
1160943593 19:1631092-1631114 ACCAACCCCCACCTGGCATTGGG + Intronic
1162930845 19:13956742-13956764 TCCAGCAGCCACTTGGAATGTGG + Intronic
1163205978 19:15803108-15803130 TCCAGCATCAGCATGGCACTTGG - Intergenic
1165481464 19:36067029-36067051 TGCAGCCCACACATGGTATTGGG - Intronic
1165651374 19:37493737-37493759 TCCAGGATCCACATGGCTATTGG + Intergenic
1168616386 19:57840527-57840549 TACAGCACTCACATGTCATGAGG + Intronic
1168620472 19:57875515-57875537 TACAGCACTCACATGTCATGAGG - Intronic
925461571 2:4067651-4067673 GCCAGCACCCACATGGCCTGTGG - Intergenic
925639853 2:5976908-5976930 TCAAGCACCCTGAGGGCATTAGG - Intergenic
927072013 2:19540559-19540581 CTCAGCACCCACAATGCATTTGG + Intergenic
927755208 2:25702741-25702763 TCCAGCCCTCACCTGGCAGTGGG + Intergenic
928746257 2:34419118-34419140 GCAAGCACCCACATGGCAAGAGG + Intergenic
930899351 2:56484682-56484704 ACCAGCTTCCACATGGCACTTGG - Intergenic
931434332 2:62234024-62234046 TTAAGGCCCCACATGGCATTTGG + Intergenic
932337754 2:70940531-70940553 TCCCACACCCACATGGTGTTTGG - Exonic
936020787 2:108993380-108993402 TCCAGCCCCCACGTGGAATGTGG - Intergenic
936041028 2:109149635-109149657 TTGAGCACCCACATGTCCTTTGG + Intronic
937058901 2:118967047-118967069 TCCAGCACCAACGTGGTATCTGG - Intronic
939369472 2:141279565-141279587 TCCAGTACCCCCAGGGCCTTAGG + Intronic
940183419 2:150958499-150958521 TCCTGCAGGCAGATGGCATTTGG - Intergenic
945310833 2:208310790-208310812 TCAAGTTCACACATGGCATTTGG - Intronic
945842572 2:214905488-214905510 TGCAGAATCCACTTGGCATTGGG + Intergenic
946003200 2:216500080-216500102 TCCAGCAGCAACCTGGAATTTGG - Intronic
946778397 2:223168047-223168069 TCAAGCACTCACATGGTCTTTGG + Intronic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
1170552191 20:17487672-17487694 CCCAAAACTCACATGGCATTTGG - Intergenic
1174195430 20:48769436-48769458 CCCAGCACCCACTAGGCATGGGG + Intronic
1175856587 20:62123659-62123681 TCCAGCACACACACGGGCTTAGG - Intronic
1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG + Intronic
1178088876 21:29140649-29140671 TCCATCAACCCCATGGCCTTTGG - Intronic
1179352936 21:40630646-40630668 TCCATCACCCACCTGGATTTAGG + Intronic
1179678195 21:42999147-42999169 GGCAGCTTCCACATGGCATTGGG - Intronic
1179965179 21:44800449-44800471 TGCAGCACTTACATTGCATTAGG + Intronic
1182114388 22:27747109-27747131 TCCCGCTCCAACCTGGCATTGGG + Intergenic
1182677889 22:32054301-32054323 ATCAGCACCTACATGGCATCTGG - Intronic
950503244 3:13377526-13377548 TCCAGCACCCACCTGTCACCAGG + Exonic
954222688 3:49164195-49164217 ACCACCACACTCATGGCATTAGG + Exonic
954654647 3:52186479-52186501 TCCAGCACCTCCTTGGCACTGGG + Intergenic
955656790 3:61252338-61252360 TCCAGCACCCACATGGCATTTGG - Intergenic
961809004 3:129510699-129510721 TCCAGGACCTACATGGGACTAGG + Intronic
966528620 3:180947885-180947907 ACCACCACCCACATGGCTCTTGG - Exonic
968123620 3:196143079-196143101 TCCAGCACCCTGATGGCCATGGG - Intergenic
968665315 4:1818207-1818229 TGGAGAACCCACATGGCATGAGG + Intronic
971257155 4:25025032-25025054 TCCTGCTACCACATGGAATTTGG - Intronic
972719825 4:41684875-41684897 TCCAGCACCCACATCTCACCCGG - Intronic
984236085 4:177160203-177160225 TCGAGCACACACATGCCACTGGG - Intergenic
985126664 4:186701567-186701589 CCCAGCTCCCACAGGGCATCAGG + Intronic
985905251 5:2830232-2830254 TCCAGCCCCCACATGGGATCAGG + Intergenic
992947154 5:81822160-81822182 TCCATCACCCACAGGGACTTTGG - Intergenic
