ID: 955666991

View in Genome Browser
Species Human (GRCh38)
Location 3:61360307-61360329
Sequence ACCAGACAGCTGGCCAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955666989_955666991 4 Left 955666989 3:61360280-61360302 CCATTCTTGGCTTTTGAGGGGCA No data
Right 955666991 3:61360307-61360329 ACCAGACAGCTGGCCAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955666991 Original CRISPR ACCAGACAGCTGGCCAGATT TGG Intergenic
No off target data available for this crispr