ID: 955671100

View in Genome Browser
Species Human (GRCh38)
Location 3:61404172-61404194
Sequence TATCAAGGAGTCTCTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955671098_955671100 7 Left 955671098 3:61404142-61404164 CCTTGGCTTGTAGAACAGAGGGA No data
Right 955671100 3:61404172-61404194 TATCAAGGAGTCTCTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955671100 Original CRISPR TATCAAGGAGTCTCTGCTCC AGG Intergenic
No off target data available for this crispr