ID: 955666036

View in Genome Browser
Species Human (GRCh38)
Location 3:61350053-61350075
Sequence CTATGGGCACGGATTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955666030_955666036 19 Left 955666030 3:61350011-61350033 CCTCACAGGGGTGAGGCTGATAA No data
Right 955666036 3:61350053-61350075 CTATGGGCACGGATTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955666036 Original CRISPR CTATGGGCACGGATTGAGGC AGG Intergenic
No off target data available for this crispr