993026896 5:82657481-82657503 TCAAGCACCCACTTGGCAGTGGG + Intergenic
999185308 5:149703100-149703122 TCCAGCACCCACAAGGCTGGAGG + Intergenic
1000611188 5:163377013-163377035 TCAAGCAACATCATGGCATTCGG + Intergenic
1000728507 5:164801969-164801991 GGCAGCTCTCACATGGCATTGGG - Intergenic
1001383448 5:171318642-171318664 TCCAGCACCCAGCTACCATTTGG + Intergenic
1003038289 6:2664103-2664125 TCCAGCACCCACTTCCCTTTAGG + Exonic
1003515900 6:6818624-6818646 TCCAGCTCCCAGGTGGCATTTGG + Intergenic
1003744672 6:8987258-8987280 TTCAGCCCCCACATGGCGTGTGG + Intergenic
1004167230 6:13267454-13267476 TTCAGCAGCCACATGGAAGTGGG - Exonic
1007844265 6:44740702-44740724 CCCAGAACCCACATGGCACGTGG + Intergenic
1008839428 6:55882689-55882711 TCAAGCATCCAAATGACATTTGG - Intergenic
1015634666 6:135263684-135263706 TCCAGCAGCGACACAGCATTTGG + Intergenic
1016252877 6:142067918-142067940 TCAAACAGCCATATGGCATTAGG - Intronic
1019276216 7:177335-177357 TCCAGTAACCACAGGGCCTTGGG - Intergenic
1024646446 7:51375008-51375030 TCAAGAAACCACATGGCATTTGG + Intergenic
1024968769 7:55049920-55049942 TCCAAAACACACATGGCATCTGG + Intronic
1025113043 7:56235508-56235530 GCCAGCACCCACAGGCCATGGGG + Intergenic
1025810710 7:64873751-64873773 TCCTGGAGCCACATGGCAGTGGG + Intronic
1025811125 7:64876237-64876259 TCCTGGAGCCACATGGCAGTGGG + Intronic
1025811537 7:64878724-64878746 TCCCGGAGCCACATGGCAGTGGG + Intronic
1030276456 7:107726719-107726741 TACAGCATCCACATGAAATTGGG + Intergenic
1031561812 7:123248139-123248161 TCCATCACCCACTTGGTTTTCGG + Intergenic
1034068400 7:148158730-148158752 TCCAACATCCTCATGGCAATTGG + Intronic
1034704371 7:153127418-153127440 CCCCCCACCCTCATGGCATTGGG + Intergenic
1035000560 7:155609389-155609411 GTCAGCAGCCACATGGGATTAGG - Intergenic
1036405943 8:8455374-8455396 AGCAGGACCCACAGGGCATTGGG + Intergenic
1037878918 8:22563420-22563442 TCCAGCACCCTCATGGAACTAGG + Intronic
1039571103 8:38587083-38587105 TCCAGTACCCAAAGGGCACTTGG - Intergenic
1042368100 8:67959571-67959593 GCAAGCACCCCCATGGCACTGGG + Intronic
1044583546 8:93846762-93846784 TCTTGCACGCACATGCCATTTGG + Intergenic
1045394996 8:101751627-101751649 CCCAGCAGCCACATGTCACTGGG + Intronic
1048744136 8:137594349-137594371 TCCAGCAGCCATATTGTATTAGG - Intergenic
1049359218 8:142204035-142204057 TCCAGCTGCCACGTGGCCTTGGG + Intergenic
1051544443 9:18258624-18258646 TCCAGGACCCTCATGGCACCAGG + Intergenic
1055197911 9:73619419-73619441 TCCAGTACCCAGAGGGCAGTAGG - Intergenic
1056837608 9:89969887-89969909 TCCAGTAACCACAGGGCAGTAGG + Intergenic
1057328038 9:94084522-94084544 TCCTGCACCTGCATGGCACTGGG - Exonic
1057860239 9:98635241-98635263 TCTAGCAACCACAGGGCATTTGG + Intronic
1060392826 9:123292443-123292465 TTGAGCACCCACATTGCATCAGG - Intergenic
1060597511 9:124857079-124857101 TCCATGACCCAAATGGCATCAGG + Intronic
1061916557 9:133758408-133758430 TCCAACACTCTCCTGGCATTGGG - Intergenic
1185698822 X:2215064-2215086 TTCCGCACTCACATGGCATCTGG + Intergenic
1186372328 X:8959882-8959904 TCCAGATCCCACACTGCATTTGG - Intergenic
1192727206 X:73765886-73765908 TCCAGCACCAGCATGGCATATGG - Intergenic
1198008120 X:132519687-132519709 TCCATCAGCCATGTGGCATTGGG + Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200787936 Y:7275221-7275243 TCCAGCGCCCACATGCCGCTGGG - Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201377224 Y:13335880-13335902 TCCAGTACCCACATTGCCATTGG + Exonic