ID: 955662533

View in Genome Browser
Species Human (GRCh38)
Location 3:61316506-61316528
Sequence CTGGAGCCACAGTTGCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955662530_955662533 19 Left 955662530 3:61316464-61316486 CCAATACACAATATCAGTAAATG No data
Right 955662533 3:61316506-61316528 CTGGAGCCACAGTTGCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955662533 Original CRISPR CTGGAGCCACAGTTGCAAAC TGG Intergenic
No off target data available for this crispr