ID: 955661389

View in Genome Browser
Species Human (GRCh38)
Location 3:61303138-61303160
Sequence CTTATGTTCTCAAAGTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955661386_955661389 30 Left 955661386 3:61303085-61303107 CCTATTAGTCAAGGTATTTTTTT No data
Right 955661389 3:61303138-61303160 CTTATGTTCTCAAAGTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955661389 Original CRISPR CTTATGTTCTCAAAGTGTCA GGG Intergenic
No off target data available for this crispr